ID pB10D8 standard; DNA; FUN; 666 BP. AC pB10D8; FH Key Location/Qualifiers FH FT CDS 994..2652 FT /colour=7 FT /gene="SPBPB10D8.01" FT /label=SPBPB10D8.01 FT /product="putative allantoate permease; major facilitator FT family" FT /fasta_file="fasta/pB10D8.tab.seq.04367.out" FT CDS complement(3466..5130) FT /colour=7 FT /gene="SPBPB10D8.02c" FT /label=SPBPB10D8.02c FT /product="putative arylsulfatase; contains sulphatase FT domain" FT /fasta_file="fasta/pB10D8.tab.seq.04368.out" FT CDS complement(join(1370070..1370493,1370586..1370635, FT 1370714..1370803)) FT /colour=10 FT /gene="SPBP22H7.10c" FT /gene="SPBC32H8.01c" FT /label=SPBP22H7.10c FT /note="SPBP22H7.10c, len:187, SIMILARITY:Saccharomyces FT cerevisiae, YEV8_YEAST, hypothetical 23.5 kD protein in FT rsp5-pak1 intergenic region.hypothetical 23.5 kD protein FT in lcp5-pak1 intergenic region., (203 aa), fasta scores: FT opt: 156, E():0.0094, (22.6% identity in 146 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YER128W" FT /fasta_file="fasta/p22H7.tab.seq.04391.out" FT /label=SPBC32H8.01c FT /note="SPBC32H8.01c, len:187, SIMILARITY:Saccharomyces FT cerevisiae, YEV8_YEAST, hypothetical 23.5 kD protein in FT rsp5-pak1 intergenic region.hypothetical 23.5 kD protein FT in lcp5-pak1 intergenic region., (203 aa), fasta scores: FT opt: 156, E():0.0094, (22.6% identity in 146 aa)" FT /fasta_file="fasta/c32H8.tab.seq.04295.out" FT CDS join(114377..114497,114544..115688) FT /colour=2 FT /fasta_file="fasta/c1198.tab.seq.00031.out" FT /gene="mfr1" FT /gene="SPBC1198.12" FT /gene="SPBC660.02" FT /label=SPBC1198.12 FT /note="SPBC1198.12, len:421, FT SIMILARITY:Schizosaccharomyces pombe, O13286, srw1., (556 FT aa), fasta scores: opt: 1361, E():0, (51.6% identity in FT 372 aa)" FT /product="WD repeat protein; meiosis-specific activator of FT APC; fizzy-related; similar to S. cerevisiae CDH1" FT /label=SPBC660.02 FT /note="SPBC660.02, len:421, SIMILARITY:Schizosaccharomyces FT pombe, O13286, srw1., (556 aa), fasta scores: opt: 1364, FT E():0, (50.6% identity in 385 aa)" FT /fasta_file="fasta/c660.tab.seq.03094.out" FT CDS complement(join(115689..115943,116047..116190, FT 116250..116774)) FT /colour=7 FT /fasta_file="fasta/c1198.tab.seq.00032.out" FT /gene="SPBC1198.13c" FT /gene="SPBC660.03c" FT /label=SPBC1198.13c FT /note="SPBC1198.13c, len:307, SIMILARITY:Saccharomyces FT cerevisiae, T2FB_YEAST, transcription initiation factor FT iif, beta subunit, (400 aa), fasta scores: opt: 461, FT E():1.1e-22, (31.0% identity in 368 aa)" FT /product="transcription initiation factor TFIIF, beta FT subunit" FT /label=SPBC660.03c FT /note="SPBC660.03c, len:307, SIMILARITY:Saccharomyces FT cerevisiae, T2FB_YEAST, transcription initiation factor FT iif, beta subunit, (400 aa), fasta scores: opt: 461, FT E():1.4e-22, (31.0% identity in 368 aa)" FT /fasta_file="fasta/c660.tab.seq.03095.out" FT CDS 1243439..1243768 FT /colour=9 FT /gene="SPBC30B4.10" FT /gene="SPBC27B12.02" FT /note="SPBC30B4.09, 109aa" FT /product="very hypothetical protein" FT /fasta_file="fasta/c30B4.tab.seq.02595.out" FT /label=SPBC27B12.02 FT /note="SPBC27B12.02, len:109aa" FT /fasta_file="fasta/c27B12.tab.seq.02665.out" FT CDS complement(362330..363472) FT /colour=2 FT /gene="eca39" FT /gene="SPBC582.12c" FT /gene="SPBC428.02c" FT /EC_number="2.6.1.42" FT /label=eca39 FT /note="SPBC582.12c, len:380" FT /product="branched-chain amino acid aminotransferase; FT mitochondrial; similar to S. cerevisiae BAT1" FT /fasta_file="fasta/c582.tab.seq.03882.out" FT /note="SPBC428.02c, len:380" FT /fasta_file="fasta/c428.tab.seq.03582.out" FT CDS complement(join(981669..982334,982409..982516, FT 982573..982640,982695..982861,982918..982973, FT 983023..983076)) FT /colour=2 FT /gene="cdc27" FT /gene="SPBC1734.02c" FT /gene="SPBC337.18c" FT /label=cdc27 FT /note="SPBC337.18c, len:372" FT /product="DNA polymerase delta subunit; required for G2/M FT phase transition (PMID: 1538696); interacts with Pcn1p FT (PMID: 10698951); interacts with Cdc1p; similar to S. FT cerevisiae POL32" FT /fasta_file="fasta/c337.tab.seq.03501.out" FT /note="SPBC1734.02c, len:372" FT /product="DNA polymerase delta subunit; required for G2/M FT phase transition (PMID: 1538696); interacts with Pcn1p FT (PMID:10698951); interacts with Cdc1p; similar to S. FT cerevisiae POL32" FT /fasta_file="fasta/c1734.tab.seq.03282.out" FT CDS 984040..986100 FT /EC_number="2.5.1.15" FT /colour=7 FT /gene="SPBC1734.03" FT /gene="SPBC337.19" FT /label=SPBC337.19 FT /note="SPBC337.19, len:686, SIMILARITY:Pneumocystis FT carinii , FAS_PNECA, folic acid synthesis protein, (740 FT aa), fasta scores: opt: 919, E():0, (41.4% identity in 701 FT aa)" FT /product="dihydropteroate synthase" FT /fasta_file="fasta/c337.tab.seq.03502.out" FT /label=SPBC1734.03 FT /note="SPBC1734.03, len:685, SIMILARITY:Pneumocystis FT carinii., FAS_PNECA, folic acid synthesis protein FT [includes: dihydroneopterin aldolase(ec 4.1.2.25), (740 FT aa), fasta scores: opt: 919, E():0, (41.4% identity in 701 FT aa)" FT /fasta_file="fasta/c1734.tab.seq.03283.out" FT CDS complement(join(1017999..1020779,1020911..1020984, FT 1021044..1021095,1021136..1021171)) FT /EC_number="6.1.1.9" FT /colour=7 FT /gene="SPBC1709.02c" FT /gene="SPBC1734.18c" FT /label=SPBC1734.18c FT /note="SPBC1734.18c, len:979, SIMILARITY:Saccharomyces FT cerevisiae, SYV_YEAST, valyl-tRNA synthetase, FT mitochondrial , (1104 aa), fasta scores: opt: 4207, E():0, FT (62.7% identity in 956 aa)" FT /product="valyl-tRNA synthetase, mitochondrial; similar to FT S. cerevisiae VAS1" FT /fasta_file="fasta/c1734.tab.seq.03298.out" FT /label=SPBC1709.02c FT /note="SPBC1709.02c, len:980, SIMILARITY:Saccharomyces FT cerevisiae, SYV_YEAST, valyl-tRNA synthetase, FT mitochondrial , (1104 aa), fasta scores: opt: 4207, E():0, FT (62.7% identity in 956 aa)" FT /fasta_file="fasta/c1709.tab.seq.03261.out" FT misc_feature complement(3628..5097) FT /note="Match to Sulfatase Score 274.42" FT CDS join(7426..7800,7802..8728) FT /colour=4 FT /gene="SPBPB10D8.03" FT /label=SPBPB10D8.03 FT /note="pB10D8.cand.2 score = 10.73" FT /product="pseudo transporter" FT /pseudo FT /fasta_file="fasta/pB10D8.tab.seq.04369.out" FT CDS complement(11423..12562) FT /colour=7 FT /gene="SPBPB10D8.04c" FT /label=SPBPB10D8.04c FT /product="putative malate permease" FT /fasta_file="fasta/pB10D8.tab.seq.04370.out" FT LTR complement(13216..13559) FT /note="854 (-1) 1 349 Tf2-type LTR" FT CDS complement(14182..15321) FT /colour=7 FT /gene="SPBPB10D8.05c" FT /label=SPBPB10D8.05c FT /product="putative malate permease" FT /fasta_file="fasta/pB10D8.tab.seq.04371.out" FT rRNA 1119581..1119765 FT /note="5s rRNA" FT /note="5S ribosomal RNA." FT LTR complement(15975..16318) FT /note="854 (-1) 1 349 Tf2-type LTR" FT CDS complement(16941..18080) FT /colour=7 FT /gene="SPBPB10D8.06c" FT /label=SPBPB10D8.06c FT /product="putative malate permease" FT /fasta_file="fasta/pB10D8.tab.seq.04372.out" FT LTR complement(18734..19077) FT /note="854 (-1) 1 349 Tf2-type LTR" FT CDS complement(19700..20839) FT /colour=7 FT /gene="SPBPB10D8.07c" FT /label=SPBPB10D8.07c FT /product="putative malate permease" FT /fasta_file="fasta/pB10D8.tab.seq.04373.out" FT LTR complement(21493..21836) FT /note="854 (-1) 1 349 Tf2-type LTR" FT misc_feature 25277..25389 FT /fasta_file="fasta/pB10D8.tab.seq.00013.out" FT /note="565 (+1) 1 113 SPBC359 S. pombe chromosome 2" FT CDS 27458..28570 FT /colour=7 FT /gene="SPBC359.02" FT /label=SPBC359.02 FT /note="SPBC359.02, len:370, SIMILARITY:Schizosaccharomyces FT pombe, O59828, putative alanine racemase., (375 aa), fasta FT scores: opt: 1629, E():0, (62.5% identity in 376 aa)" FT /product="putative alanine racemase; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c359.tab.seq.04196.out" FT CDS complement(31008..32747) FT /colour=7 FT /gene="SPBC359.03c" FT /label=SPBC359.03c FT /note="SPBC359.03c, len:579, FT SIMILARITY:Schizosaccharomyces pombe, CAB60021, amino-acid FT permease, (537 aa), fasta scores: opt: 2901, E():0, (81.0% FT identity in 531 aa)" FT /product="putative amino acid permease" FT /fasta_file="fasta/c359.tab.seq.04197.out" FT CDS complement(37951..39027) FT /colour=12 FT /gene="SPBC359.04c" FT /label=SPBC359.04c FT /note="SPBC359.04c, len:358, FT SIMILARITY:Schizosaccharomyces pombe, YAH2_SCHPO, FT hypothetical 62.9 kD protein c8a4.02c in chromosome i., FT (609 aa), fasta scores: opt: 323, E():6.7e-10, (28.6% FT identity in 315 aa)" FT /product="serine/threonine-rich protein; low similarity to FT cell surface proteins; predicted N-terminal signal FT sequence; similar to SPAC186.01, SPBC947.04; possibly S. FT pombe specific" FT /fasta_file="fasta/c359.tab.seq.04198.out" FT CDS 42446..46843 FT /colour=7 FT /gene="SPBC359.05" FT /label=SPBC359.05 FT /note="SPBC359.05, len:1465, FT SIMILARITY:Schizosaccharomyces pombe, YAWB_SCHPO, putative FT ATP-dependent permease c3f10.11c., (1478 aa), fasta FT scores: opt: 6358, E():0, (63.3% identity in 1472 aa)" FT /product="putative ABC multidrug or ion efflux transporter" FT /fasta_file="fasta/c359.tab.seq.04199.out" FT misc_feature 43193..44026 FT /note="Match to PF00664 ABC_membrane, ABC transporter FT transmembrane region. Score 181.94" FT misc_feature 44264..44785 FT /note="Match to PF00005 ABC_tran, ABC transporter Score FT 75.02" FT misc_feature 45152..45976 FT /note="Match to PF00664 ABC_membrane, ABC transporter FT transmembrane region. Score 211.68" FT misc_feature 46202..46753 FT /note="Match to PF00005 ABC_tran, ABC transporter Score FT 182.38" FT CDS 48524..49297 FT /colour=7 FT /gene="SPBC359.06" FT /label=SPBC359.06 FT /note="SPBC359.06, len:257, LOW SIMILARITY:Homo sapiens, FT Q13734, alpha-adducin., (662 aa), fasta scores: opt: 336, FT E():4.3e-15, (29.4% identity in 235 aa)" FT /product="putative class II aldolase and adducin N FT terminal domain; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c359.tab.seq.04200.out" FT misc_feature 48575..49186 FT /note="Match to PF00596 Aldolase_II, Class II Aldolase and FT Adducin N-terminal domain. Score 64.68" FT misc_feature 50777..51276 FT /note="nominal overlap with cosmid SPBC1683" FT misc_feature 50777..51276 FT /note="nominal overlap with cosmid SPBC359 S. pombe FT chromosome II" FT mRNA 52127..52319 FT /colour=3 FT /note="mRNA from spc08587 1 193" FT CDS 54002..55723 FT /colour=7 FT /gene="SPBC1683.01" FT /label=SPBC1683.01 FT /note="SPBC1683.01, len:573, FT SIMILARITY:Schizosaccharomyces pombe, YAEC_SCHPO, putative FT inorganic phosphate transporter c23d3.12., (559 aa), fasta FT scores: opt: 2395, E():0, (70.0% identity in 574 aa)" FT /product="MFS inorganic phosphate transporter" FT /fasta_file="fasta/c1683.tab.seq.04245.out" FT misc_feature join(54140..54780,54910..55648) FT /note="Match to PF00083 sugar_tr, Sugar (and other) FT transporter Score 132.74" FT LTR complement(56084..56254) FT /note="partial degraded TF1-type LTR" FT CDS 56743..57762 FT /colour=7 FT /gene="SPBC1683.02" FT /label=SPBC1683.02 FT /note="SPBC1683.02, len:339, SIMILARITY:Saccharomyces FT cerevisiae, ADA_YEAST, putative adenosine deaminase, (347 FT aa), fasta scores: opt: 723, E():0, (37.6% identity in 351 FT aa)" FT /product="putative adenosine deaminase" FT /fasta_file="fasta/c1683.tab.seq.04246.out" FT misc_feature 56917..57732 FT /note="Match to PF00962 A_deaminase, Adenosine/AMP FT deaminase Score 164.32" FT CDS complement(58224..59783) FT /colour=7 FT /gene="SPBC1683.03c" FT /label=SPBC1683.03c FT /note="SPBC1683.03c, len:519, SIMILARITY:Saccharomyces FT cerevisiae, Q08902, orf yor378w., (515 aa), fasta scores: FT opt: 2052, E():0, (58.0% identity in 509 aa)" FT /product="MFS transporter of unknown specificity" FT /fasta_file="fasta/c1683.tab.seq.04247.out" FT CDS 62111..64609 FT /EC_number="3.2.1.21" FT /colour=7 FT /gene="SPBC1683.04" FT /label=SPBC1683.04 FT /note="SPBC1683.04, len:832, SIMILARITY:Kluyveromyces FT marxianus, BGLS_KLUMA, beta-glucosidase , (845 aa), fasta FT scores: opt: 1274, E():0, (46.3% identity in 848 aa)" FT /product="beta-glucosidase (EC 3.2.1.21); glycosyl FT hydrolase; family 3; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c1683.tab.seq.00055.out" FT misc_feature 62204..64552 FT /note="Match to PF00933 Glyco_hydro_3, Glycosyl hydrolase FT family 3 Score 687.70" FT mRNA 66850..66967 FT /colour=3 FT /note="mRNA from spc06472 118 1" FT CDS 68449..70128 FT /colour=7 FT /gene="SPBC1683.05" FT /label=SPBC1683.05 FT /note="SPBC1683.05, len:559, SIMILARITY:Saccharomyces FT cerevisiae, THIY_YEAST, putative thiamine transporter FT yor192c., (599 aa), fasta scores: opt: 828, E():0, (26.8% FT identity in 512 aa)" FT /product="NCS1 allantoate transporter" FT /product="low affinity thiamine transporter" FT /fasta_file="fasta/c1683.tab.seq.04249.out" FT CDS complement(71513..72445) FT /colour=7 FT /gene="SPBC1683.06c" FT /label=SPBC1683.06c FT /note="SPBC1683.06c, len:310, SIMILARITY:Escherichia coli., FT YBEK_ECOLI, hypothetical 33.8 kD protein in leus-gltl FT intergenic region., (311 aa), fasta scores: opt: 838, FT E():0, (44.5% identity in 308 aa)" FT /product="putative inosine-uridine preferring nucleoside FT hydrolase" FT /fasta_file="fasta/c1683.tab.seq.04250.out" FT misc_feature complement(71516..72448) FT /note="Match to PF01156 IU_nuc_hydro, Inosine-uridine FT preferring nucleoside hydrolase Score 415.14" FT CDS 73261..75000 FT /colour=7 FT /gene="SPBC1683.07" FT /label=SPBC1683.07 FT /note="SPBC1683.07, len:579, SIMILARITY:Candida albicans, FT MALT_CANAL, alpha-glucosidase, (569 aa), fasta scores: FT opt: 1829, E():0, (46.4% identity in 571 aa)" FT /product="alpha-glucosidase" FT /fasta_file="fasta/c1683.tab.seq.04251.out" FT misc_feature 73312..74763 FT /note="Match to PF00128 alpha-amylase, Alpha amylase Score FT 438.67" FT CDS 77254..78927 FT /colour=2 FT /gene="ght4" FT /gene="SPBC1683.08" FT /label=ght4 FT /note="SPBC1683.08, len:557" FT /product="putative glucose transporter protein" FT /fasta_file="fasta/c1683.tab.seq.04252.out" FT misc_feature 77278..78654 FT /note="Match to PF00083 sugar_tr, Sugar (and other) FT transporter Score 447.24" FT CDS complement(80160..81854) FT /EC_number="1.6.99.13" FT /colour=2 FT /gene="frp1" FT /gene="SPBC1683.09c" FT /label=frp1 FT /note="SPBC1683.09c, len:564" FT /product="ferric reductase transmembrane component" FT /fasta_file="fasta/c1683.tab.seq.04253.out" FT mRNA 83388..83590 FT /colour=3 FT /note="mRNA from spc11163 8 210" FT CDS complement(84129..84857) FT /colour=7 FT /gene="SPBC1683.10c" FT /label=SPBC1683.10c FT /note="SPBC1683.10c, len:242, SIMILARITY:Arabidopsis FT thaliana, AAD12695, similar to yeast ccc1 protein., (250 FT aa), fasta scores: opt: 295, E():2.3e-11, (27.0% identity FT in 215 aa)" FT /product="similar to S. coelicolor glutamate synthase FT large subunit and plant nodulin-21 which possibly FT important for nitrogen fixation; contains 8 predicted FT transmembrane helices; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c1683.tab.seq.04254.out" FT CDS complement(86491..88047) FT /EC_number="4.1.3.1" FT /colour=7 FT /gene="SPBC1683.11c" FT /label=SPBC1683.11c FT /note="SPBC1683.11c, len:518, SIMILARITY:Emericella FT nidulans, ACEA_EMENI, isocitrate lyase, (536 aa), fasta FT scores: opt: 1045, E():0, (33.1% identity in 513 aa)" FT /product="isocitrate lyase (EC 4.1.3.1)" FT /fasta_file="fasta/c1683.tab.seq.04255.out" FT misc_feature complement(86534..88005) FT /note="Match to PF00463 ICL, Isocitrate lyase Score 329.92" FT CDS 88370..89818 FT /colour=7 FT /gene="SPBC1683.12" FT /label=SPBC1683.12 FT /note="SPBC1683.12, len:482, FT SIMILARITY:Schizosaccharomyces pombe, YAOI_SCHPO, putative FT transporter c11d3.18c., (498 aa), fasta scores: opt: 1312, FT E():0, (43.4% identity in 484 aa)" FT /product="MFS transporter of unknown specificity" FT /fasta_file="fasta/c1683.tab.seq.04256.out" FT misc_feature 88499..89728 FT /note="Pfam match to entry PF00083 sugar_tr, Sugar (and FT other) transporter, score -76.60, E-value 0.0004" FT CDS complement(join(89866..91561,91608..91690,91739..91763, FT 91804..91856)) FT /colour=7 FT /gene="SPBC1683.13c" FT /label=SPBC1683.13c FT /note="SPBC1683.13c, len:618, FT SIMILARITY:Schizosaccharomyces pombe, O74915, putative FT transcriptional activator, zinc finger containing., (684 FT aa), fasta scores: opt: 574, E():1.3e-30, (27.3% identity FT in 611 aa)" FT /product="putative transcriptional activator; zinc finger FT protein; fungal Zn(2)-Cys(6) binuclear cluster domain" FT /fasta_file="fasta/c1683.tab.seq.04257.out" FT misc_feature complement(91562..91573) FT /colour=6 FT /note="ctgacatagaag, splice branch and acceptor" FT misc_feature complement(91602..91607) FT /colour=6 FT /note="gtaatt, splice donor sequence" FT misc_feature complement(91691..91710) FT /colour=6 FT /note="ctaatagaattgttctgtag, splice branch and acceptor" FT misc_feature complement(91692..91808) FT /note="Pfam match to entry PF00172 Zn_clus, fungal Zn(2)- FT Cys(6) binuclear cluster domain, score 41.30, E-value 2.1e- FT 08" FT misc_feature complement(91733..91738) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(91764..91779) FT /colour=6 FT /note="ctaattgaatgcgtag, splice branch and acceptor" FT misc_feature complement(91798..91803) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 92077..92575 FT /note="nominal overlap with cosmid SPBC1198 S. pombe FT chromosome 2" FT CDS 92690..93961 FT /colour=7 FT /fasta_file="fasta/c1198.tab.seq.00020.out" FT /gene="SPBC1198.01" FT /label=SPBC1198.01 FT /note="SPBC1198.01, len:423, SIMILARITY:Methylobacter FT marinus, FADH_METMR, glutathione-dependent formaldehyde FT dehydrogenase, (424 aa), fasta scores: opt: 1000, E():0, FT (40.7% identity in 388 aa)" FT /product="putative glutathione-dependent formaldehyde FT dehydrogenase" FT misc_feature join(92801..93584,93645..93946) FT /note="Match to PF00107 adh_zinc, zinc binding FT dehydrogenases Score 148.09" FT CDS 94541..95644 FT /colour=7 FT /fasta_file="fasta/c1198.tab.seq.00021.out" FT /gene="SPBC1198.02" FT /label=SPBC1198.02 FT /note="SPBC1198.02, len:367, SIMILARITY:Saccharomyces FT cerevisiae, ADA_YEAST, putative adenosine deaminase, (347 FT aa), fasta scores: opt: 1083, E():0, (49.3% identity in FT 345 aa)" FT /product="adenosine deaminase" FT misc_feature 94739..95563 FT /note="Match to PF00962 A_deaminase, Adenosine/AMP FT deaminase Score 255.34" FT CDS complement(95996..96745) FT /colour=8 FT /fasta_file="fasta/c1198.tab.seq.00022.out" FT /gene="SPBC1198.03c" FT /label=SPBC1198.03c FT /note="SPBC1198.03c, len:249" FT /product="hypothetical protein; sequence orphan" FT CDS complement(join(97255..97307,97355..97990,98043..98350, FT 98389..98510,98556..98687,98731..98982,99021..99086, FT 99139..100115,100160..100307)) FT /colour=2 FT /fasta_file="fasta/c1198.tab.seq.00023.out" FT /gene="zas1" FT /gene="SPBC1198.04c" FT /label=zas1 FT /note="SPBC1198.04c, len:897, SIMILARITY:Saccharomyces FT cerevisiae, ZMS1_YEAST, zinc finger protein zms1., (1380 FT aa), fasta scores: opt: 236, E():4.6e-07, (41.2% identity FT in 85 aa)" FT /product="zinc finger protein; zf-C2H2 type; alternative FT splicing" FT misc_feature complement(97308..97319) FT /colour=6 FT /note="ctaattaaccag, splice branch and acceptor" FT intron complement(97308..97354) FT /note="confirmed intron" FT misc_feature complement(97349..97354) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(97991..98008) FT /colour=6 FT /note="ctaacattccaaacatag, splice branch and acceptor" FT misc_feature complement(98037..98042) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(98351..98364) FT /colour=6 FT /note="cttacaacggttag, splice branch and acceptor" FT misc_feature complement(98383..98388) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature complement(98511..98523) FT /colour=6 FT /note="ctaacttattaag, splice branch and acceptor" FT misc_feature complement(98550..98555) FT /colour=6 FT /note="gtaatc, splice donor sequence" FT misc_feature complement(98688..98702) FT /colour=6 FT /note="ctaatcttcctttag, splice branch and acceptor" FT misc_feature complement(98725..98730) FT /colour=6 FT /note="gtttgt, splice donor sequence" FT misc_feature complement(98983..98995) FT /colour=6 FT /note="ctaataaacatag, splice branch and acceptor" FT misc_feature complement(99015..99020) FT /colour=6 FT /note="gtatag, splice donor sequence" FT misc_feature complement(99087..99099) FT /colour=6 FT /note="ctgattcatttag, splice branch and acceptor" FT misc_feature complement(99133..99138) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT intron complement(99843..99998) FT /note="alteRNAtively spliced intron" FT misc_feature complement(100116..100128) FT /colour=6 FT /note="ttaacttatttag, splice branch and acceptor" FT misc_feature complement(100154..100159) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT tRNA complement(100693..100763) FT /note="tRNA Gly anticodon GCC, Cove score 72.94" FT CDS 101394..102002 FT /EC_number="2.7.4.8" FT /colour=7 FT /fasta_file="fasta/c1198.tab.seq.00024.out" FT /gene="SPBC1198.05" FT /label=SPBC1198.05 FT /note="SPBC1198.05, len:202, SIMILARITY:Saccharomyces FT cerevisiae, KGUA_YEAST, guanylate kinase, (186 aa), fasta FT scores: opt: 652, E():0, (53.1% identity in 179 aa)" FT /product="putative guanylate kinase; similar to S. FT cerevisiae GUK1" FT misc_feature 101553..101867 FT /note="Match to PF00625 Guanylate_kin, Guanylate kinase FT Score 159.14" FT CDS complement(102524..103924) FT /colour=7 FT /fasta_file="fasta/c1198.tab.seq.00025.out" FT /gene="SPBC1198.06c" FT /label=SPBC1198.06c FT /note="SPBC1198.06c, len:466, similar to SPCC970.02 and FT SPBC1198.07c, SIMILARITY:Schizosaccharomyces pombe, O74556, FT hypothetical 49.1 kD protein, (442 aa), fasta scores: FT opt: 1215, E():0, (41.8% identity in 409 aa)" FT /product="similar to S. cerevisiae DFG5 cellular FT elongation protein; tandem repeat in S. pombe" FT CDS complement(join(104988..106234,106293..106569)) FT /colour=7 FT /fasta_file="fasta/c1198.tab.seq.00026.out" FT /gene="SPBC1198.07c" FT /label=SPBC1198.07c FT /note="SPBC1198.07c, len:507, similar to SPCC970.02 and FT SPBC1198.06c, SIMILARITY:Schizosaccharomyces pombe, O74556, FT hypothetical 49.1 kD protein, (442 aa), fasta scores: FT opt: 1391, E():0, (46.7% identity in 445 aa)" FT /product="similar to S. cerevisiae DFG5; cellular FT elongation protein; tandem repeat in S. pombe" FT misc_feature complement(106235..106249) FT /colour=6 FT /note="ttaaccatatttaag, splice branch and acceptor" FT misc_feature complement(106287..106292) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS join(107129..107154,107280..108678) FT /colour=10 FT /fasta_file="fasta/c1198.tab.seq.00027.out" FT /gene="SPBC1198.08" FT /label=SPBC1198.08 FT /note="SPBC1198.08, len:432, SIMILARITY:Saccharomyces FT cerevisiae, YFL4_YEAST, hypothetical 52.9 kD protein in FT sap155-ymr31 intergenic region., (481 aa), fasta scores: FT opt: 1765, E():0, (53.9% identity in 477 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YFR044C" FT misc_feature 107155..107160 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 107266..107279 FT /colour=6 FT /note="ctaacactttatag, splice branch and acceptor" FT misc_feature join(109361..109618,109677..109871) FT /note="Match to PF00179 UQ_con, Ubiquitin-conjugating FT enzyme Score 150.10" FT CDS join(109364..109618,109677..109904) FT /EC_number="6.3.2.19" FT /colour=2 FT /fasta_file="fasta/c1198.tab.seq.00028.out" FT /gene="ubc16" FT /gene="SPBC1198.09" FT /label=ubc16 FT /note="SPBC1198.09, len:150, SIMILARITY:Brassica oleracea, FT Q39372, ubiquitin conjugating enzyme, e2, (129 aa), fasta FT scores: opt: 265, E():8.2e-12, (37.4% identity in 123 aa)" FT /product="putative ubiquitin conjugating enzyme, e2" FT misc_feature 109619..109624 FT /colour=6 FT /note="gtaagc, splice donor sequence" FT CDS complement(join(109906..110916,110987..111113, FT 111188..111375)) FT /colour=7 FT /fasta_file="fasta/c1198.tab.seq.00029.out" FT /gene="SPBC1198.10c" FT /label=SPBC1198.10c FT /note="SPBC1198.10c, len:441, SIMILARITY:Saccharomyces FT cerevisiae, SYNM_YEAST, asparaginyl-tRNA synthetase, FT mitochondrial , (492 aa), fasta scores: opt: 652, E():0, FT (40.5% identity in 484 aa)" FT /product="asparaginyl-tRNA synthetase, mitochondrial" FT misc_feature complement(109921..110889) FT /note="Match to PF00152 tRNA-synt_2, tRNA synthetases FT class II (D, K and N) Score 303.16" FT misc_feature complement(110917..110932) FT /colour=6 FT /note="ctaatccggaatatag, splice branch and acceptor" FT misc_feature complement(110981..110986) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(111114..111129) FT /colour=6 FT /note="ttaatttattatcaag, splice branch and acceptor" FT misc_feature complement(111182..111187) FT /colour=6 FT /note="gtatgg, splice donor sequence" FT misc_feature 111760..118832 FT /note="nominal overlap with cosmid SPBC660 EM:AL034563 S. FT pombe chromosome 2" FT misc_feature complement(111846..111855) FT /colour=6 FT /note="ttaatttaag, splice branch and acceptor" FT misc_feature complement(111891..111896) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(join(112130..112223,112259..112305)) FT /note="Match to PF00249 myb_DNA-binding, Myb-like DNA- FT binding domain Score 34.85" FT misc_feature complement(112224..112234) FT /colour=6 FT /note="ttaacgtttag, splice branch and acceptor" FT misc_feature complement(112259..112264) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 114498..114503 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 114531..114543 FT /colour=6 FT /note="ctaacgacagcag, splice branch and acceptor" FT misc_feature 115014..115124 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 27.69" FT misc_feature 115137..115253 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 25.01" FT misc_feature 115527..115643 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 29.73" FT misc_feature complement(115944..115961) FT /colour=6 FT /note="ctaatgaattcatattag, splice branch and acceptor" FT misc_feature complement(116041..116046) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(116191..116206) FT /colour=6 FT /note="ctaacttttttttcag, splice branch and acceptor" FT misc_feature complement(116244..116249) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(117825..118592) FT /note="Match to PF00316 FBPase, Fructose-1-6- FT bisphosphatase Score 606.61" FT misc_feature 111760..118832 FT /note="nominal overlap with cosmids SP33010, EM:U33010 S. FT pombe chromosome 2" FT misc_feature complement(111846..111863) FT /colour=6 FT /note="ctaatattttaatttaag, splice branch and acceptor" FT misc_feature complement(111891..111896) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(join(112142..112223,112265..112296)) FT /note="Match to PF00249 myb_DNA-binding, Myb-like DNA- FT binding domain Score 30.86" FT misc_feature complement(112224..112234) FT /colour=6 FT /note="ttaacgtttag, splice branch and acceptor" FT misc_feature complement(112259..112264) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 114498..114503 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 114531..114543 FT /colour=6 FT /note="ctaacgacagcag, splice branch and acceptor" FT misc_feature 115017..115112 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 22.93" FT misc_feature 115137..115253 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 31.68" FT misc_feature 115530..115643 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 20.22" FT misc_feature complement(115944..115961) FT /colour=6 FT /note="ctaatgaattcatattag, splice branch and acceptor" FT misc_feature complement(116041..116046) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(116191..116206) FT /colour=6 FT /note="ctaacttttttttcag, splice branch and acceptor" FT misc_feature complement(116244..116249) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(117825..118592) FT /note="Match to PF00316 FBPase, Fructose-1-6- FT bisphosphatase Score 601.39" FT misc_feature 118842..122234 FT /note="low-complexity gene-free region" FT CDS 122235..122666 FT /colour=10 FT /gene="SPBC660.05" FT /label=SPBC660.05 FT /note="SPBC660.05, len:143, SIMILARITY:Schizosaccharomyces FT pombe, O94426, glycine-rich protein, putative cell wall FT protein., (273 aa), fasta scores: opt: 293, E():3.9e-08, FT (32.0% identity in 244 aa)" FT /product="hypothetical protein; glycine-rich; possible WW FT domain" FT /fasta_file="fasta/c660.tab.seq.03097.out" FT CDS 124348..125169 FT /colour=10 FT /gene="SPBC660.06" FT /label=SPBC660.06 FT /note="SPBC660.06, len:273" FT /product="hypothetical protein; glycine-rich; possible WW FT domain" FT /fasta_file="fasta/c660.tab.seq.03098.out" FT CDS 126777..128984 FT /EC_number="3.2.1.28" FT /colour=2 FT /gene="ntp1" FT /gene="SPBC660.07" FT /label=ntp1 FT /note="SPBC660.07, len:735" FT /product="neutral trehalase; subcellular localization of FT GFP fusion- Cytoplasm" FT /fasta_file="fasta/c660.tab.seq.03099.out" FT misc_feature 127008..128873 FT /note="Match to PF01204 Trehalase, Trehalase Score 949.05" FT CDS 129684..130871 FT /colour=8 FT /gene="SPBC660.08" FT /label=SPBC660.08 FT /note="SPBC660.08, len:395," FT /product="hypothetical protein; sequence orphan; predicted FT coiled-coil region" FT /fasta_file="fasta/c660.tab.seq.03100.out" FT CDS 131210..131557 FT /colour=8 FT /gene="SPBC660.09" FT /label=SPBC660.09 FT /note="SPBC660.09, len:115" FT /product="hypothetical protein; sequence orphan; has FT transcript profile on microarray" FT /fasta_file="fasta/c660.tab.seq.03101.out" FT CDS join(132074..132190,132274..134598) FT /colour=7 FT /gene="SPBC660.10" FT /label=SPBC660.10 FT /note="SPBC660.10, len:813, SIMILARITY:Saccharomyces FT cerevisiae, EFG2_YEAST, elongation factor g 2, FT mitochondrial , (819 aa), fasta scores: opt: 1142, E():0, FT (35.3% identity in 811 aa)" FT /product="elongation factor g; mitochondrial" FT /fasta_file="fasta/c660.tab.seq.03102.out" FT misc_feature join(132155..132190,132274..133722) FT /note="Match to PF00009 GTP_EFTU, Elongation factor Tu FT family Score 349.48" FT misc_feature 132191..132196 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 132253..132273 FT /colour=6 FT /note="ctaactttttaatag, splice branch and acceptor" FT CDS join(134846..135054,135305..135506,135560..136195) FT /colour=2 FT /function="complements temperature sensitive phenotype of FT Saccharomyces cerevisiae cdc13-1 mutation by single- FT stranded telomeric DNA-binding" FT /gene="tcg1" FT /gene="SPBC660.11" FT /label=tcg1 FT /note="SPBC660.11, len:348, SIMILARITY:Nicotiana FT sylvestris, Q42412, RNA-binding protein rz-1., (209 aa), FT fasta scores: opt: 190, E():0.00019, (24.7% identity in FT 162 aa)" FT /product="single-stranded TG1-3 telomeric binding protein" FT /fasta_file="fasta/c660.tab.seq.03103.out" FT misc_feature join(134981..135054,135305..135458) FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 41.91" FT misc_feature 135055..135060 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 135291..135304 FT /colour=6 FT /note="ctaatgctttttag, splice branch and acceptor" FT misc_feature 135507..135512 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 135548..135559 FT /colour=6 FT /note="ctgacacattag, splice branch and acceptor" FT misc_feature 135767..136018 FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 49.45" FT CDS complement(136700..137878) FT /colour=7 FT /gene="SPBC660.12c" FT /label=SPBC660.12c FT /note="SPBC660.12c, len:392, SIMILARITY:Streptomyces FT clavul igerus., CEFD_STRCL, isopenicillin n epimerase, FT (397 aa), f asta scores: opt: 302, E():3.5e-13, (20.4% FT identity in 388 aa)" FT /note="SPBC660.12c, len:392, SIMILARITY:Candida albicans, FT O94021, hypothetical 48.1 kD protein., (421 aa), fasta FT scores: opt: 768, E():0, (33.1% identity in 399 aa)" FT /product="putative peptide epimerase; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c660.tab.seq.03104.out" FT CDS complement(join(139061..140849,140919..140959)) FT /colour=2 FT /gene="ssb1" FT /gene="rpa1" FT /gene="rad11" FT /gene="SPBC660.13c" FT /label=ssb1 FT /note="SPBC660.13c, len:609" FT /note="SPBC660.13c, len:609" FT /product="replication factor-a protein 1; similar to S. FT cerevisiae RPA1" FT /fasta_file="fasta/c660.tab.seq.03105.out" FT misc_feature complement(140850..140866) FT /colour=6 FT /note="ttaacacgtttctttag, splice branch and acceptor" FT intron complement(140850..140918) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(140913..140918) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS join(141398..142606,142675..143211) FT /colour=2 FT /gene="mik1" FT /gene="SPBC660.14" FT /label=mik1 FT /note="SPBC660.14, len:581" FT /product="serine/threonine protein kinase; mitosis FT inhibitor protein kinase; DNA replication checkpoint FT control; similar to S. cerevisiae SWE1" FT /fasta_file="fasta/c660.tab.seq.03106.out" FT misc_feature 142295..142555 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 50.76" FT misc_feature 142607..142612 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 142654..142674 FT /colour=6 FT /note="aattcactaaccgaacatag, splice branch and acceptor" FT misc_feature 142675..143133 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 99.06" FT CDS join(144028..144074,144123..144563,144636..144676, FT 144998..145161,145207..145938) FT /colour=10 FT /gene="SPBC660.15" FT /label=SPBC660.15 FT /note="SPBC660.15, len:474, SIMILARITY:Saccharomyces FT cerevisiae, NAB4_YEAST, nuclear polyadenylated RNA-binding FT protein nab4., (534 aa), fasta scores: opt: 777, E():0, FT (32.6% identity in 537 aa)" FT /product="RNA-binding protein" FT /fasta_file="fasta/c660.tab.seq.03107.out" FT misc_feature 144075..144080 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 144104..144122 FT /colour=6 FT /note="ctaattatcgattaattag, splice branch and acceptor" FT misc_feature 144564..144569 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 144619..144635 FT /colour=6 FT /note="ctaaccagatattttag, splice branch and acceptor" FT misc_feature join(144643..144676,144998..145146) FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 65.65" FT misc_feature 144677..144682 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 144980..144997 FT /colour=6 FT /note="ctaatgtttgatttacag, splice branch and acceptor" FT misc_feature 145162..145167 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 145192..145206 FT /colour=6 FT /note="ctaataaataatcag, splice branch and acceptor" FT misc_feature 145261..145470 FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 83.00" FT misc_feature 145936..150066 FT /note="low-complexity gene-free region" FT misc_feature 147137..147455 FT /note="RNA not assocciated with an orf; FT dbj|AU012817|AU012817 Schizosaccharomyces pombe cDNA, FT clone spc07314" FT misc_feature 147546..148008 FT /note="RNA not associated with an orf; FT dbj|AU012311|AU012311 Schizosaccharomyces pombe cDNA, FT clone spc06604" FT CDS join(150067..150083,150145..150149,150315..150378, FT 151196..151263,151436..152760) FT /EC_number="1.1.1.44" FT /colour=7 FT /gene="SPBC660.16" FT /note="SPBC660.16, len:492, SIMILARITY:Saccharomyces FT cerevisiae, 6PG1_YEAST, 6-phosphogluconate dehydrogenase, FT decarboxylating 1, (489 aa), fasta scores: opt: 2473, FT E():0, (74.0% identity in 488 aa)" FT /product="6-phosphogluconate dehydrogenase, FT decarboxylating 1" FT /fasta_file="fasta/c660.tab.seq.03108.out" FT misc_feature 150084..150089 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 150126..150144 FT /colour=6 FT /note="ctaacattttcccctttag, splice branch and acceptor" FT misc_feature 150150..150155 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 150298..150314 FT /colour=6 FT /note="ttaactttttgccaaag, splice branch and acceptor" FT misc_feature 150335..150379 FT /note="Match to PF00393 6PGD, 6-phosphogluconate FT dehydrogenases Score 23.85" FT misc_feature 150379..150384 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT intron complement(982335..982408) FT /colour=2 FT /note="confirmed intron" FT intron complement(982517..982572) FT /colour=2 FT /note="confirmed intron" FT intron complement(982641..982694) FT /colour=2 FT /note="confirmed intron" FT intron complement(982862..982917) FT /colour=2 FT /note="confirmed intron" FT intron complement(982974..983022) FT /colour=2 FT /note="confirmed intron" FT intron 150379..151195 FT /colour=2 FT /note="confirmed intron" FT misc_feature 151181..151195 FT /colour=6 FT /note="ctaacatcattgtag, splice branch and acceptor" FT misc_feature join(151194..151263,151436..152658) FT /note="Match to PF00393 6PGD, 6-phosphogluconate FT dehydrogenases Score 1066.69" FT misc_feature 151264..151269 FT /colour=6 FT /note="gtaatg, splice donor sequence" FT intron 151264..151435 FT /colour=2 FT /note="confirmed intron" FT misc_feature 151415..151435 FT /colour=6 FT /note="ctaacggttctttttcttcag, splice branch and acceptor" FT CDS complement(join(153333..153769,153866..153947)) FT /colour=8 FT /gene="SPBC660.17c" FT /label=SPBC660.17c FT /note="SPBC660.17c, len:172" FT /product="hypothetical protein; sequence orphan; contains FT 4 predicted transmembrane helices" FT /fasta_file="fasta/c660.tab.seq.03109.out" FT misc_feature complement(153770..153789) FT /colour=6 FT /note="ctaacatatctatttcgtag, splice branch and acceptor" FT intron complement(153770..153865) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(153860..153865) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature complement(154223..154237) FT /colour=6 FT /note="ctaacaattctatag, splice branch and acceptor" FT misc_feature complement(154287..154292) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 154427..155084 FT /note="nominal overlap with cosmid SPBC31E1, EM:A049190 S. FT pombe chromosome 2" FT misc_feature 154427..155084 FT /note="nominal overlap with cosmid SPBC660, EM:A034563 S. FT pombe chromosome 2" FT CDS complement(160069..162768) FT /EC_number="3.6.1.38" FT /colour=2 FT /gene="pgak" FT /gene="SPBC31E1.02c" FT /label=pgak FT /note="SPBC31E1.02c, len:899" FT /product="P-type calcium ATPase" FT /fasta_file="fasta/c31E1.tab.seq.03798.out" FT misc_feature complement(160561..162513) FT /note="Match to PF00122, E1-E2_ATPase, E1-E2 ATPases" FT CDS complement(join(164310..164412,164462..164563, FT 164634..164650)) FT /colour=2 FT /gene="ubl4" FT /gene="SPBC31E1.03" FT /label=ubl5 FT /note="SPBC31E1.03, len:73aa, SIMILARITY: TR:P91302, C. FT elegans, ubiquitin -like protein, fasta scores, opt:354, FT E(): 9.6e-2, (66.7% identity in 72 aa overlap)" FT /product="ubiquitin-like protein" FT /fasta_file="fasta/c31E1.tab.seq.03799.out" FT misc_feature complement(164413..164427) FT /colour=6 FT /note="ttaacaaaaaaatag, splice branch and acceptor" FT misc_feature complement(164456..164461) FT /colour=6 FT /note="gtaagg, splice donor sequence" FT misc_feature complement(164564..164578) FT /colour=6 FT /note="ctaactaaattttag, splice branch and acceptor" FT misc_feature complement(164628..164633) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS join(165417..165996,166127..166284,166339..166554) FT /colour=2 FT /gene="pep12" FT /gene="SPBC31E1.04" FT /label=pep12 FT /note="SPBC31E1.04, len:316, SIMILARITY:Saccharomyces FT cerevisiae, PE12_YEAST, syntaxin (T-SNARE), vacuolar, (288 FT aa), fasta scores: opt: 318, E():2.9e-12, (29.4% identity FT in 245 aa)" FT /product="putative syntaxin (T-SNARE), vacuolar" FT /fasta_file="fasta/c31E1.tab.seq.03800.out" FT misc_feature 165423..166184 FT /colour=9 FT /note="Pfam match to entry PF00804 Syntaxin, Syntaxin" FT misc_feature 165997..166002 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 166108..166126 FT /colour=6 FT /note="ctaacaattttctttttag, splice branch and acceptor" FT misc_feature 166285..166290 FT /colour=6 FT /note="gtaatt, splice donor sequence" FT misc_feature 166324..166338 FT /colour=6 FT /note="ttaataatgggctag, splice branch and acceptor" FT CDS join(166960..167097,167148..168452) FT /colour=7 FT /gene="SPBC31E1.05" FT /label=SPBC31E1.05 FT /note="SPBC31E1.05, len:480, SIMILARITY:Saccharomyces FT cerevisiae, GLE1_YEAST, RNA export factor gle1, (538 aa), FT fasta scores: opt: 712, E():9e-32, (35.9% identity in 426 FT aa)" FT /product="putative RNA export factor" FT /fasta_file="fasta/c31E1.tab.seq.03801.out" FT misc_feature 167098..167103 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 167132..167147 FT /colour=6 FT /note="ttaataatgttcttag, splice branch and acceptor" FT misc_feature 168888..168893 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 168922..168934 FT /colour=6 FT /note="ctaataagaatag, splice branch and acceptor" FT misc_feature 169073..169096 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 171170..171346 FT /note="nominal overlap with cosmid SPU41410, EM:U41410 S. FT pombe chromosome 2" FT misc_feature 171170..171346 FT /note="nominal overlap with cosmid SPBC31E1 S. pombe FT chromosome 2" FT CDS join(172847..172930,173009..173683) FT /colour=8 FT /gene="SPBC800.02" FT /label=SPBC800.02 FT /note="SPBC800.02, len:252" FT /product="hypothetical serine-rich protein; sequence FT orphan" FT /fasta_file="fasta/c800.tab.seq.04269.out" FT misc_feature 172931..172936 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS 174521..176584 FT /colour=2 FT /gene="clr3" FT /gene="SPBC800.03" FT /label=clr3 FT /note="SPBC800.03, len:687" FT /product="histone deacetylase; HDA1-like (class II); FT subcellular localization nuclear, nucleolus, FT heterochromatin of CEN, rDNA and mating type region (PMID: FT 11884604) (IDA); required for rDNA silencing (PMID: FT 11884604); similar to S. cerevisiae HDA1" FT /fasta_file="fasta/c800.tab.seq.04270.out" FT misc_feature 174701..175675 FT /note="Match to PF00850 Hist_deacetyl, Histone deacetylase FT family Score 374.92" FT tRNA 177153..177224 FT /note="tRNA Gln anticodon CTG, Cove score 71.48" FT tRNA complement(177607..177678) FT /note="tRNA Gln anticodon TTG, Cove score 71.12" FT tRNA complement(178547..178618) FT /note="tRNA Gln anticodon CTG, Cove score 71.48" FT CDS complement(join(179276..179403,179504..179660)) FT /colour=2 FT /gene="rpl37a-1" FT /gene="rpl43-1" FT /gene="SPBC800.04c" FT /label=rpl43-1 FT /note="SPBC800.04c, len:94" FT /product="60S ribosomal protein L37a/L43A" FT /fasta_file="fasta/c800.tab.seq.04271.out" FT misc_feature complement(join(179282..179403,179504..179654)) FT /note="Match to PF01780 Ribosomal_L37ae, Ribosomal L37ae FT protein family Score 182.99" FT misc_feature complement(179404..179418) FT /colour=6 FT /note="ctaactatgaaatag, splice branch and acceptor" FT intron complement(179404..179503) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(179498..179503) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS complement(180424..181773) FT /colour=2 FT /gene="tub1" FT /gene="atb2" FT /gene="alp2" FT /gene="SPBC800.05c" FT /gene="ban5" FT /label=tub1 FT /note="SPBC800.05c, len:449" FT /product="tubulin alpha-2 chain; alpha tubulin (a2); FT required for the maintenance of microtubule structure ; FT predominantly nuclear; viable" FT /fasta_file="fasta/c800.tab.seq.04272.out" FT misc_feature complement(180475..181773) FT /note="Match to PF00091 tubulin, Tubulin/FtsZ family Score FT 969.89" FT CDS 182462..183349 FT /colour=7 FT /gene="SPBC800.06" FT /label=SPBC800.06 FT /note="SPBC800.06, len:295, PfamB domain Pfam-B_33535, FT SIMILARITY:Saccharomyces cerevisiae, Q08235, chromosome xv FT reading frame orf yol077c., (291 aa), fasta scores: opt: FT 1029, E():0, (52.0% identity in 298 aa)" FT /product="required for biogenesis of the 60S ribosomal FT subunit; possibly localized to the nucleolus; similar to FT S. cerevisiae BRX1" FT /fasta_file="fasta/c800.tab.seq.04273.out" FT CDS complement(183614..184513) FT /colour=7 FT /gene="SPBC800.07c" FT /label=SPBC800.07c FT /note="SPBC800.07c, len:299, predicted mitochondrial FT transit peptide 1-35aa, SIMILARITY to N-terminalof:Aquifex FT aeolicus.aquifex aeolicus., EFTS_AQUAE, elongation factor FT ts, (290 aa), fasta scores: opt: 265, E():1.4e-09, (31.9% FT identity in 235 aa)" FT /product="putative mitochondrial elongation factor ts; no FT apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c800.tab.seq.04274.out" FT CDS join(185073..185167,185304..186597) FT /colour=7 FT /gene="SPBC800.08" FT /label=SPBC800.08 FT /note="SPBC800.08, len:492, SIMILARITY:Saccharomyces FT cerevisiae, IF33_YEAST, eukaryotic translation initiation FT factor 3 gamma subunit, (478 aa), fasta scores: opt: 363, FT E():5.8e-16, (25.0% identity in 476 aa)" FT /product="putative eukaryotic translation initiation FT factor 3 gamma subunit" FT /fasta_file="fasta/c800.tab.seq.04275.out" FT misc_feature 185168..185173 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 185285..185303 FT /colour=6 FT /note="ctgactttatattaaatag, splice branch and acceptor" FT CDS join(187189..187241,187280..187338,187377..187558, FT 187667..188653) FT /colour=2 FT /gene="sum2" FT /gene="SPBC800.09" FT /label=sum2 FT /note="SPBC800.09, len:426, SIMILARITY:Pleurodeles waltlii, FT Q9YH12, rap55 protein., (467 aa), fasta scores: opt: 317, FT E():3.6e-07, (29.6% identity in 466 aa), and yeast FT Multicopy suppressor of inviable strains of clathrin heavy FT chain deficient yeast" FT /product="required for G2/M phase checkpoint control" FT /fasta_file="fasta/c800.tab.seq.04276.out" FT misc_feature 187242..187247 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT intron 187242..187279 FT /colour=2 FT /note="confirmed intron" FT misc_feature 187269..187279 FT /colour=6 FT /note="ctaatatttag, splice branch and acceptor" FT misc_feature 187339..187344 FT /colour=6 FT /note="gtaggt, splice donor sequence" FT intron 187339..187376 FT /colour=2 FT /note="confirmed intron" FT misc_feature 187365..187376 FT /colour=6 FT /note="ctaacagtttag, splice branch and acceptor" FT misc_feature 187559..187564 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT intron 187559..187666 FT /colour=2 FT /note="confirmed intron" FT misc_feature 187653..187666 FT /colour=6 FT /note="ttaactataattag, splice branch and acceptor" FT CDS complement(189406..189888) FT /colour=8 FT /gene="SPBC800.14c" FT /label=SPBC800.14c FT /note="SPBC800.14c len:160aa" FT /product="hypothetical protein; sequence orphan; contains FT 4 predicted transmembrane helices" FT /fasta_file="fasta/c800.tab.seq.04277.out" FT CDS complement(190686..194036) FT /colour=10 FT /gene="SPBC800.10c" FT /label=SPBC800.10c FT /note="SPBC800.10c, len:1116, contains 5x PfamB Pfam- FT B_2101 domains and 1 Pfam-B_1 domain, SIMILARITY:Homo FT sapiens, BAA86570, kiaa1256 protein, (1676 aa), fasta FT scores: opt: 416, E():1.3e-12, (26.9% identity in 491 aa)" FT /product="conserved protein; predicted coiled-coil region; FT similar to S. cerevisiae USO1 and PAN1; EF hand protein; FT EPS15 repeat;" FT /fasta_file="fasta/c800.tab.seq.04278.out" FT CDS 195606..196775 FT /colour=7 FT /gene="SPBC800.11" FT /label=SPBC800.11 FT /note="SPBC800.11, len:389, SIMILARITY:Caenorhabditis FT elegans, Q19431, cosmid f13h8., (452 aa), fasta scores: FT opt: 288, E():5.2e-11, (26.6% identity in 319 aa)" FT /product="putative inosine-uridine prefering nucleoside FT hydrolase" FT /fasta_file="fasta/c800.tab.seq.04279.out" FT CDS complement(join(197946..198187,198229..198292, FT 198350..198457)) FT /colour=10 FT /gene="SPBC800.12c" FT /label=SPBC800.12c FT /note="SPBC800.12c, len:137, may use alteRNAtive 5' exon FT (MKLLFRC) and intron, LOW SIMILARITY:Melanoplus FT sanguinipes entomopoxvirus., Q9YVU8, orf msv144 putative FT ubiquitin, similar to neurospora crassa gb:u01220., (80 FT aa), fasta scores: opt: 104, E():0.67, (31.7% identity in FT 60 aa)" FT /product="low similar to putative ubiquitin" FT /fasta_file="fasta/c800.tab.seq.04280.out" FT misc_feature complement(198188..198203) FT /colour=6 FT /note="ttaactaaaaatctag, splice branch and acceptor" FT misc_feature complement(198223..198228) FT /colour=6 FT /note="gtaaat, splice donor sequence" FT misc_feature complement(198293..198307) FT /colour=6 FT /note="ctaatagttttatag, splice branch and acceptor" FT intron complement(198293..198345) FT /note="alteRNAtive 5' intron prediction, may use MKLLFRC FT exon" FT misc_feature complement(198344..198349) FT /colour=6 FT /note="gtgcgt, splice donor sequence" FT CDS 199363..200802 FT /colour=8 FT /gene="SPBC800.13" FT /label=SPBC800.13 FT /note="SPBC800.13, len:479" FT /product="serine rich hypothetical possibly nuclear; FT sequence orphan; has low similar to histone like FT transcription factors, and a DEAD box helicase- below FT threshold; subcellular localization of GFP fusion-nucleus" FT /fasta_file="fasta/c800.tab.seq.04281.out" FT misc_feature 201109..201269 FT /note="nominal overlap with cosmid SPBC1773 S. pombe FT chromosome 2" FT misc_feature 201109..211607 FT /note="nominal overlap with cosmid SPU41410, EM:U41410 S. FT pombe chromosome 2" FT CDS join(201328..201486,201524..201750,201795..203247) FT /colour=10 FT /gene="SPBC1773.01" FT /label=SPBC1773.01 FT /note="SPBC1773.01, len:612, SIMILARITY:Rattus norvegicus, FT STRI_RAT, striatin., (780 aa), fasta scores: opt: 317, FT E():2.7e-11, (23.3% identity in 464 aa)" FT /product="WD repeat protein" FT /fasta_file="fasta/c1773.tab.seq.03527.out" FT misc_feature 201487..201492 FT /colour=6 FT /note="gtatta, splice donor sequence" FT misc_feature 201513..201523 FT /colour=6 FT /note="ctaatcattag, splice branch and acceptor" FT misc_feature 201751..201756 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 201779..201794 FT /colour=6 FT /note="ttaacatgtttag, splice branch and acceptor" FT misc_feature 202393..202509 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 40.16" FT misc_feature 202468..202593 FT /colour=9 FT /note="Pfam match to entry PF00400 G-beta, WD domain, G- FT bet a repeat" FT CDS complement(203637..204224) FT /colour=7 FT /gene="SPBC1773.02c" FT /label=SPBC1773.02c FT /note="SPBC1773.02c, len:195, SIMILARITY:Saccharomyces FT cere visiae, YIL010W, YIB0_YEAST, involved in derepression FT of telomeric silencing, (215 aa), fasta scores: opt: 461, FT E():9. 7e-19, (43.8% identity in 203 aa)" FT /product="possibly involved in de-repression of telomeric FT silencing" FT /fasta_file="fasta/c1773.tab.seq.03528.out" FT misc_feature complement(203667..204083) FT /note="Match to PF00578 AhpC-TSA, AhpC/TSA family Score FT 100.89" FT tRNA complement(205088..205158) FT /note="tRNA Gly anticodon TCC, Cove score 54.33" FT tRNA 205375..205448 FT /note="tRNA Ala anticodon AGC, Cove score 56.39" FT CDS complement(205738..207117) FT /colour=7 FT /gene="SPBC1773.03c" FT /label=SPBC1773.03c FT /note="SPBC1773.03c, len:459, SIMILARITY:Bacillus subtilis, FT YODT_BACSU, putative aminotransferase yodt, (444 aa), FT fasta scores: opt: 1003, E():0, (35.9% identity in 437 aa)" FT /product="aminotransferase" FT /fasta_file="fasta/c1773.tab.seq.03529.out" FT misc_feature complement(205876..207012) FT /note="Match to PF00202 aminotran_3, Aminotransferases FT class-III pyridoxal-phosphate Score 320.06" FT CDS 209324..210334 FT /EC_number="1.2.1.44" FT /colour=7 FT /gene="SPBC1773.04" FT /label=SPBC1773.04 FT /note="SPBC1773.04, len:336, SIMILARITY:Zea mays, E1325797, FT cinnamoyl-coa reductase, (338 aa), fasta scores: opt: FT 166, E():1.3e-17, (27.4% identity in 340 aa)" FT /product="putative reductase" FT /fasta_file="fasta/c1773.tab.seq.03530.out" FT CDS complement(210575..211657) FT /colour=2 FT /gene="tms1" FT /gene="SPBC1773.05c" FT /label=tms1 FT /note="SPBC1773.05c, len:360" FT /product="putative sorbitol dehydrogenase" FT /fasta_file="fasta/c1773.tab.seq.03531.out" FT misc_feature complement(210593..211618) FT /note="Match to PF00107 adh_zinc, zinc binding FT dehydrogenases Score 451.65" FT CDS complement(213165..214205) FT /EC_number="1.1.1.1" FT /colour=7 FT /gene="SPBC1773.06c" FT /label=SPBC1773.06c FT /note="SPBC1773.06c, len:346, FT SIMILARITY:Schizosaccharomyces pombe, YAE5_SCHPO, very FT hypothetical 17.1 kD protein c23d3.05c in chromosome i., FT (160 aa), fasta scores: opt: 699, E():0, (76.9% identity FT in 143 aa)" FT /product="alcohol dehydrogenase" FT /fasta_file="fasta/c1773.tab.seq.03532.out" FT misc_feature complement(213174..214157) FT /note="Match to PF00107 adh_zinc, zinc binding FT dehydrogenases Score 157.89" FT misc_feature complement(213174..214160) FT /note="Match to PF00107 Score 164.60" FT misc_feature complement(213174..214184) FT /colour=9 FT /note="Pfam match to entry PF00107 adh_zinc, zinc binding FT d ehydrogenases" FT CDS complement(join(215935..216005,216104..216232, FT 216405..216852)) FT /colour=2 FT /gene="sbp1" FT /gene="yrb1" FT /gene="SPBC1773.07c" FT /label=sbp1 FT /note="SPBC1773.07c, len:215" FT /product="ran/spi1 binding protein." FT /fasta_file="fasta/c1773.tab.seq.03533.out" FT misc_feature complement(join(215962..216005,216104..216232, FT 216405..216600)) FT /note="Match to PF00638 Ran_BP1, RanBP1 domain. Score FT 191.77" FT misc_feature complement(216006..216023) FT /colour=6 FT /note="ctaaccaaacctcgttag, splice branch and acceptor" FT intron complement(216006..216103) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(216098..216103) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(216232..216600) FT /colour=9 FT /note="Pfam match to entry PF00638 Ran_BP1, RanBP1 domain" FT misc_feature complement(216233..216247) FT /colour=6 FT /note="ctaacttgtttttag, splice branch and acceptor" FT intron complement(216233..216404) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(216399..216404) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS complement(217470..218645) FT /EC_number="2.4.1.131" FT /colour=7 FT /gene="SPBC1773.08c" FT /label=SPBC1773.08c FT /note="SPBC1773.08c, len:391, FT SIMILARITY:Schizosaccharomyces pombe, BAA21393, alpha-1,2- FT mannosyltransferase homolog, (351 aa), fasta scores: opt: FT 1162, E():0, (50.6% identity in 328 aa)" FT /product="putative mannosyltransferase" FT /fasta_file="fasta/c1773.tab.seq.03534.out" FT misc_feature complement(217599..218702) FT /note="Match to PF01793 Glyco_transf_15, Glycolipid 2- FT alpha-mannosyltransferase Score 538.77" FT CDS complement(join(219046..219773,219930..220807, FT 220864..220913)) FT /colour=10 FT /gene="SPBC1773.09c" FT /label=SPBC1773.09c FT /note="SPBC1773.09c, len:551, FT SIMILARITY:Schizosaccharomyces pombe, O13601, pi006 FT protein., (494 aa), fasta scores: opt: 279, E():6.5e-09, FT (23.5% identity in 596 aa)" FT /product="DNAJ domain protein" FT /fasta_file="fasta/c1773.tab.seq.03535.out" FT misc_feature complement(220630..220806) FT /note="Match to PF00226 DnaJ, DnaJ domain Score 76.99" FT misc_feature complement(join(220630..220807,220864..220880)) FT /note="Match to PF00226 Score 83.11" FT misc_feature complement(220808..220828) FT /colour=6 FT /note="ctaacatgtaatttattacag, splice branch and acceptor" FT misc_feature complement(220858..220863) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT CDS complement(221681..223387) FT /EC_number="6.1.1.22" FT /colour=7 FT /gene="SPBC1773.10c" FT /label=SPBC1773.10c FT /note="SPBC1773.10c, len:568, SIMILARITY:Saccharomyces FT cerevisiae, SYNC_YEAST, asparaginyl-tRNA synthetase, FT cytoplasmic, (554 aa), fasta scores: opt: 2106, E():0, FT (58.3% identity in 557 aa)" FT /product="asparaginyl-tRNA synthetase, cytoplasmic" FT /fasta_file="fasta/c1773.tab.seq.03536.out" FT misc_feature complement(221702..222655) FT /note="Match to PF00152 tRNA-synt_2, tRNA synthetases FT class II (D, K and N) Score 438.74" FT CDS complement(225000..226190) FT /colour=7 FT /gene="SPBC1773.11c" FT /label=SPBC1773.11c FT /note="SPBC1773.11c, len:396, SIMILARITY:Saccharomyces FT cerevisiae, YN63_YEAST, hypothetical 47.4 kD protein in FT egt2-kre1 intergenic region., (414 aa), fasta scores: opt: FT 941, E():0, (39.7% identity in 373 aa)" FT /product="similar to S. cerevisiae CDC50" FT /fasta_file="fasta/c1773.tab.seq.03537.out" FT CDS 227859..229643 FT /colour=7 FT /gene="SPBC1773.12" FT /label=SPBC1773.12 FT /note="SPBC1773.12, len:594, FT SIMILARITY:Schizosaccharomyces pombe, O94573, putative FT transcriptional regulator, zinc finger, binuclear FT clusterdomain containing., (595 aa), fasta scores: opt: FT 1990, E():0, (48.9% identity in 583 aa)" FT /product="putative transcriptional regulator; zinc finger FT protein; fungal binuclear cluster domain" FT /fasta_file="fasta/c1773.tab.seq.03538.out" FT misc_feature 227883..227993 FT /note="Match to PF00172 Zn_clus, fungal Zn(2)-Cys(6) FT binuclear cluster domain Score 59.30" FT CDS 230401..231846 FT /colour=7 FT /gene="SPBC1773.13" FT /label=SPBC1773.13 FT /note="SPBC1773.13, len:481, FT SIMILARITY:Schizosaccharomyces pombe, Q9Y7S6, putative FT aminotransferase., (470 aa), fasta scores: opt: 2032, FT E():0, (62.9% identity in 466 aa)" FT /product="putative aromatic aminotransferase" FT /fasta_file="fasta/c1773.tab.seq.03539.out" FT CDS 232996..234381 FT /EC_number="4.3.2.1" FT /colour=2 FT /gene="arg7" FT /gene="SPBC1773.14" FT /label=arg7 FT /note="SPBC1773.14, len:461" FT /product="argininosuccinate lyase" FT /fasta_file="fasta/c1773.tab.seq.03540.out" FT misc_feature 233029..234303 FT /note="Match to PF00206 lyase_1, Lyase Score 676.49" FT CDS 235661..237154 FT /colour=7 FT /gene="SPBC1773.15" FT /label=SPBC1773.15 FT /note="SPBC1773.15, len:497, SIMILARITY:Saccharomyces FT cerevisiae, YIL166c, DAL5_YEAST, allantoate permease, (543 FT aa), fasta scores: opt: 899, E():0, (41.3% identity in 492 FT aa)" FT /product="putative MFS allantoate transporter" FT /fasta_file="fasta/c1773.tab.seq.03541.out" FT CDS complement(238392..240179) FT /colour=7 FT /gene="SPBC1773.16c" FT /label=SPBC1773.16c FT /note="SPBC1773.16c, len:568, SIMILARITY:E1339996, FT HYPOTHETICAL ZINC-FINGER PROTEIN, BINUCLEAR CLUSTER DOMAIN FT CONTAINING, (594 aa), fasta scores, opt:1990, E():0, FT (48.9% identity in 583 aa overlap)" FT /note="SPBC1773.16c, len:595, FT SIMILARITY:Schizosaccharomyces pombe, O94569, hypothetical FT zinc finger protein, binuclear clus ter domaincontaining FT transcriptional regulator., (594 aa), fasta scores: opt: FT 1990, E():0, (48.9% identity in 583 aa)" FT /product="putative transcriptional regulator; zinc finger FT protein; fungal binuclear cluster domain" FT /fasta_file="fasta/c1773.tab.seq.03542.out" FT misc_feature complement(240057..240161) FT /note="Match to PF00172 Zn_clus, fungal Zn(2)-Cys(6) FT binuclear cluster domain Score 42.11" FT misc_feature complement(241490..241918) FT /note="Match to PF00389 2-Hacid_DH, D-isomer specific 2- FT hydroxyacid dehydrogenases Score 172.49" FT misc_feature 241791..241918 FT /note="nominal overlap with SPBC1773 S. pombe chromosome 2" FT misc_feature complement(241793..242107) FT /note="Match to PF00389 2-Hacid_DH, D-isomer specific 2- FT hydroxyacid dehydrogenases Score 62.71" FT CDS complement(243890..244861) FT /EC_number="3.5.3.1" FT /colour=2 FT /gene="car1" FT /gene="SPBP26C9.02c" FT /label=car1 FT /note="SPBP26C9.02c, len:323" FT /product="arginase" FT /fasta_file="fasta/p26C9.tab.seq.04332.out" FT misc_feature complement(243977..244786) FT /note="Match to PF00491 arginase, Arginase family Score FT 548.41" FT tRNA 245934..246004 FT /note="tRNA Gly anticodon TCC, Cove score 60.52" FT tRNA complement(246351..246423) FT /note="tRNA Arg anticodon TCT, Cove score 69.29" FT CDS complement(247691..249445) FT /colour=7 FT /gene="SPBP26C9.03c" FT /label=SPBP26C9.03c FT /note="SPBP26C9.03c, len:584, SIMILARITY:Saccharomyces FT cerevisiae, FET4_YEAST, low-affinity fe(ii) transport FT protein., (552 aa), fasta scores: opt: 828, E():0, (38.8% FT identity in 541 aa)" FT /product="putative metal transport protein; similar to S. FT cerevisiae FET4" FT /fasta_file="fasta/p26C9.tab.seq.04333.out" FT misc_feature 249542..252873 FT /note="low complexity gene free region with (G-C)/(G+C) FT strandswitch" FT misc_feature 252781..252880 FT /note="500 (+1) 1 100 SPBC1271 S. pombe chromosome 2" FT CDS 254087..256147 FT /colour=7 FT /gene="SPBC1271.15c" FT /label=SPBC1271.15c FT /note="SPBC1271.15c, len:686, SIMILARITY:Saccharomyces FT cere visiae, YOL023W, IF2M_YEAST, translation initiation FT factor if-2, mitochondrial , (676 aa), fasta scores: opt: FT 1057, E():0, (38.1% identity in 653 aa)" FT /product="putative translation initiation factor if-2, FT mitochondrial" FT /fasta_file="fasta/c1271.tab.seq.03544.out" FT misc_feature 254591..255595 FT /colour=9 FT /note="Pfam match to entry PF00009 GTP_EFTU, Elongation FT fac tor Tu family" FT misc_feature 254594..255595 FT /note="Match to GTP_EFTU , Score 114.20" FT misc_feature 255995..256063 FT /colour=8 FT /note="PS01176 Initiation factor 2 signature" FT CDS complement(256500..257837) FT /colour=7 FT /gene="SPBC1271.14" FT /label=SPBC1271.14 FT /note="SPBC1271.14, len:445, SIMILARITY:Saccharomyces FT cerev isiae, YMR062C, ARGJ_YEAST, glutamate n- FT acetyltransferase , (441 aa), fasta scores: opt: 1338, FT E():0, (51.0% identity in 433 aa)" FT /product="glutamate n-acetyltransferase" FT /fasta_file="fasta/c1271.tab.seq.03545.out" FT misc_feature complement(256503..257726) FT /note="Match to ArgJ , Score 840.54" FT misc_RNA complement(259045..259711) FT /note="SPMEIRNA D31852 Fission yeast DNA for meiRNA, FT comple te sequence" FT CDS complement(join(260669..261218,261282..261355)) FT /colour=7 FT /gene="SPBC1271.13" FT /label=SPBC1271.13 FT /note="SPBC1271.13, len:207, SIMILARITY:Bacillus FT stearothermophilus., RL17_BACST, 50s ribosomal protein l17, FT (119 aa), fasta scores: opt: 317, E():1.6e-14, (46.6% FT identity in 118 aa)" FT /product="mitochondrial ribosomal protein L17" FT /fasta_file="fasta/c1271.tab.seq.03546.out" FT misc_feature complement(260936..261217) FT /note="Match to Ribosomal_L17 , Score 114.95" FT misc_feature complement(261219..261234) FT /colour=6 FT /note="ctaataaatggaacag, splice branch and acceptor" FT misc_feature complement(261276..261281) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS complement(join(262108..262649,262709..263021, FT 263204..263326,263470..263548,263721..263746, FT 263822..263834,263885..263955)) FT /colour=2 FT /gene="kes1" FT /gene="SPBC1271.12" FT /label=kes1 FT /note="SPBC1271.12, len:388" FT /product="ergosterol biosynthesis protein" FT /fasta_file="fasta/c1271.tab.seq.03547.out" FT misc_feature complement(join(262117..262649,262709..263011, FT 263194..263278)) FT /note="Match to Oxysterol_BP , Score 216.78" FT misc_feature complement(262650..262663) FT /colour=6 FT /note="ctaactcttttcag, splice branch and acceptor" FT intron complement(262650..262708) FT /note="confirmed by mRNA" FT misc_feature complement(262703..262708) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(263022..263043) FT /colour=6 FT /note="ctaacatctctgtttcttatag, splice branch and acceptor" FT misc_feature complement(263022..263203) FT /note="confirmed by mRNA" FT misc_feature complement(263198..263203) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(263327..263348) FT /colour=6 FT /note="ctaaccaaagtttttttgttag, splice branch and acceptor" FT intron complement(263327..263469) FT /note="confirmed by mRNA" FT misc_feature complement(263464..263469) FT /colour=6 FT /note="gtaagg, splice donor sequence" FT misc_feature complement(263549..263565) FT /colour=6 FT /note="ctaacaactgtatttag, splice branch and acceptor" FT intron complement(263549..263720) FT /note="confirmed by mRNA" FT misc_feature complement(263715..263720) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(263747..263763) FT /colour=6 FT /note="ctaatgaatatttcaag, splice branch and acceptor" FT misc_feature complement(263816..263821) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature complement(263835..263853) FT /colour=6 FT /note="ctaacggatttgatattag, splice branch and acceptor" FT misc_feature complement(263879..263884) FT /colour=6 FT /note="gtacgc, splice donor sequence" FT CDS complement(join(265063..265646,265757..265877, FT 265945..265952,266009..266036,266102..266137)) FT /colour=7 FT /gene="SPBC1271.11" FT /label=SPBC1271.11 FT /note="SPBC1271.11, len:258, SIMILARITY:Saccharomyces FT cerevisiae, YNL003C, PET8_YEAST, putative mitochondrial FT carrier protein pet8, (284 aa), fasta scores: opt: 211, FT E():2.7e-26 , (35.6% identity in 275 aa)" FT /product="MC tricarboxylate transporter" FT /fasta_file="fasta/c1271.tab.seq.03548.out" FT misc_feature complement(265099..265323) FT /note="Match to mito_carr , Score 59.82" FT misc_feature complement(265363..265422) FT /note="Match to mito_carr , Score 21.20" FT misc_feature complement(265647..265663) FT /colour=6 FT /note="ctaactttttgttatag, splice branch and acceptor" FT misc_feature complement(265751..265756) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature complement(265878..265899) FT /colour=6 FT /note="cttacatcgttatcttttttag, splice branch and acceptor" FT misc_feature complement(265939..265944) FT /colour=6 FT /note="gtatat, splice donor sequence" FT misc_feature complement(265953..265971) FT /colour=6 FT /note="ttaactctatgtaattcag, splice branch and acceptor" FT misc_feature complement(266003..266008) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature complement(266037..266051) FT /colour=6 FT /note="ctaacatctgtaaag, splice branch and acceptor" FT misc_feature complement(266096..266101) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT CDS 268013..269758 FT /colour=7 FT /gene="SPBC1271.10c" FT /label=SPBC1271.10c FT /note="SPBC1271.10c, len:581, SIMILARITY:Saccharomyces FT cerevisiae, YNR055C, HOL1_YEAST, hol1 protein, (586 aa), FT fasta scores: opt: 984, E():0, (46.1% identity in 573 aa)" FT /product="MFS multidrug efflux transporter" FT /fasta_file="fasta/c1271.tab.seq.03549.out" FT CDS complement(join(270391..270439,270486..272068)) FT /colour=7 FT /gene="SPBC1271.09" FT /label=SPBC1271.09 FT /note="SPBC1271.09, len:543, SIMILARITY:Saccharomyces FT cerevisiae, GIT1_YEAST, putative metabolite transport FT protein git1., (518 aa), fasta scores: opt: 845, E():0, FT (30.2% identity in 490 aa)" FT /product="MFS transporter of unknown specificity" FT /fasta_file="fasta/c1271.tab.seq.03550.out" FT misc_feature complement(270440..270454) FT /colour=6 FT /note="ttaataatttcttag, splice branch and acceptor" FT misc_feature complement(270480..270485) FT /colour=6 FT /note="gtaatt, splice donor sequence" FT misc_feature complement(270584..271831) FT /colour=9 FT /note="Pfam match to entry PF00083 sugar_tr, Sugar (and FT oth er) transporter" FT misc_feature complement(270617..271801) FT /note="Match to sugar_tr , Score 110.27" FT misc_feature 272069..275618 FT /note="putative gene free region" FT tRNA 275619..275690 FT /note="tRNA Gln anticodon TTG, Cove score 53.35" FT CDS 276609..277031 FT /colour=9 FT /gene="SPBC1271.08c" FT /label=SPBC1271.08c FT /note="SPBC1271.08c, len:140" FT /product="very hypothetical protein" FT /fasta_file="fasta/c1271.tab.seq.03551.out" FT CDS 278554..279045 FT /colour=7 FT /gene="SPBC1271.07c" FT /label=SPBC1271.07c FT /note="SPBC1271.07c, len:163, SIMILARITY:Azospirillum FT brasilense., IAAT_AZOBR, iaa acetyltransferase, (153 aa), FT fasta scores: opt: 177, E():3.4e-05, (29.7% identity in FT 155 aa)" FT /product="putative acetyltransferase; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c1271.tab.seq.03552.out" FT misc_feature 278578..278976 FT /colour=9 FT /note="Pfam match to entry PF00583 Acetyltransf, FT Acetyltran sferase (GNAT) family" FT misc_feature 278596..278976 FT /note="Match to Acetyltransf , Score 46.43" FT CDS 279602..280042 FT /colour=8 FT /gene="SPBC1271.06c" FT /label=SPBC1271.06c FT /note="SPBC1271.06c, len:146" FT /product="hypothetical protein; sequence orphan; shows FT expression profile on microarray" FT /fasta_file="fasta/c1271.tab.seq.03553.out" FT CDS 283141..283788 FT /colour=10 FT /gene="SPBC1271.05c" FT /label=SPBC1271.05c FT /note="SPBC1271.05c, len:215, SIMILARITY:Saccharomyces FT cere visiae, YOR052C, Q08422, hypothetical protein (150 FT aa), fasta scores: opt: 216, E():3.9e-14, (32.8% identity FT in 125 a a)" FT /product="zinc finger protein; zf-AN1 type" FT /fasta_file="fasta/c1271.tab.seq.03554.out" FT misc_feature 283630..283704 FT /note="Match to zf-AN1 , Score 37.78" FT CDS join(285114..285329,285465..286241,286294..286353) FT /EC_number="2.5.1.46" FT /colour=7 FT /gene="SPBC1271.04c" FT /label=SPBC1271.04c FT /note="SPBC1271.04c, len:350, SIMILARITY:Neurospora FT crassa., DHYS_NEUCR, deoxyhypusine synthase, (353 aa), FT fasta scores: opt: 1400, E():0, (62.8% identity in 352 aa)" FT /product="deoxyhypusine synthase" FT /fasta_file="fasta/c1271.tab.seq.03555.out" FT misc_feature join(285246..285329,285465..286241,286294..286347) FT /note="Match to DS , Score 688.71" FT misc_feature 285330..285335 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 285452..285464 FT /colour=6 FT /note="ctaattgttacag, splice branch and acceptor" FT misc_feature 286260..286265 FT /colour=6 FT /note="gtatat, splice donor sequence" FT misc_feature 286274..286293 FT /colour=6 FT /note="ctaacttttgatgtctgtag, splice branch and acceptor" FT CDS 287293..288027 FT /colour=8 FT /gene="SPBC1271.03c" FT /label=SPBC1271.03c FT /note="SPBC1271.03c, len:244" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c1271.tab.seq.03556.out" FT CDS complement(join(288257..290415,290475..290574)) FT /colour=2 FT /gene="stt3" FT /gene="SPBC1271.02" FT /label=stt3 FT /note="SPBC1271.02, len:752" FT /product="oligosaccharyl transferase; stt3 subunit; FT similar to S. cerevisiae STT3" FT /fasta_file="fasta/c1271.tab.seq.03557.out" FT misc_feature complement(290416..290434) FT /colour=6 FT /note="ttaatcaagtatcttttag, splice branch and acceptor" FT misc_feature complement(290469..290474) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS 292058..293248 FT /colour=2 FT /gene="pof13" FT /gene="SPBC1271.01c" FT /label=pof13 FT /note="SPBC1271.01c, len:396" FT /product="F-box protein" FT /fasta_file="fasta/c1271.tab.seq.03558.out" FT misc_feature 293271..293687 FT /note="nominal overlap with cosmid SPBC243 S. pombe FT chromosome 2" FT misc_feature 293271..293687 FT /note="nominal overlap with cosmid SPBC1271, EM:AL034353 FT S. pombe chromosome 2" FT misc_feature 294533..295396 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 203.71" FT misc_feature 294551..294622 FT /colour=8 FT /note="PS00107 protein kinases ATP-binding region FT signature" FT misc_feature 294899..294937 FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT misc_feature 295343..296095 FT /note="nominal overlap with cosmid SPBC106, EM:AL110295 S. FT pombe chromosome 2" FT misc_feature 295343..296095 FT /note="nominal overlap with cosmid SPBC243 S. pombe FT chromosome 2" FT CDS complement(296161..296535) FT /colour=7 FT /gene="SPBC106.02c" FT /label=SPBC106.02c FT /note="SPBC106.02c, len:124, SIMILARITY:Saccharomyces FT cerevisiae, YKI6_YEAST, hypothetical 13.9 kD protein in FT cyt2-mdh1 intergenic region., (127 aa), fasta scores: opt: FT 317, E():8.1e-16, (45.1% identity in 113 aa)" FT /product="ParBc-lik nuclease domain; similar to S. FT cerevisiae YKL086W" FT /fasta_file="fasta/c106.tab.seq.03977.out" FT CDS 298326..299399 FT /colour=8 FT /gene="SPBC106.03" FT /label=SPBC106.03 FT /note="SPBC106.03, len:357, SIMILARITY: LOW TO FT Saccharomyces douglasii, YHH7_SACDO, hypothetical 44.4 kD FT protein in spo13-arg4 intergenic region., (385 aa), fasta FT scores: opt: 122, E():0.47, (24.0% identity in 287 aa)" FT /product="hypothetical protein; sequence orphan; low FT similarity to dehydrogenases; contains 1 predicted FT transmembrane helix" FT /fasta_file="fasta/c106.tab.seq.00065.out" FT CDS join(299927..299964,300082..300259,300323..302647) FT /EC_number="3.5.4.6" FT /colour=2 FT /gene="ada1" FT /gene="SPBC106.04" FT /label=ada1 FT /note="SPBC106.04, len:846" FT /product="amp deaminase" FT /fasta_file="fasta/c106.tab.seq.03979.out" FT misc_feature 299965..299970 FT /colour=6 FT /note="gtatat, splice donor sequence" FT misc_feature 300071..300081 FT /colour=6 FT /note="ctaatttttag, splice branch and acceptor" FT misc_feature 300260..300265 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT intron 300260..300322 FT /note="confirmed intron" FT misc_feature 300308..300322 FT /colour=6 FT /note="ctaaccataacctag, splice branch and acceptor" FT misc_feature 301520..302305 FT /note="Match to PF00962 A_deaminase, Adenosine/AMP FT deaminase Score 419.88" FT CDS complement(join(303226..303311,303402..303531)) FT /colour=9 FT /gene="SPBC106.05c" FT /label=SPBC106.05c FT /note="SPBC106.05c, len:71" FT /product="very hypothetical protein" FT /fasta_file="fasta/c106.tab.seq.03980.out" FT misc_feature complement(303312..303327) FT /colour=6 FT /note="ctaatactcaatttag, splice branch and acceptor" FT misc_feature complement(303396..303401) FT /colour=6 FT /note="gttagt, splice donor sequence" FT CDS 304020..305603 FT /colour=2 FT /gene="cct4" FT /gene="SPBC106.06" FT /label=cct4 FT /note="SPBC106.06, len:527" FT /product="t-complex protein 1, delta subunit" FT /fasta_file="fasta/c106.tab.seq.03981.out" FT misc_feature 304110..305588 FT /note="Match to PF00118 cpn60_TCP1, TCP-1/cpn60 chaperonin FT family Score 634.60" FT CDS complement(306205..306708) FT /colour=7 FT /gene="SPBC106.07c" FT /label=SPBC106.07c FT /note="SPBC106.07c, len:167, SIMILARITY:Arabidopsis FT thaliana, AAD29822, f26h11.30 protein., (129 aa), fasta FT scores: opt: 137, E():0.015, (27.2% identity in 125 aa)" FT /product="putative protein N-acetyltransferase for N- FT terminal methionine; similar to S. cerevisiae NAT2" FT /fasta_file="fasta/c106.tab.seq.03982.out" FT CDS complement(307540..308430) FT /colour=12 FT /gene="B13958-1" FT /gene="SPBC106.08c" FT /label=B13958-1 FT /note="SPBC106.08c, len:296, FT SIMILARITY:Schizosaccharomyces pombe, CAB42062, FT hypothetical repeat containing protein., (323 aa), fasta FT scores: opt: 330, E():8e-14, (32.2% identity in 202 aa)" FT /product="Pfam-B_13958 domain; possibly S. pombe specific" FT /fasta_file="fasta/c106.tab.seq.03983.out" FT CDS 310688..315064 FT /colour=2 FT /gene="cut4" FT /gene="SPBC106.09" FT /label=cut4 FT /note="SPBC106.09, len:1458" FT /product=" anaphase-promoting complex (APC); required for FT cyclin degradation; required for metaphase-anaphase FT transition; putative target for the spindle checkpoint FT pathway; similar to S. cerevisiae APC1" FT /fasta_file="fasta/c106.tab.seq.03984.out" FT CDS 316691..318229 FT /EC_number="2.7.1.37" FT /colour=2 FT /gene="pka1" FT /gene="tpk" FT /gene="git6" FT /gene="SPBC106.10" FT /label=pka1 FT /note="SPBC106.10, len:512" FT /product="camp-dependent protein kinase catalytic subunit; FT serine/threonine protein kinase" FT /fasta_file="fasta/c106.tab.seq.03985.out" FT misc_feature 317291..318058 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 277.84" FT misc_feature 318059..318124 FT /colour=9 FT /note="Pfam match to entry PF00433 pkinase_C, protein FT kinase C terminal domain, score 12.80, E-value 0.011" FT CDS complement(319067..320383) FT /colour=7 FT /gene="SPBC106.11c" FT /label=SPBC106.11c FT /note="SPBC106.11c, len:438, SIMILARITY:Gallus gallus, FT PAFA_CHICK, platelet-activating factor acetylhydrolase , FT (422 aa), fasta scores: opt: 249, E():3.5e-09, (25.6% FT identity in 437 aa)" FT /product="putative phospholipase A2; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c106.tab.seq.03986.out" FT CDS complement(join(320864..321382,321543..321609, FT 321716..321840,321894..321962,322004..322048)) FT /colour=7 FT /gene="SPBC106.12c" FT /label=SPBC106.12c FT /note="SPBC106.12c, len:274, SIMILARITY:Mus musculus, FT O08583, transcriptional coactivator aly, (255 aa), fasta FT scores: opt: 196, E():3.4e-05, (28.0% identity in 182 aa)" FT /product="rrm type RNA-binding protein; putative RNA and FT export factor binding protein" FT /fasta_file="fasta/c106.tab.seq.03987.out" FT misc_feature complement(321383..321398) FT /colour=6 FT /note="ctaaccttttcttaag, splice branch and acceptor" FT misc_feature complement(321537..321542) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(321581..321790) FT /colour=9 FT /note="Pfam match to entry PF00076 rrm, RNA recognition FT motif. (a.k.a. RRM, RBD, or RNP domain), score 43.70, E- FT value 4.2e-09" FT misc_feature complement(321610..321627) FT /colour=6 FT /note="ctaacacagcaatcttag, splice branch and acceptor" FT misc_feature complement(321710..321715) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(321841..321860) FT /colour=6 FT /note="ctaattttttactttttaag, splice branch and acceptor" FT misc_feature complement(321888..321893) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature complement(321963..321975) FT /colour=6 FT /note="ttaacaatcctag, splice branch and acceptor" FT misc_feature complement(321998..322003) FT /colour=6 FT /note="gtaaat, splice donor sequence" FT CDS join(322395..322622,322685..323206,323257..323721) FT /colour=10 FT /gene="SPBC106.13" FT /label=SPBC106.13 FT /note="SPBC106.13, len:404, LOW SIMILARITY:Caenorhabditis FT elegans., O18188, w09g3.2 protein., (428 aa), fasta FT scores: opt: 421, E():2.8e-21, (25.6% identity in 363 aa)" FT /product="conserved protein; similar to S. cerevisiae FT YIL097W" FT /fasta_file="fasta/c106.tab.seq.03988.out" FT misc_feature 322623..322628 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 322664..322684 FT /colour=6 FT /note="cttacatggttctttgtgtag, splice branch and acceptor" FT misc_feature 323207..323212 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 323245..323256 FT /colour=6 FT /note="ctgacaaattag, splice branch and acceptor" FT misc_feature 323344..323376 FT /colour=8 FT /note="PS00639 Eukaryotic thiol (cysteine) proteases FT histidine active site" FT CDS complement(323961..326120) FT /colour=7 FT /gene="SPBC106.14c" FT /label=SPBC106.14c FT /note="SPBC106.14c, len:719, SIMILARITY:Saccharomyces FT cerevisiae, YG58_YEAST, hypothetical 86.6 kD protein in FT pfk1-tds4 intergenic region, (767 aa), fasta scores: opt: FT 1486, E():0, (43.2% identity in 790 aa)" FT /product="possibly required for actin cytoskeletal FT organisation; similar to S. cerevisiae SDA1" FT /fasta_file="fasta/c106.tab.seq.03989.out" FT CDS join(326573..326690,326755..327093,327150..327376) FT /EC_number="5.3.3.2" FT /colour=2 FT /gene="idi1" FT /gene="SPBC106.15" FT /label=idi1 FT /note="SPBC106.15, len:227" FT /product="isopentenyl-diphosphate delta-isomerase" FT /fasta_file="fasta/c106.tab.seq.03990.out" FT misc_feature 326691..326696 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 326739..326754 FT /colour=6 FT /note="ctaacaagccttttag, splice branch and acceptor" FT misc_feature 327094..327099 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 327134..327149 FT /colour=6 FT /note="ctaacggacattctag, splice branch and acceptor" FT CDS join(329195..329293,329354..329727,329846..330152) FT /EC_number="3.4.25.1" FT /colour=7 FT /gene="SPBC106.16" FT /label=SPBC106.16 FT /note="SPBC106.16, len:259, SIMILARITY:Saccharomyces FT cerevisiae, PRC6_YEAST, proteasome component pre6, (254 FT aa), fasta scores: opt: 954, E():0, (57.1% identity in 252 FT aa)" FT /product="20S proteasome component (alpha 4); similar to FT S. cerevisiae PRE6" FT /fasta_file="fasta/c106.tab.seq.03991.out" FT misc_feature 329294..329299 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 329334..329353 FT /colour=6 FT /note="cttacatatatcattaacag, splice branch and acceptor" FT misc_feature join(329354..329727,329846..329909) FT /note="Match to PF00227 proteasome, Proteasome A-type and FT B-type Score 157.94" FT misc_feature 329728..329733 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 329830..329845 FT /colour=6 FT /note="ttaacaaagaatatag, splice branch and acceptor" FT CDS complement(330819..332333) FT /colour=7 FT /gene="SPBC106.17c" FT /label=SPBC106.17c FT /note="SPBC106.17c, len:504, SIMILARITY:Emericella FT nidulans, O13389, putative homoserine o-acetyltransferase., FT (525 aa), fasta scores: opt: 1777, E():0, (58.6% FT identity in 473 aa)" FT /product="putative homoserine o-acetyltransferase; FT putative abhydrolase fold" FT /fasta_file="fasta/c106.tab.seq.03992.out" FT misc_feature complement(331146..331862) FT /note="Match to PF00561 abhydrolase, alpha/beta hydrolase FT fold Score 116.32" FT CDS join(333255..333352,333593..333920) FT /colour=2 FT /gene="rpl25a" FT /gene="SPBC106.18" FT /label=rpl25a FT /note="SPBC106.18, len:141" FT /product="60S ribosomal protein L25" FT /fasta_file="fasta/c106.tab.seq.03993.out" FT misc_feature 333353..333358 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT intron 333353..333592 FT /colour=2 FT /note="confirmed intron" FT misc_feature 333574..333592 FT /colour=6 FT /note="ctaacttatatctttatag, splice branch and acceptor" FT misc_feature 333669..333908 FT /note="Match to PF00276 Ribosomal_L23, Ribosomal protein FT L23 Score 102.72" FT misc_feature 335691..337886 FT /note="nominal overlap with cosmid SPBC582, EM:AL096788 S. FT pombe chromosome 2" FT misc_feature 337020..337025 FT /colour=6 FT /note="gtatct, splice donor sequence" FT misc_feature 337057..337069 FT /colour=6 FT /note="ctaactggtatag, splice branch and acceptor" FT misc_feature 337099..337104 FT /colour=6 FT /note="gtattt, splice donor sequence" FT misc_feature 337141..337158 FT /colour=6 FT /note="ctaattaaatcgttacag, splice branch and acceptor" FT misc_feature 337318..337323 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 337350..337363 FT /colour=6 FT /note="ctaatttgtttaag, splice branch and acceptor" FT misc_feature 337543..337584 FT /colour=8 FT /note="PS00300 SRP54-type proteins GTP-binding domain FT signature" FT misc_feature 335691..337886 FT /note="nominal overlap with cosmid SPBC106, EM:AL110295 S. FT pombe chromosome 2" FT misc_feature 337020..337025 FT /colour=6 FT /note="gtatct, splice donor sequence" FT misc_feature 337057..337069 FT /colour=6 FT /note="ctaactggtatag, splice branch and acceptor" FT misc_feature 337099..337104 FT /colour=6 FT /note="gtattt, splice donor sequence" FT misc_feature 337141..337158 FT /colour=6 FT /note="ctaattaaatcgttacag, splice branch and acceptor" FT misc_feature 337318..337323 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 337350..337363 FT /colour=6 FT /note="ctaatttgtttaag, splice branch and acceptor" FT misc_feature 338919..338924 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 338957..338971 FT /colour=6 FT /note="ctaacctctgtttag, splice branch and acceptor" FT misc_feature 339009..339014 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 339094..339109 FT /colour=6 FT /note="cttactcattacgtag, splice branch and acceptor" FT CDS 340822..342270 FT /colour=2 FT /gene="cdc13" FT /gene="SPBC582.03" FT /label=cdc13 FT /note="SPBC582.03, len:482" FT /product="G2/mitotic-specific cyclin; subcellular FT localization of GFP fusion- Nucleus" FT /fasta_file="fasta/c582.tab.seq.03873.out" FT misc_feature 341383..342150 FT /note="Match to PF00134 cyclin, Cyclin Score 494.03" FT CDS complement(join(342968..343297,343368..343437, FT 343481..343570,343611..344072,344123..344571, FT 344620..344859,344922..345049,345109..345145)) FT /colour=8 FT /gene="SPBC582.04c" FT /label=SPBC582.04c FT /note="SPBC582.04c, len:601" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c582.tab.seq.03874.out" FT misc_feature complement(343298..343307) FT /colour=6 FT /note="ctaattttag, splice branch and acceptor" FT misc_feature complement(343362..343367) FT /colour=6 FT /note="gtaaat, splice donor sequence" FT misc_feature complement(343438..343449) FT /colour=6 FT /note="ctgaccataaag, splice branch and acceptor" FT misc_feature complement(343475..343480) FT /colour=6 FT /note="gtaagg, splice donor sequence" FT misc_feature complement(343571..343585) FT /colour=6 FT /note="ctaacactcttgcag, splice branch and acceptor" FT misc_feature complement(343605..343610) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(344073..344087) FT /colour=6 FT /note="ttgacataactatag, splice branch and acceptor" FT misc_feature complement(344117..344122) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(344572..344585) FT /colour=6 FT /note="ttgacgattattag, splice branch and acceptor" FT misc_feature complement(344614..344619) FT /colour=6 FT /note="gtaata, splice donor sequence" FT misc_feature complement(344860..344882) FT /colour=6 FT /note="ctaattagcatatattactacag, splice branch and acceptor" FT misc_feature complement(344916..344921) FT /colour=6 FT /note="gtaggt, splice donor sequence" FT misc_feature complement(345050..345072) FT /colour=6 FT /note="ctaatatattgcttttcacctag, splice branch and acceptor" FT misc_feature complement(345103..345108) FT /colour=6 FT /note="gtatga, splice donor sequence" FT CDS complement(join(345859..348246,348333..348470, FT 348602..348712)) FT /colour=2 FT /gene="brc1" FT /gene="SPBC582.05c" FT /label=brc1 FT /note="SPBC582.05c, len:878, SIMILARITY:Saccharomyces FT cerevisiae, YHV4_YEAST, HYPOTHETICAL 123.0 kD PROTEIN, FT (1070 aa), fasta scores, opt:236, E(): 6.4e-07, (21.9% FT identity in 974 aa overlap)" FT /product="BRCT domain protein; cell cycle checkpoint FT family; similar to S. cerevisiae YHR154W" FT /fasta_file="fasta/c582.tab.seq.03875.out" FT misc_feature complement(345880..346197) FT /note="Match to PF00533 BRCT, BRCA1 C Terminus (BRCT) FT domain Score 45.81" FT misc_feature complement(346264..346503) FT /note="Match to PF00533 BRCT, BRCA1 C Terminus (BRCT) FT domain Score 45.09" FT misc_feature complement(347305..347565) FT /note="Match to PF00533 BRCT, BRCA1 C Terminus (BRCT) FT domain Score 69.04" FT misc_feature complement(347578..347847) FT /note="Match to PF00533 BRCT, BRCA1 C Terminus (BRCT) FT domain Score 55.47" FT misc_feature complement(347911..348183) FT /note="Match to PF00533 BRCT, BRCA1 C Terminus (BRCT) FT domain Score 77.10" FT misc_feature complement(348247..348260) FT /colour=6 FT /note="ctaactgtcgctag, splice branch and acceptor" FT misc_feature complement(348327..348332) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(348471..348488) FT /colour=6 FT /note="ctgactttgtttacctag, splice branch and acceptor" FT misc_feature complement(348596..348601) FT /colour=6 FT /note="gtacga, splice donor sequence" FT CDS complement(348882..349865) FT /colour=8 FT /gene="SPBC582.06c" FT /label=SPBC582.06c FT /note="SPBC582.06c, len:327," FT /product="hypothetical protein; sequence orphan; predicted FT coiled-coil protein" FT /fasta_file="fasta/c582.tab.seq.03876.out" FT CDS complement(350250..351479) FT /colour=2 FT /gene="rpn7" FT /gene="SPBC582.07c" FT /label=rpn7 FT /note="SPBC582.07c, len:409, SIMILARITY:Homo sapiens, FT Y107_HUMAN, hypothetical proteinkiaa0107., (389 aa), fasta FT scores: opt: 1040, E():0, (44.2% identity in 382 aa)" FT /product="19S proteasome regulatory subunit; similar to S. FT cerevisiae RPN7" FT /fasta_file="fasta/c582.tab.seq.03877.out" FT misc_feature complement(350328..350564) FT /note="Match to PF01399 PCI, PCI domain Score 112.89" FT CDS join(352249..352711,352903..353702,353756..354010) FT /EC_number="2.6.1.2" FT /colour=7 FT /gene="SPBC582.08" FT /label=SPBC582.08 FT /note="SPBC582.08, len:505, SIMILARITY:Saccharomyces FT cerevisiae, ALAT_YEAST, putative alanine aminotransferase, FT (507 aa), fasta scores: opt: 1412, E():0, (44.5% identity FT in 492 aa)" FT /product="putative alanine aminotransferase; similar to S. FT cerevisiae YDR117C" FT /fasta_file="fasta/c582.tab.seq.03878.out" FT misc_feature 352712..352717 FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature 352888..352902 FT /colour=6 FT /note="ctaattatattttag, splice branch and acceptor" FT misc_feature 352941..353417 FT /note="Match to PF00155 aminotran_1, Aminotransferases FT class-I Score 38.99" FT misc_feature 353703..353708 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 353738..353755 FT /colour=6 FT /note="ctaattcatattttcaag, splice branch and acceptor" FT CDS join(354572..354616,354661..354690,354982..355460, FT 355510..355672) FT /colour=7 FT /gene="SPBC582.09" FT /label=SPBC582.09 FT /note="SPBC582.09, len:238, SIMILARITY:Candida boidinii, FT PXBA_CANBO, peroxisomal membrane protein pmp30a, (256 aa), FT fasta scores: opt: 163, E():0.00027, (22.7% identity in FT 251 aa)" FT /product="putative peroxisome biogenesis factor; possibly FT involved in medium-chain fatty acid beta-oxidation; FT similar to S. cerevisiae PEX11" FT /fasta_file="fasta/c582.tab.seq.03879.out" FT misc_feature 354617..354622 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT intron 354617..354660 FT /colour=2 FT /note="confirmed intron" FT misc_feature 354632..354660 FT /colour=6 FT /note="ttgattgcatggtttataacattttatag, splice branch and FT acceptor" FT misc_feature 354691..354696 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT intron 354691..354981 FT /colour=2 FT /note="confirmed intron" FT misc_feature 354967..354981 FT /colour=6 FT /note="ctaattatgcgctag, splice branch and acceptor" FT misc_feature 355461..355466 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT intron 355461..355509 FT /colour=2 FT /note="confirmed intron" FT misc_feature 355492..355509 FT /colour=6 FT /note="ctaaccacatttgtgcag, splice branch and acceptor" FT CDS complement(join(355932..357635,357688..358476)) FT /colour=7 FT /gene="SPBC582.10c" FT /label=SPBC582.10c FT /note="SPBC582.10c, len:830, FT SIMILARITY:Schizosaccharomyces pombe, O74911, rad16 FT nucleotide-excision repair protein homolog., (963 aa), FT fasta scores: opt: 610, E():1.2e-32, (30.6% identity in FT 833 aa)" FT /product="rad16 nucleotide-excision repair protein homolog" FT /fasta_file="fasta/c582.tab.seq.03880.out" FT misc_feature complement(356124..356375) FT /note="Match to PF00271 helicase_C, Helicases conserved C- FT terminal domain Score 86.15" FT misc_feature complement(356766..357323) FT /note="Match to PF00176 SNF2_N, SNF2 and others N-terminal FT domain Score 138.37" FT misc_feature complement(357396..357635) FT /note="Match to PF00176 SNF2_N, SNF2 and others N-terminal FT domain Score 61.16" FT misc_feature complement(357636..357651) FT /colour=6 FT /note="ctaataatttttttag, splice branch and acceptor" FT misc_feature complement(357682..357687) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 360474..363689 FT /note="nominal overlap with cosmid SPBC428, EM:AL034382 S. FT pombe chromosome 2" FT misc_feature complement(360887..360900) FT /colour=6 FT /note="ttaatattctatag, splice branch and acceptor" FT misc_feature complement(360922..360927) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(361037..361053) FT /colour=6 FT /note="ttaacaacttttactag, splice branch and acceptor" FT misc_feature complement(361085..361090) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(361184..361196) FT /colour=6 FT /note="ttaacataaatag, splice branch and acceptor" FT misc_feature complement(361234..361239) FT /colour=6 FT /note="gtatgg, splice donor sequence" FT misc_feature complement(361367..361381) FT /colour=6 FT /note="ctaactatggtacag, splice branch and acceptor" FT misc_feature complement(361411..361416) FT /colour=6 FT /note="gtataa, splice donor sequence" FT misc_feature complement(361451..361462) FT /colour=6 FT /note="ttaaccatttag, splice branch and acceptor" FT misc_feature complement(361609..361614) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(362390..363301) FT /note="Match to PF01063 aminotran_4, Aminotransferase FT class IV Score 566.01" FT misc_feature 360474..363689 FT /note="nominal overlap with cosmid SPBC582, EM:AL096788 S. FT pombe chromosome 2" FT misc_feature complement(360887..360900) FT /colour=6 FT /note="ttaatattctatag, splice branch and acceptor" FT misc_feature complement(360922..360927) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(361037..361053) FT /colour=6 FT /note="ttaacaacttttactag, splice branch and acceptor" FT misc_feature complement(361085..361090) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(361184..361196) FT /colour=6 FT /note="ttaacataaatag, splice branch and acceptor" FT misc_feature complement(361234..361239) FT /colour=6 FT /note="gtatgg, splice donor sequence" FT misc_feature complement(361367..361381) FT /colour=6 FT /note="ctaactatggtacag, splice branch and acceptor" FT misc_feature complement(361411..361416) FT /colour=6 FT /note="gtataa, splice donor sequence" FT misc_feature complement(361451..361462) FT /colour=6 FT /note="ttaaccatttag, splice branch and acceptor" FT misc_feature complement(361486..361491) FT /colour=6 FT /note="gtttgt, splice donor sequence" FT misc_feature complement(361532..361552) FT /colour=6 FT /note="ctaacatacgaagagttctag, splice branch and acceptor" FT misc_feature complement(361609..361614) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(362387..363301) FT /colour=9 FT /note="Pfam match to entry PF01063 aminotran_4, FT Aminotransf erase class IV" FT misc_feature complement(362639..362743) FT /colour=8 FT /note="PS00770 Aminotransferases class-IV signature" FT CDS complement(365116..366507) FT /EC_number="3.1.3.2" FT /colour=2 FT /gene="pho4" FT /gene="SPBC428.03c" FT /label=pho4 FT /note="SPBC428.03c, len:463" FT /product="thiamine-repressible acid phosphatase" FT /fasta_file="fasta/c428.tab.seq.03583.out" FT misc_feature complement(365341..366321) FT /colour=9 FT /note="Pfam match to entry PF00328 acid_phosphat, FT Histidine acid phosphatases" FT misc_feature complement(365458..365508) FT /colour=8 FT /note="PS00778 Histidine acid phosphatases active site FT signature" FT misc_feature complement(366286..366330) FT /colour=8 FT /note="PS00616 Histidine acid phosphatases FT phosphohistidine signature" FT CDS 368633..368980 FT /colour=8 FT /gene="SPBC428.04" FT /label=SPBC428.04 FT /note="SPBC428.04, len:115" FT /product="hypothetical protein; sequence orphan; contains FT 2 predicted transmembrane helices" FT /fasta_file="fasta/c428.tab.seq.03584.out" FT CDS complement(369470..370702) FT /EC_number="6.3.4.5" FT /colour=7 FT /gene="SPBC428.05c" FT /label=SPBC428.05c FT /note="SPBC428.05c, len:410, SIMILARITY:Saccharomyces FT cerev isiae, ASSY_YEAST, argininosuccinate synthase, (420 FT aa), fa sta scores: opt: 1691, E():0, (61.5% identity in FT 408 aa)" FT /product="argininosuccinate synthase; similar to S. FT cerevisiae ARG1" FT /fasta_file="fasta/c428.tab.seq.03585.out" FT misc_feature complement(369485..370678) FT /colour=9 FT /note="Pfam match to entry PF00764 Arginosuc_synth, FT Arginos uccinate synthase" FT misc_feature complement(370316..370351) FT /colour=8 FT /note="PS00565 Argininosuccinate synthase signature 2" FT misc_feature complement(370646..370672) FT /colour=8 FT /note="PS00564 Argininosuccinate synthase signature 1" FT CDS complement(join(371688..372115,372296..372404, FT 372448..372578,372629..372663,372713..372738)) FT /colour=8 FT /gene="SPBC428.06c" FT /label=SPBC428.06c FT /note="SPBC428.06c, len:242" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c428.tab.seq.03586.out" FT misc_feature complement(372116..372136) FT /colour=6 FT /note="ctaactcagtaaaaattatag, splice branch and acceptor" FT misc_feature complement(372290..372295) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(372405..372422) FT /colour=6 FT /note="ctaaccactactttatag, splice branch and acceptor" FT misc_feature complement(372442..372447) FT /colour=6 FT /note="gtgagt, splice donor sequence" FT misc_feature complement(372579..372594) FT /colour=6 FT /note="ctaacatctcgtatag, splice branch and acceptor" FT misc_feature complement(372623..372628) FT /colour=6 FT /note="gtaatt, splice donor sequence" FT misc_feature complement(372664..372676) FT /colour=6 FT /note="ctaacaaatttag, splice branch and acceptor" FT misc_feature complement(372707..372712) FT /colour=6 FT /note="gtaggt, splice donor sequence" FT CDS join(373929..374296,374367..374643,374701..376011) FT /colour=2 FT /gene="meu6" FT /gene="SPBC428.07" FT /label=meu6 FT /note="SPBC428.07, len:651, VERY LOW FT SIMILARITY:Caenorhabdi tis elegans., O17338, t23e7.2b FT protein, (880 aa), fasta sco res: opt: 126, E():0.0002, FT (24.0% identity in 304 aa)" FT /product="hypothetical lysine-rich protein; predicted FT coiled-coil region; meiotic expression upregulated; FT contains putative NLS" FT /fasta_file="fasta/c428.tab.seq.03587.out" FT misc_feature 374297..374302 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 374353..374366 FT /colour=6 FT /note="ctaaccacatgtag, splice branch and acceptor" FT misc_feature 374644..374649 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 374685..374700 FT /colour=6 FT /note="ctaactgtattttcag, splice branch and acceptor" FT CDS complement(376274..377746) FT /colour=2 FT /gene="clr4" FT /gene="SPBC428.08c" FT /label=clr4 FT /note="SPBC428.08c, len:490" FT /product="histone H3 methyltransferase; mating-type locus FT protein; centromeric silencing protein; contains SET FT domain; chromodomain protein; no apparent S. cerevisiae FT ortholog" FT /fasta_file="fasta/c428.tab.seq.03588.out" FT misc_feature complement(376373..376789) FT /colour=9 FT /note="Pfam match to entry PF00856 SET, SET domain" FT misc_feature complement(377606..377668) FT /colour=8 FT /note="PS00598 Chromo domain signature" FT misc_feature complement(377606..377734) FT /colour=9 FT /note="Pfam match to entry PF00385 chromo, 'chromo' FT (CHRrom atin Organization MOdifier) domain" FT LTR 378177..378523 FT /colour=4 FT /note="lone tf1-type LTR" FT misc_feature complement(join(379782..380237,380344..380631)) FT /note="SPBC428.09c, removed -almost certainly non coding FT as no branch and no MET without splice. len:252" FT CDS 381005..383260 FT /colour=8 FT /gene="SPBC428.10" FT /label=SPBC428.10 FT /note="SPBC428.10, len:751, VERY LOW SIMILARITY:Neurospora FT crassa., O13335, ro11., (697 aa), fasta scores: opt: 123, FT E ():0.0002, (21.7% identity in 428 aa)" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c428.tab.seq.03589.out" FT tRNA 383937..384008 FT /note="tRNA His anticodon GTG" FT rRNA 384226..384344 FT /note="SPA Yeast (S.pombe) 5S ribosomal RNA." FT CDS 385332..386621 FT /EC_number="4.2.99.10" FT /colour=2 FT /gene="SPBC428.11" FT /label=SPBC428.11 FT /note="Sienko M., Brzywczy J., Kucharska A., Paszewski A.; FT Cloning and characterization of Schizosaccharomyces pombe FT homocysteine synthase gene; unpublished; AF012876" FT /product="homocysteine synthase" FT /fasta_file="fasta/c428.tab.seq.03590.out" FT misc_feature 385356..386612 FT /colour=9 FT /note="Pfam match to entry PF01053 Cys_Met_Meta_PP, Gamma- FT f amily of PLP-dependent enzymes" FT misc_feature 385935..385979 FT /colour=8 FT /note="PS00868 Cys/Met metabolism enzymes pyridoxal- FT phosphate attachment site9" FT snRNA complement(386724..387522) FT /note="putative small nuclear RNA by similar to SPSNU4 X FT 15491 Yeast snu4 gene for small nuclear RNA U4" FT CDS complement(join(387833..387897,387959..388117, FT 388213..388308,388498..388528)) FT /colour=7 FT /gene="SPBC428.12c" FT /label=SPBC428.12c FT /note="SPBC428.12c, len:116, SIMILARITY:Drosophila FT melanogaster, AAF01031, cyclophilin-33., (300 aa), fasta FT scores: opt: 241, E():8.2e-11, (44.7% identity in 94 aa)" FT /product="putative RNA-binding protein" FT /fasta_file="fasta/c428.tab.seq.03591.out" FT misc_feature complement(387898..387910) FT /colour=6 FT /note="ctaatttacgtag, splice branch and acceptor" FT misc_feature complement(387953..387958) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature complement(join(388011..388117,388213..388315)) FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 54.75" FT misc_feature complement(388118..388129) FT /colour=6 FT /note="ctaactttctag, splice branch and acceptor" FT misc_feature complement(388207..388212) FT /colour=6 FT /note="gtaaag, splice donor sequence" FT misc_feature complement(388309..388324) FT /colour=6 FT /note="ctaactttctttttag, splice branch and acceptor" FT misc_feature complement(388492..388497) FT /colour=6 FT /note="gtaagg, splice donor sequence" FT CDS complement(join(389087..389144,389193..389592, FT 389650..389824)) FT /colour=2 FT /gene="mob1" FT /gene="SPBC428.13c" FT /label=mob1 FT /note="SPBC428.13c, len:226, SIMILARITY:Saccharomyces FT cerev isaie, YIL106W, MOB1_YEAST, required for completion FT of mito sis and maintenance of ploidy, (1405 aa), fasta FT scores: op t: 751, E():0, (50.5% identity in 218 aa)" FT /product="required for cytokinesis; interacts with sid2p" FT /fasta_file="fasta/c428.tab.seq.03592.out" FT misc_feature complement(389145..389161) FT /colour=6 FT /note="ttaacaacaaatttcag, splice branch and acceptor" FT misc_feature complement(389187..389192) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(389593..389610) FT /colour=6 FT /note="ttaattgaatacttctag, splice branch and acceptor" FT misc_feature complement(389644..389649) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT CDS 390351..391403 FT /colour=7 FT /gene="SPBC428.14" FT /label=SPBC428.14 FT /note="SPBC428.14, len:350, SIMILARITY:Zea mays, Q41745, 1- FT acyl-glycerol-3-phosphate acyltransferase, (374 aa), FT fasta scores: opt: 392, E():3.3e-21, (24.9% identity in FT 297 aa)" FT /product="putative acetyltransferase; putative 1- FT acylglycerol-3-phosphate acyltransferase" FT /fasta_file="fasta/c428.tab.seq.03593.out" FT misc_feature 390639..391166 FT /note="Match to PF01553 Acyltransferase, Acyltransferase FT Score 35.57" FT CDS 391909..393138 FT /colour=10 FT /gene="SPBC428.15" FT /label=SPBC428.15 FT /note="SPBC428.15, len:409, SIMILARITY:Saccharomyces FT cerevi siae, YGR210C, YG4I_YEAST, similar to M.jannaschii FT GTP-b inding protein a, (411 aa), fasta scores: opt: 1655, FT E():0, (60.9% identity in 407 aa)" FT /product="GTP-binding protein; similar to S. cerevisiae FT YGR210C" FT /fasta_file="fasta/c428.tab.seq.03594.out" FT misc_feature 391939..391962 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS complement(join(393526..393762,393817..394075, FT 394135..394196)) FT /colour=7 FT /gene="SPBC428.16c" FT /label=SPBC428.16c FT /note="SPBC428.16c, len:185, SIMILARITY:Homo sapiens, FT Q1538 2, ras-related GTP-binding protein, (184 aa), fasta FT scores: opt: 633, E():0, (52.2% identity in 184 aa)" FT /product="putative ras-related GTP-binding protein" FT /fasta_file="fasta/c428.tab.seq.03595.out" FT misc_feature complement(join(393532..394075,394135..394172)) FT /note="Match to PF00071 ras, Ras family Score 160.11" FT misc_feature complement(393763..393782) FT /colour=6 FT /note="ctaacctacttgctattaag, splice branch and acceptor" FT intron complement(393763..393816) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(393811..393816) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(394076..394096) FT /colour=6 FT /note="ctaaccattttttttaaatag, splice branch and acceptor" FT intron complement(394076..394134) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(394129..394134) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature complement(394137..394160) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS complement(join(394326..394580,394626..394678, FT 394719..396219)) FT /colour=8 FT /gene="SPBC428.17c" FT /label=SPBC428.17c FT /note="SPBC428.17c, len:602" FT /product="hypothetical serine rich protein; sequence FT orphan; subcellular localization of GFP fusion- Nucleus" FT /fasta_file="fasta/c428.tab.seq.03596.out" FT misc_feature complement(394581..394593) FT /colour=6 FT /note="ctaacaaatgtag, splice branch and acceptor" FT misc_feature complement(394620..394625) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(394679..394692) FT /colour=6 FT /note="ctaattctatttag, splice branch and acceptor" FT misc_feature complement(394713..394718) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS 397064..398398 FT /colour=2 FT /gene="cdt1" FT /gene="SPBC428.18" FT /label=cdt1 FT /note="SPBC428.18, len:444" FT /product="replication initiation factor; cell division FT cycle protein; essential; target of the cdc10/sct1 Tf; FT required for DNA synthesis; required for the inhibition of FT mitosis; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c428.tab.seq.00044.out" FT CDS complement(join(398902..400068,400278..400595)) FT /colour=10 FT /gene="SPBC428.19c" FT /label=SPBC428.19c FT /note="SPBC428.19c, len:494, SIMILARITY:Saccharomyces FT cerev isiae, YMR093W, YMY3_YEAST, weak similarity to Pwp2p, FT (535 aa), fasta scores: opt: 759, E():0, (35.4% identity FT in 517 aa)" FT /product="WD repeat protein; similar to S. cerevisiae FT YMR093W" FT /fasta_file="fasta/c428.tab.seq.03598.out" FT misc_feature complement(399553..399666) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 31.83" FT misc_feature complement(399805..399849) FT /colour=8 FT /note="PS00678 Trp-Asp (WD) repeats signature" FT misc_feature complement(399808..399921) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 40.54" FT misc_feature complement(399931..400050) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 27.52" FT misc_feature complement(400069..400084) FT /colour=6 FT /note="ctaatgtactttcag, splice branch and acceptor" FT misc_feature complement(400272..400277) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(401117..401140) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature complement(401252..401268) FT /colour=6 FT /note="ctaaccattggaaacag, splice branch and acceptor" FT misc_feature complement(401332..401337) FT /colour=6 FT /note="gtttgt, splice donor sequence" FT misc_feature 401627..401728 FT /note="nominal overlap with cosmid SPBC902, EM:AL133306 S. FT pombe chromosome 2" FT misc_feature 401627..401728 FT /note="nominal overlap with cosmid SPBC428, EM:AL034382 S. FT pombe chromosome 2" FT CDS complement(join(403648..404011,404061..404191, FT 404272..406659)) FT /colour=2 FT /gene="ctf18" FT /gene="chl12" FT /gene="SPBC902.02c" FT /label=SPBC902.02c FT /note="SPBC902.02c, len:960, SIMILARITY:Saccharomyces FT cerevisiae, CH12_YEAST, chl12 protein., (741 aa), fasta FT scores: opt: 894, E():0, (28.7% identity in 705 aa)" FT /product="RFC-1 related protein; required for chromosome FT transmission; similar to S. cerevisiae CHL12 protein FT involved in recombination and telomere length regulation; FT possibly involved in sister chromatid cohesion" FT /fasta_file="fasta/c902.tab.seq.04154.out" FT misc_feature complement(404012..404024) FT /colour=6 FT /note="ctaacgttgacag, splice branch and acceptor" FT misc_feature complement(404055..404060) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(404192..404205) FT /colour=6 FT /note="ctaactttttatag, splice branch and acceptor" FT misc_feature complement(404266..404271) FT /colour=6 FT /note="gtaagg, splice donor sequence" FT CDS 407929..408471 FT /colour=8 FT /gene="SPBC902.03" FT /label=SPBC902.03 FT /note="SPBC902.03, len:180" FT /product="hypothetical protein; very low similar to yeast FT spo7; sequence orphan; contains 2 predicted transmembrane FT helices" FT /fasta_file="fasta/c902.tab.seq.04155.out" FT CDS join(409581..409610,409649..409686,409777..411319, FT 411374..411532) FT /colour=10 FT /gene="SPBC902.04" FT /label=SPBC902.04 FT /note="SPBC902.04, len:589 SIMILARITY: C. elegans, Q10954, FT hypothetical protein (717 aa), fasta scores, opt: 311, , FT E(): 5.7e-09, (23.7% identity in 490 aa overlap)" FT /product="rrm motif nuclear RNA-binding protein; predicted FT coiled-coil region; GFP fusion nuclear; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c902.tab.seq.04156.out" FT misc_feature 409611..409616 FT /colour=6 FT /note="gtaatt, splice donor sequence" FT misc_feature 409636..409648 FT /colour=6 FT /note="ttaacgcttttag, splice branch and acceptor" FT misc_feature 409687..409692 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 409761..409776 FT /colour=6 FT /note="ctaacgaaatgactag, splice branch and acceptor" FT misc_feature 410310..410507 FT /colour=9 FT /note="Pfam match to entry PF00076 rrm, RNA recognition FT motif. (a.k.a. RRM, RBD, or RNP domain)," FT misc_feature 411320..411325 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 411360..411373 FT /colour=6 FT /note="ttaacaaattttag, splice branch and acceptor" FT CDS complement(join(411861..411967,412018..412782, FT 412937..412985,413033..413176,413283..413354)) FT /EC_number="1.1.1.41" FT /colour=7 FT /gene="idh2" FT /gene="glu2" FT /gene="SPBC902.05c" FT /label=idh2 FT /note="SPBC902.05c, len:378, SIMILARITY:Saccharomyces FT cerevisiae, IDH2_YEAST, isocitrate dehydrogenase [nad] FT subunit 2, mitochondrial (ec 1.1.1.41), (369 aa), fasta FT scores: opt: 1468, E():0, (62.5% identity in 365 aa)" FT /product="isocitrate dehydrogenase (NAD+) subunit 2; FT mitochondrial; similar to S. cerevisiae IDH2" FT /fasta_file="fasta/c902.tab.seq.04157.out" FT misc_feature complement(join(411879..411967,412018..412777)) FT /note="Match to PF00180 isodh, Isocitrate and FT isopropylmalate dehydrogenases Score 399.25" FT misc_feature complement(411968..411981) FT /colour=6 FT /note="ctaattaccattag, splice branch and acceptor" FT misc_feature complement(412012..412017) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(412783..412795) FT /colour=6 FT /note="ctaattcgtttag, splice branch and acceptor" FT misc_feature complement(412931..412936) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(412986..413004) FT /colour=6 FT /note="ttaacgacttgtattgtag, splice branch and acceptor" FT misc_feature complement(413027..413032) FT /colour=6 FT /note="gtttgt, splice donor sequence" FT misc_feature complement(413033..413110) FT /note="Match to PF00180 isodh, Isocitrate and FT isopropylmalate dehydrogenases Score 26.11" FT misc_feature complement(413177..413198) FT /colour=6 FT /note="ttaacagagttatttttagcag, splice branch and acceptor" FT misc_feature complement(413277..413282) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS 414441..415634 FT /colour=8 FT /gene="SPBC902.06" FT /label=SPBC902.06 FT /note="SPBC902.06, len:397" FT /product="hypothetical protein; predicted coiled-coil FT region; sequence orphan" FT /fasta_file="fasta/c902.tab.seq.04158.out" FT misc_feature 415976..416076 FT /note="nominal overlap with cosmid SPBC1685, EM:AL031154 FT S. pombe chromosome 2" FT misc_feature 415976..416076 FT /note="nominal overlap with cosmid SPBC902, EM:AL133306 S. FT pombe chromosome 2" FT CDS 416512..417348 FT /EC_number="3.1.3.48" FT /colour=2 FT /gene="pmp1" FT /gene="SPBC1685.01" FT /label=pmp1 FT /note="SPBC1685.01, len:278aa" FT /product="dual-specificity map kinase phosphatase" FT /fasta_file="fasta/c1685.tab.seq.03072.out" FT misc_feature 416689..417144 FT /note="Match to PF00782 DSPc, Dual specificity phosphatase, FT catalytic domain Score 225.35" FT CDS complement(join(418186..418242,418300..418689)) FT /colour=2 FT /gene="rps12-2" FT /gene="SPBC1685.02c" FT /label=rps12-2 FT /note="SPBC1685.02c, len:148aa" FT /product="40S ribosomal protein S12" FT /fasta_file="fasta/c1685.tab.seq.03073.out" FT misc_feature complement(418243..418258) FT /colour=6 FT /note="ctaacttattttttag, splice branch and acceptor" FT intron complement(418243..418299) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(418294..418299) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(418294..418605) FT /note="Match to PF01164 Ribosomal_S12e, Ribosomal protein FT S12e Score 230.23" FT CDS join(419073..419096,419255..419568,419629..419860) FT /colour=7 FT /gene="SPBC1685.03" FT /label=SPBC1685.03 FT /note="SPBC1685.03, len:189, SIMILARITY:Saccharomyces FT cerevisiae, SC11_YEAST, signal sequence processing protein FT sec11, (167 aa), fasta scores: opt: 307, E():6.5e-14, FT (41.1% identity in 185 aa)" FT /product="signal sequence processing protein, peptidase" FT /fasta_file="fasta/c1685.tab.seq.03074.out" FT misc_feature 419097..419102 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 419236..419254 FT /colour=6 FT /note="ctaacgtgtaaatttacag, splice branch and acceptor" FT misc_feature 419243..419557 FT /note="Match to PF00461 Peptidase_S26, Signal peptidase I FT Score 54.66" FT misc_feature 419569..419574 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 419615..419628 FT /colour=6 FT /note="ctaacttgaatcag, splice branch and acceptor" FT CDS 422572..423549 FT /colour=8 FT /gene="SPBC1685.04" FT /label=SPBC1685.04 FT /note="SPBC1685.04, len:325aa" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c1685.tab.seq.03075.out" FT CDS 425622..428615 FT /colour=7 FT /gene="SPBC1685.05" FT /label=SPBC1685.05 FT /note="SPBC1685.05, len:997, SIMILARITY:Saccharomyces FT cerevisiae, YNM3_YEAST, hypothetical 110.9 kD protein in FT spc98-tom70 intergenic region., (997 aa), fasta scores: FT opt: 1695, E():0, (33.5% identity in 972 aa)" FT /product="putative serine protease" FT /fasta_file="fasta/c1685.tab.seq.03076.out" FT CDS join(429201..429594,429641..430683) FT /colour=2 FT /function="deletion causes sensitivity to low-dose FT caffeine and hydroxyurea" FT /gene="cid11" FT /gene="SPBC1685.06" FT /label=cid11 FT /note="SPBC1685.06, len:478, FT SIMILARITY:Schizosaccharomyces pombe, CAB57438, FT hypothetical 65.8 kD protein, SPAC821.04C, (578 aa), fasta FT scores: opt: 970, E():0, (38.9% identity in 432 aa)" FT /product="cid1-related; putative nucleotidyl transferase; FT putative DNA polymerase kappa" FT /fasta_file="fasta/c1685.tab.seq.03077.out" FT misc_feature 429595..429600 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 429626..429640 FT /colour=6 FT /note="ctaaccaggaaacag, splice branch and acceptor" FT CDS complement(430903..432165) FT /colour=7 FT /gene="SPBC1685.07c" FT /label=SPBC1685.07c FT /note="SPBC1685.07c, len:420, SIMILARITY:Saccharomyces FT cerevisiae, YEU9_YEAST, hypothetical 48.8 kD protein in FT ssu81-scs2 intergenic region., (448 aa), fasta scores: FT opt: 760, E():0, (36.9% identity in 445 aa)" FT /product="putative AAAP amino acid transporter" FT /fasta_file="fasta/c1685.tab.seq.03078.out" FT misc_feature complement(430963..432039) FT /note="Match to PF01490 Aa_trans, Transmembrane amino acid FT transporter protein Score 191.48" FT CDS join(433915..434252,434423..434626,434671..435403) FT /colour=10 FT /gene="SPBC1685.08" FT /label=SPBC1685.08 FT /note="SPBC1685.08, len:424, SIMILARITY:Saccharomyces FT cerevisiae, Q08923, orf ypl181w., (506 aa), fasta scores: FT opt: 319, E():1.2e-10, (27.5% identity in 494 aa)" FT /product="zinc finger protein; zf-PHD finger (2); similar FT to S. cerevisiae YPL181W; GFP fusion localizes to Nucleus FT and cytoplasm" FT /fasta_file="fasta/c1685.tab.seq.03079.out" FT misc_feature 434056..434214 FT /note="Match to PF00628 PHD, PHD-finger Score 43.38" FT misc_feature 434253..434258 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 434408..434422 FT /colour=6 FT /note="ctaacttcgccgcag, splice branch and acceptor" FT misc_feature 434627..434632 FT /colour=6 FT /note="gtatgg, splice donor sequence" FT misc_feature 434657..434670 FT /colour=6 FT /note="ctaactgtttttag, splice branch and acceptor" FT CDS join(436141..436202,436254..436353,436426..436434) FT /colour=2 FT /gene="rps29" FT /gene="SPBC1685.09" FT /label=rps29 FT /note="SPBC1685.09, len:56" FT /product="40S ribosomal protein S29" FT /fasta_file="fasta/c1685.tab.seq.03080.out" FT misc_feature 436203..436208 FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature 436238..436253 FT /colour=6 FT /note="ttaattcataatttag, splice branch and acceptor" FT misc_feature 436258..436353 FT /note="Match to PF00253 Ribosomal_S14, Ribosomal protein FT S14p/S29e Score 41.26" FT misc_feature 436354..436359 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT intron 436354..436425 FT /colour=2 FT /note="confirmed intron" FT misc_feature 436413..436425 FT /colour=6 FT /note="ttaactagtttag, splice branch and acceptor" FT CDS join(437043..437048,437087..437179,437384..437536) FT /colour=2 FT /gene="rps27" FT /gene="SPBC1685.10" FT /label=rps27 FT /note="SPBC1685.10, len:83" FT /product="40S ribosomal protein S27" FT /fasta_file="fasta/c1685.tab.seq.03081.out" FT misc_feature 437049..437054 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 437075..437086 FT /colour=6 FT /note="ctaacaaagtag, splice branch and acceptor" FT misc_feature 437180..437185 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT intron 437180..437383 FT /colour=2 FT /note="confirmed intron" FT misc_feature 437368..437383 FT /colour=6 FT /note="ctaactattttttag, splice branch and acceptor" FT misc_feature 437384..437530 FT /note="Match to PF01667 Ribosomal_S27e, Ribosomal protein FT S27 Score 117.54" FT CDS 438071..439162 FT /colour=7 FT /gene="SPBC1685.11" FT /label=SPBC1685.11 FT /note="SPBC1685.11, len:363, SIMILARITY to N- FT terminalof:Homo sapiens, O43543, x-ray repair cross- FT complementing protein 2, (280 aa), fasta scores: opt: 125, FT E():0.18, (30.6% identity in 111 aa)" FT /product="putative DNA repair protein; shares conserved FT SGKTE[LM]LYHL (possibly ATP/GTP binding motif) with human FT and mouse XRCC2 protein; no apparent S. cerevisiae FT ortholog" FT /fasta_file="fasta/c1685.tab.seq.00063.out" FT misc_feature 438215..438238 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT rRNA 439953..440193 FT /note="S.pombe 5s rRNA gene" FT misc_feature 440193..445790 FT /note="putative gene-free region" FT CDS complement(443586..443939) FT /colour=9 FT /gene="SPBC1685.12c" FT /label=SPBC1685.12c FT /note="SPBC1685.12c, len:117aa, probably not coding" FT /product="very hypothetical protein" FT /fasta_file="fasta/c1685.tab.seq.03083.out" FT CDS 445790..446341 FT /colour=7 FT /gene="SPBC1685.13" FT /label=SPBC1685.13 FT /note="SPBC1685.13, len:183aa, similar eg. to YPR149W, FT NCE2 _YEAST,Q12207 , non-classical export protein nce2, FT (173aa), fasta scores, opt:267, E():3.8e-11, (30.1% FT identity in 166 aa overlap)" FT /note="SPBC1685.13, len:183, SIMILARITY:Saccharomyces FT cerevisiae, NCE2_YEAST, non-classical export protein nce2., FT (173 aa), fasta scores: opt: 267, E():1.1e-11, (30.1% FT identity in 166 aa)" FT /product="possibly involved in non-classical protein FT export pathway for proteins that lack standard secretory FT signal sequences; similar to S. cerevisiae nce102" FT /fasta_file="fasta/c1685.tab.seq.03084.out" FT misc_feature complement(446541..446797) FT /note="gt repeat region similar to human/mouse repeated FT reg ion" FT mRNA 446742..448065 FT /note="mRNA from AU011804and AU007212" FT CDS complement(join(449152..451441,451511..451603, FT 451656..451678)) FT /colour=10 FT /gene="SPBC1685.14c" FT /label=SPBC1685.14c FT /note="SPBC1685.14c, len:803, SIMILARITY:Saccharomyces FT cerevisiae, YNV2_YEAST, hypothetical 88.8 kD protein in FT pex17-mer1 intergenic region., (782 aa), fasta scores: FT opt: 1340, E():0, (32.7% identity in 813 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YNL212W" FT /fasta_file="fasta/c1685.tab.seq.03085.out" FT misc_feature complement(451442..451456) FT /colour=6 FT /note="ctaacgattgtatag, splice branch and acceptor" FT misc_feature complement(451505..451510) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(451604..451619) FT /colour=6 FT /note="ctaacttaagatctag, splice branch and acceptor" FT misc_feature complement(451650..451655) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 452373..453361 FT /note="nominal overlap with cosmid SPBC649, EM:AL023587 S. FT pombe chromosome 2" FT misc_feature complement(452373..453361) FT /note="nominal overlap with cosmid SPBC1685, EM:AL031154 FT S.pombe chromosome 2" FT misc_feature complement(453500..454471) FT /note="Match to PF00225 kinesin, Kinesin motor domain FT Score 359.55" FT misc_feature complement(453857..453892) FT /colour=8 FT /note="PS00411 Kinesin motor domain signature" FT misc_feature complement(454720..454731) FT /colour=6 FT /note="ctgaccatcaag, splice branch and acceptor" FT misc_feature complement(454754..454759) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT CDS join(455082..455157,455331..455686) FT /colour=2 FT /gene="rps19-2" FT /gene="SPBC649.02" FT /label=rps1-2 FT /note="SPBC649.02, len:143" FT /product="40S ribosomal protein S19" FT /fasta_file="fasta/c649.tab.seq.03010.out" FT misc_feature join(455091..455157,455331..455683) FT /note="Match to PF01090 Ribosomal_S19e, Ribosomal protein FT S19e Score 297.30" FT misc_feature 455158..455163 FT /colour=6 FT /note="gtaggt, splice donor sequence" FT intron 455158..455330 FT /colour=2 FT /note="confirmed intron" FT misc_feature 455316..455330 FT /colour=6 FT /note="ctaactgatccgtag, splice branch and acceptor" FT misc_feature 455519..455578 FT /colour=8 FT /note="PS00628 Ribosomal protein S19e signature" FT CDS 456684..457553 FT /colour=2 FT /gene="rhp14" FT /gene="SPBC649.03" FT /label=rhp14 FT /note="SPBC649.03, len:289, SIMILARITY:Saccharomyces FT cerevisiae, RA14_YEAST, DNA repair protein rad14., (371 FT aa), fasta scores: opt: 574, E():8.5e-28, (39.9% identity FT in 283 aa)" FT /product="nucleotide-excision repair protein; XPA family; FT similar to S. cerevisiae RAD14" FT /fasta_file="fasta/c649.tab.seq.03011.out" FT misc_feature 456687..457550 FT /note="Match to PF01286 XPA, XPA protein Score 171.07" FT CDS join(459117..459152,459222..459403,459614..459659) FT /colour=2 FT /gene="uvi15" FT /gene="SPBC649.04" FT /label=uvi15 FT /note="SPBC649.04, len:87" FT /product="required for the maintenance of viability of FT cells in stationary phase and in starvation condition; FT induced by UV, alkylating agents and heat shock; similar FT to S. cerevisiae YDL012C" FT /fasta_file="fasta/c649.tab.seq.00013.out" FT misc_feature 459153..459158 FT /colour=6 FT /note="gtatgg, splice donor sequence" FT intron 459153..459221 FT /note="confirmed by mRNA" FT misc_feature 459203..459221 FT /colour=6 FT /note="ctaacagcttcaattttag, splice branch and acceptor" FT misc_feature 459404..459409 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT intron 459404..459613 FT /colour=2 FT /note="confirmed intron" FT misc_feature 459597..459613 FT /colour=6 FT /note="ctaacgactgtttttag, splice branch and acceptor" FT CDS join(460982..460988,461031..462670) FT /colour=2 FT /gene="cut12" FT /gene="stf1" FT /gene="SPBC649.05" FT /label=cut12 FT /note="SPBC649.05, len:548" FT /product="spindle pole body component; no apparent FT orthologs" FT /fasta_file="fasta/c649.tab.seq.03013.out" FT misc_feature 460989..460994 FT /colour=6 FT /note="gtaagg, splice donor sequence" FT misc_feature 461014..461030 FT /colour=6 FT /note="ctaatctcaaaatttag, splice branch and acceptor" FT misc_feature 463138..463143 FT /colour=6 FT /note="gtaaat, splice donor sequence" FT intron 463138..463182 FT /colour=2 FT /note="confirmed intron" FT misc_feature 463165..463182 FT /colour=6 FT /note="ctaatctaaattggctag, splice branch and acceptor" FT misc_feature join(463183..463251,463367..463537,463591..464370) FT /note="Match to PF01018 GTP1_OBG, GTP1/OBG family Score FT 542.34" FT misc_feature 463252..463257 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT intron 463252..463366 FT /colour=2 FT /note="confirmed intron" FT misc_feature 463350..463366 FT /colour=6 FT /note="ctaacctagtcctttag, splice branch and acceptor" FT misc_feature 463484..463507 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 463538..463543 FT /colour=6 FT /note="gtttgc, splice donor sequence" FT intron 463538..463590 FT /colour=2 FT /note="confirmed intron" FT misc_feature 463573..463590 FT /colour=6 FT /note="ctaacaatggtaatatag, splice branch and acceptor" FT misc_feature 463675..463716 FT /colour=8 FT /note="PS00905 GTP1/OBG family signature" FT misc_feature 464017..464371 FT /note="nominal overlap with cosmid SPBC354, EM:AL022071 FT S.pombe chromosome 2" FT misc_feature 464017..464371 FT /note="nominal overlap with cosmid SPBC649, EM:AL023587 S. FT pombe chromosome 2" FT CDS complement(join(464770..465851,466030..466163, FT 466289..466321,466378..466490,466544..466611, FT 466656..466665)) FT /colour=2 FT /gene="sec61" FT /gene="SPBC354.02c" FT /label=sec61 FT /note="SPBC354.02c, len:479" FT /product="protein transport protein sec61 alpha subunit; FT subcellular localization of GFP fusion- Membrane" FT /fasta_file="fasta/c354.tab.seq.02833.out" FT misc_feature complement(join(464860..465851,466030..466150)) FT /note="Match to PF00344 secY, eubacterial secY protein FT Score 34.26" FT misc_feature complement(465852..465866) FT /colour=6 FT /note="ctaactttaatttag, splice branch and acceptor" FT intron complement(465852..466029) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(466024..466029) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(466103..466162) FT /colour=8 FT /note="PS00755 protein secY signature 1" FT misc_feature complement(466164..466177) FT /colour=6 FT /note="ctaaccattataag, splice branch and acceptor" FT intron complement(466164..466288) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(466283..466288) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(466322..466337) FT /colour=6 FT /note="ctaatgactttttcag, splice branch and acceptor" FT intron complement(466322..466377) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(466372..466377) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature complement(466491..466506) FT /colour=6 FT /note="ctaatatcgaatctag, splice branch and acceptor" FT intron complement(466491..466543) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(466538..466543) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(466612..466625) FT /colour=6 FT /note="ctaacactatacag, splice branch and acceptor" FT intron complement(466612..466655) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(466650..466655) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT CDS 468369..469511 FT /colour=7 FT /gene="SPBC354.03" FT /label=SPBC354.03 FT /note="SPBC354.03, len:380, SIMILARITY:Caenorhabditis FT elegans., YKY4_CAEEL, hypothetical 40.4 kD trp-asp repeats FT containing protein c14b1.4 inchromosome iii., (376 aa), FT fasta scores: opt: 751, E():0, (44.3% identity in 235 aa)" FT /product="WD repeat protein" FT /fasta_file="fasta/c354.tab.seq.02834.out" FT misc_feature 468516..468614 FT /colour=9 FT /note="Pfam match to entry G-beta PF00400, WD domain, G- FT bet a repeats" FT misc_feature 468642..468740 FT /colour=9 FT /note="Pfam match to entry G-beta PF00400, WD domain, G- FT bet a repeats" FT misc_feature 468699..468743 FT /colour=8 FT /note="PS00678 Beta-transducin family Trp-Asp repeats FT signa ture" FT misc_feature 468768..468866 FT /colour=9 FT /note="Pfam match to entry G-beta PF00400, WD domain, G- FT bet a repeats" FT misc_feature 468825..468869 FT /colour=8 FT /note="PS00678 Beta-transducin family Trp-Asp repeats FT signa ture" FT misc_feature 468894..468992 FT /colour=9 FT /note="Pfam match to entry G-beta PF00400, WD domain, G- FT bet a repeats" FT misc_feature 468951..468995 FT /colour=8 FT /note="PS00678 Beta-transducin family Trp-Asp repeats FT signa ture" FT CDS 469995..470486 FT /colour=9 FT /gene="SPBC354.04" FT /label=SPBC354.04 FT /note="SPBC354.04, len:163, SIMILARITY:Schizosaccharomyces FT pombe, O74520, hypothetical transmembrane protein., (646 FT aa), fasta scores: opt: 107, E():3.4, (31.0% identity in FT 84 aa)" FT /product="very hypothetical protein" FT /fasta_file="fasta/c354.tab.seq.02835.out" FT CDS complement(471442..473823) FT /colour=7 FT /gene="SPBC354.05c" FT /label=SPBC354.05c FT /note="SPBC354.05c, len:793, FT SIMILARITY:Schizosaccharomyces pombe, CAB52036, putative FT DNA-binding protein, SPBC19C2.09, (900 aa), fasta scores: FT opt: 331, E():1.4e-10, (30.8% identity in 338 aa)" FT /product="putative transcription factor; myc family; basic FT helix-loop-helix DNA binding domain (bHLH); predicted FT membrane-tethered transcription factor (PMID: 11790253); FT contains 2 predicted transmembrane helices" FT /fasta_file="fasta/c354.tab.seq.02836.out" FT misc_feature complement(472336..472545) FT /colour=9 FT /note="Pfam match to entry HLH PF00010, Helix-loop-helix FT DN A-binding domain" FT misc_feature complement(472339..472386) FT /colour=8 FT /note="PS00038 Myc-type, 'helix-loop-helix' dimerization FT domain signature" FT CDS join(475592..475668,476098..476311) FT /colour=7 FT /gene="SPBC354.06" FT /label=SPBC354.06 FT /note="SPBC354.06, len:96, SIMILARITY:Neurospora crassa., FT RT24_NEUCR, mitochondrial ribosomal protein S24., (107 aa), FT fasta scores: opt: 318, E():6.5e-17, (59.5% identity in FT 84 aa)" FT /product="mitochondrial ribosomal protein S16" FT /fasta_file="fasta/c354.tab.seq.02837.out" FT misc_feature join(475616..475668,476098..476251) FT /note="Match to PF00886 Ribosomal_S16, Ribosomal protein FT S16 Score 66.96" FT misc_feature 475669..475674 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 476084..476097 FT /colour=6 FT /note="ttaactcaatatag, splice branch and acceptor" FT CDS complement(join(478034..478924,478972..479173, FT 479641..479727,479850..479869)) FT /colour=7 FT /gene="SPBC354.07c" FT /label=SPBC354.07c FT /note="SPBC354.07c, len:371, N-terminalexons are tentative, FT SIMILARITY:Schizosaccharomyces pombe, O74178, kes1, (386 FT aa), fasta scores: opt: 1138, E():0, (46.4% identity in FT 371 aa)" FT /product="ergosterol biosynthesis protein" FT /fasta_file="fasta/c354.tab.seq.02838.out" FT misc_feature complement(join(478037..478924,478972..479173, FT 479641..479747)) FT /note="Match to PF01237 Oxysterol_BP, Oxysterol-binding FT protein Score 143.91" FT misc_feature complement(478925..478940) FT /colour=6 FT /note="ttaaccaaaatttcag, splice branch and acceptor" FT misc_feature complement(478966..478971) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(479174..479190) FT /colour=6 FT /note="ctaactttacttcacag, splice branch and acceptor" FT misc_feature complement(479635..479640) FT /colour=6 FT /note="gtaaat, splice donor sequence" FT misc_feature complement(479728..479748) FT /colour=6 FT /note="cttactttttcttcaaaaaag, splice branch and acceptor" FT misc_feature complement(479844..479849) FT /colour=6 FT /note="gtatga, splice donor sequence" FT CDS complement(join(481203..483627,483664..483836)) FT /colour=10 FT /gene="SPBC354.08c" FT /label=SPBC354.08c FT /note="SPBC354.08c, len:865, SIMILARITY:Arabidopsis FT thaliana, G3924615, hypothetical 77.8 kD protein, (680 aa), FT fasta scores: opt: 370, E():1e-16, (23.1% identity in FT 633 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT SPO75; predicted integral membrane; contains DUF221" FT /fasta_file="fasta/c354.tab.seq.02839.out" FT misc_feature complement(483628..483644) FT /colour=6 FT /note="ctaacgtcgttgactag, splice branch and acceptor" FT misc_feature complement(483658..483663) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS complement(485009..487393) FT /colour=7 FT /gene="SPBC354.09c" FT /label=SPBC354.09c FT /note="SPBC354.09c, len:794, SIMILARITY:Rattus norvegicus, FT O54697, i100., (745 aa), fasta scores: opt: 642, E():0, FT (27.5% identity in 680 aa)" FT /product="similar transferrin receptor protein; contains FT PA (protease associated) domain" FT /fasta_file="fasta/c354.tab.seq.02840.out" FT rRNA 488820..489004 FT /note="SPRG5S yeast (s.pombe) 5s rRNA gene" FT tRNA 489855..489925 FT /note="tRNA Gly anticodon GCC, Cove score 72.94" FT CDS 490760..493651 FT /colour=10 FT /gene="SPBC354.10" FT /label=SPBC354.10 FT /note="SPBC354.10, len:963" FT /product="agglutinin-like; serine-rich protein; putative FT glucoamylase; predicted cell surface protein" FT /fasta_file="fasta/c354.tab.seq.02841.out" FT CDS complement(495472..495990) FT /colour=8 FT /gene="SPBC354.11c" FT /label=SPBC354.11c FT /note="SPBC354.11c, len:172" FT /product="hypothetical protein; sequence orphan; contains FT 4 predicted transmembrane helices" FT /fasta_file="fasta/c354.tab.seq.02842.out" FT CDS 498430..499437 FT /EC_number="1.2.1.12" FT /colour=2 FT /gene="gpd3" FT /gene="SPBC354.12" FT /label=gpd3 FT /note="SPBC354.12, len:335" FT /product="glyceraldehyde 3-phosphate dehydrogenase" FT /fasta_file="fasta/c354.tab.seq.02843.out" FT misc_feature 498436..499434 FT /colour=9 FT /note="Pfam match to entry gpdh PF00044, glyceraldehyde 3- FT p hosphate dehydrogenases" FT misc_feature 498877..498900 FT /colour=8 FT /note="PS00071 Glyceraldehyde 3-phosphate dehydrogenase FT act ive site" FT CDS 500946..503147 FT /colour=2 FT /gene="rga6" FT /gene="SPBC354.13" FT /label=rga6 FT /note="SPBC354.13, len:733" FT /product="GTPase activator; RhoGAP domain" FT /fasta_file="fasta/c354.tab.seq.02844.out" FT CDS complement(join(503493..503659,503741..504634, FT 504751..505110,505270..505390,505453..505535, FT 505581..505608)) FT /colour=2 FT /gene="vac8" FT /gene="SPBC354.14c" FT /label=SPBC354.14c FT /note="SPBC354.14c, len:550, SIMILARITY:Saccharomyces FT cerevisiae, VAC8_YEAST, vacuolar protein 8., (578 aa), FT fasta scores: opt: 2087, E():0, (63.7% identity in 510 aa)" FT /product="putative vacuolar protein; beta-catenin family; FT similar to S. cerevisiae VAC8" FT /fasta_file="fasta/c354.tab.seq.02845.out" FT misc_feature complement(503660..503673) FT /colour=6 FT /note="ctaactcattatag, splice branch and acceptor" FT intron complement(503660..503740) FT /note="intron confirmed by EST" FT misc_feature complement(503735..503740) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(504138..504242) FT /note="Match to PF00514 Armadillo_seg, Armadillo/beta- FT catenin-like repeats Score 24.70" FT misc_feature complement(504519..504635) FT /note="Match to PF00514 Armadillo_seg, Armadillo/beta- FT catenin-like repeats Score 35.34" FT misc_feature complement(504635..504650) FT /colour=6 FT /note="ctaactatgatactag, splice branch and acceptor" FT misc_feature complement(504745..504750) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(504758..504850) FT /note="Match to PF00514 Armadillo_seg, Armadillo/beta- FT catenin-like repeats Score 21.66" FT misc_feature complement(504878..505000) FT /note="Match to PF00514 Armadillo_seg, Armadillo/beta- FT catenin-like repeats Score 29.81" FT misc_feature complement(505111..505128) FT /colour=6 FT /note="ctaacacactttttttag, splice branch and acceptor" FT misc_feature complement(505264..505269) FT /colour=6 FT /note="gtaatg, splice donor sequence" FT misc_feature complement(505391..505410) FT /colour=6 FT /note="ctaacgttatcttgttgtag, splice branch and acceptor" FT misc_feature complement(505447..505452) FT /colour=6 FT /note="gttagt, splice donor sequence" FT misc_feature complement(505536..505550) FT /colour=6 FT /note="ttaacaaatacatag, splice branch and acceptor" FT misc_feature complement(505575..505580) FT /colour=6 FT /note="gtatga, splice donor sequence" FT CDS 506242..507480 FT /colour=7 FT /gene="SPBC354.15" FT /label=SPBC354.15 FT /note="SPBC354.15, len:412, SIMILARITY:Aspergillus terreus, FT Q92204, fructosyl amino acid oxidase., (437 aa), fasta FT scores: opt: 657, E():0, (31.3% identity in 402 aa)" FT /product="putative fructosyl amino acid oxidase; no FT apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c354.tab.seq.02846.out" FT misc_feature 507517..508140 FT /note="nominal overlap with cosmid SPBC1706, EM:AL023533 FT S. pombe chromosome 2" FT misc_feature 507517..508140 FT /note="nominal overlap with cosmid SPBC354, EM:AL022071 FT S.pombe chromosome 2" FT CDS 508464..510893 FT /colour=10 FT /gene="SPBC1706.01" FT /label=SPBC1706.01 FT /note="SPBC1706.01, len:808, SIMILARITY:Saccharomyces FT cerevisiae, YAI4_YEAST, hypothetical 78.3 kD protein, (702 FT aa), fasta scores: opt: 288, E():2e-09, (22.4% identity in FT 539 aa)" FT /product="SH3 Src homology domain protein" FT /fasta_file="fasta/c1706.tab.seq.02966.out" FT misc_feature 508824..508994 FT /note="Pfam match to entry SH3 PF00018, Src homology FT domain 3" FT misc_feature complement(511814..512263) FT /colour=3 FT /note="putative RNA by identity to Japanese cDNA FT sequencing project clone" FT misc_feature complement(512349..513771) FT /note="similar at the DNA level to WTF hitchiker element FT region" FT CDS complement(join(512887..512960,513010..513067, FT 513136..513274)) FT /colour=4 FT /gene="wtf5-pseudo" FT /gene="SPBC1706.02c" FT /label=wtf5-pseudo FT /note="SPBC1706.02c, len:70" FT /product="wtf-pseudo" FT /pseudo FT /fasta_file="fasta/c1706.tab.seq.02967.out" FT LTR complement(513523..513875) FT /note="TF1 type" FT misc_feature 514325..516516 FT /note="nominal overlap with cosmid SPBC839, EM:AL096796 S. FT pombe chromosome 2" FT misc_feature 514651..514674 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 514325..516516 FT /note="nominal overlap with cosmid SPBC1706, EM:AL023533 FT S. pombe chromosome 2" FT misc_feature 514651..514674 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 514849..514875 FT /colour=8 FT /note="PS00215 Mitochondrial energy transfer proteins FT signa ture" FT CDS join(517310..518823,518955..519033) FT /colour=10 FT /gene="SPBC839.02" FT /label=SPBC839.02 FT /note="SPBC839.02, len:530aa, last exon may not be real, FT similar eg. to YJL084C, YJI4 _YEAST, P47029, hypothetical FT 117.2 kD protein, (1046aa), fasta scores, opt:434, E():0, FT (28.7% identity in 519 aa overlap)" FT /product="hypothetical protein; possibly fungal specific" FT /fasta_file="fasta/c839.tab.seq.03838.out" FT CDS complement(519127..519882) FT /colour=10 FT /gene="SPBC839.03c" FT /label=SPBC839.03c FT /note="SPBC839.03c, len:251, low SIMILARITY:Homo sapiens, FT Q92564, myeloblast kiaa0276, (309 aa), fasta scores: opt: FT 266, E():1.1e-10, (26.6% identity in 214 aa)" FT /product="hypothetical protein; Pfam-b_8336; similar to S. FT cerevisiae YLR128W possibly involved in cell polarity by FT computational interaction map" FT /fasta_file="fasta/c839.tab.seq.03839.out" FT promoter 520880..520889 FT /colour=4 FT /note="Homol E box" FT promoter 520901..520908 FT /colour=4 FT /note="Homol D box" FT CDS 520980..521741 FT /colour=2 FT /gene="rpl8-3" FT /gene="rpk5-b" FT /gene="SPBC839.04" FT /gene="rpkD4" FT /label=rpl8-3 FT /note="SPBC839.04, len:253aa" FT /product="60S ribosomal protein L8" FT /fasta_file="fasta/c839.tab.seq.03840.out" FT misc_feature 521013..521738 FT /note="Match to PF00181 Ribosomal_L2, Ribosomal proteins FT L2 Score 507.74" FT misc_feature 521565..521600 FT /colour=8 FT /note="PS00467 Ribosomal protein L2 signature" FT tRNA complement(522324..522398) FT /note="tRNA Lys anticodon TTT, Cove score 77.52" FT CDS complement(join(523403..523795,524074..524076)) FT /colour=2 FT /gene="rps17-1" FT /gene="SPBC839.05c" FT /label=rps17-1 FT /note="SPBC839.05c, len:131aa" FT /product="40S ribosomal protein S17" FT /fasta_file="fasta/c839.tab.seq.03841.out" FT misc_feature complement(523445..523795) FT /note="Match to PF00833 Ribosomal_S17e, Ribosomal S17 FT Score 295.54" FT misc_feature complement(523553..523585) FT /colour=8 FT /note="PS00712 Ribosomal protein S17e signature" FT misc_feature complement(523796..523810) FT /colour=6 FT /note="ctaacattcctctag, splice branch and acceptor" FT misc_feature complement(524068..524073) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT promoter complement(524144..524151) FT /colour=4 FT /note="Homol E box" FT promoter complement(524166..524175) FT /colour=4 FT /note="Homol D box" FT CDS 527870..530983 FT /colour=2 FT /gene="cta3" FT /gene="SPBC839.06" FT /label=cta3 FT /note="SPBC839.06, len:1037aa" FT /product="P-type calcium ATPase" FT /fasta_file="fasta/c839.tab.seq.03842.out" FT misc_feature 528134..528562 FT /note="Match to PF00122 E1-E2_ATPase, E1-E2 ATPases Score FT 145.05" FT misc_feature 528695..530317 FT /note="Match to PF00122 E1-E2_ATPase, E1-E2 ATPases Score FT 434.85" FT misc_feature 528971..528991 FT /colour=8 FT /note="PS00154 E1-E2 ATPases phosphorylation site" FT CDS 532369..532785 FT /colour=7 FT /gene="SPBC839.07" FT /label=SPBC839.07 FT /note="SPBC839.07, len:138aa, similarity: eg. to YGR203W, FT YG4E_YEAST, P42937, hypothetical 17.2 kD protein, (148aa), FT fasta scores, opt:75, E():0.00027, (27.2% identity in 151 FT a a overlap), also low similar eg. to S. cerevisiae, FT ACR2_YEA ST, Q06597, arsenical-resistance protein acr2, FT (130aa), fas ta scores, opt:119, E():0.00064, (25.0% FT identity in 132 aa overlap)" FT /product="rhodanase domain protein" FT /fasta_file="fasta/c839.tab.seq.03843.out" FT misc_feature 532402..532749 FT /note="Match to PF00581 Rhodanese, Rhodanese-like domain FT Score 27.26" FT CDS complement(join(533206..535862,536015..536165)) FT /colour=7 FT /gene="SPBC839.08c" FT /label=SPBC839.08c FT /note="SPBC839.08c, len:935aa, similar eg. to YKL165C, YKQ FT 5_YEAST, P36051, hypothetical 105.7 kD protein, (919aa), FT fa sta scores, opt:1807, E():0, (42.0% identity in 932 aa FT over lap)" FT /product="possibly required for FT glycosylphosphatidylinositol (GPI) anchor synthesis" FT /fasta_file="fasta/c839.tab.seq.03844.out" FT misc_feature complement(535863..535881) FT /colour=6 FT /note="ctaaccaatatgcttatag, splice branch and acceptor" FT misc_feature complement(536009..536014) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS complement(join(537378..537667,537762..537837)) FT /colour=7 FT /gene="SPBC839.09c" FT /label=SPBC839.09c FT /note="SPBC839.09c, len:122aa, similar eg. to YBL090W, YBJ FT 0_YEAST, P38175, hypothetical 20.4 kD protein, (177aa), FT fas ta scores, opt:191, E():1e-10, (41.3% identity in 75 FT aa ove rlap)" FT /product="mitochondrial ribosomal protein S21" FT /fasta_file="fasta/c839.tab.seq.03845.out" FT CDS join(538053..538071,538121..539958,540008..540238) FT /colour=10 FT /gene="SPBC839.10" FT /label=SPBC839.10 FT /note="SPBC839.10, len:695aa, similarity: eg. to (at the C FT terminal 1/3) H. sapiens, YS64_HUMAN, P49756, hypothetical FT protein s164 fragment, (273aa), fasta scores, opt:248, E() FT :4.5e-07, (30.1% identity in 166 aa overlap), also similar FT to (in central region) C. elegans Q20042, CEESS78F, FT (1827aa ),opt:113, E():0.00031, (21.8% identity in 545 aa FT overlap)" FT /product="hypothetical protein; with RNA recognition motif FT and PWI domain" FT /fasta_file="fasta/c839.tab.seq.03846.out" FT misc_feature 538072..538077 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 538106..538120 FT /colour=6 FT /note="ctaattttatttag, splice branch and acceptor" FT misc_feature 538522..538713 FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 20.36" FT misc_feature 539959..539964 FT /colour=6 FT /note="gtttgt, splice donor sequence" FT misc_feature 539993..540007 FT /colour=6 FT /note="ctaacacattatag, splice branch and acceptor" FT misc_feature 540017..540232 FT /note="Match to PF01480 PWI, PWI domain Score 124.74" FT CDS complement(540334..541302) FT /colour=2 FT /gene="hut1" FT /gene="SPBC839.11c" FT /label=hut1 FT /note="SPBC839.11c, len:322aa, similar eg. to R. norvegicu FT s, P70639, UGTREL1 (UDP-galactose transporter related FT isozy me 1), (322aa), fasta scores, opt:571, E():0, (36.7% FT identity in 305 aa overlap), also similar eg. to YPL244C, FT Q12520, unknown, (339aa), fasta scores, opt:301, E():0, FT (34.6% identity in 338 aa overlap)" FT /product="protein which maintains optimal environment for FT folding in secretory pathway proteins in the ER; similar FT to mammalian UDP-galactose transporters; similar to S. FT cerevisiae HUT1" FT /fasta_file="fasta/c839.tab.seq.03847.out" FT CDS 542031..542663 FT /colour=2 FT /gene="rpc31" FT /gene="SPBC839.12" FT /label=rpc31 FT /note="SPBC839.12, len:210aa" FT /product="RNA polymerase III subunit; similar to S. FT cerevisiae RPC31" FT /fasta_file="fasta/c839.tab.seq.03848.out" FT CDS complement(join(543099..543651,543698..543738)) FT /colour=2 FT /gene="rpl13a-1" FT /gene="rpl16-1" FT /gene="SPBC839.13c" FT /label=rpl13 FT /note="SPBC839.13c, len:198aa" FT /product="60S ribosomal protein L13/L16" FT /fasta_file="fasta/c839.tab.seq.03849.out" FT misc_feature complement(join(543324..543651,543698..543720)) FT /note="Match to PF00572 Ribosomal_L13, Ribosomal protein FT L13 Score 177.55" FT misc_feature complement(543652..543664) FT /colour=6 FT /note="ctaacatgaatag, splice branch and acceptor" FT intron complement(543652..543697) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(543692..543697) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT promoter complement(543791..543797) FT /colour=4 FT /note="Homol D box" FT promoter complement(543813..543822) FT /colour=4 FT /note="Homol E box" FT CDS complement(join(544125..544800,544856..544896)) FT /colour=10 FT /gene="SPBC839.14c" FT /label=SPBC839.14c FT /note="SPBC839.14c, unknown, len:238aa, similar eg. to YIL FT 064W, YIG4_YEAST, P40516, hypothetical 28.7 kD protein, FT (25 7aa), fasta scores, opt:495, E():1.9e-26, (42.3% FT identity i n 234 aa overlap)" FT /product="putative methyltransferase" FT /fasta_file="fasta/c839.tab.seq.03850.out" FT misc_feature complement(544801..544814) FT /colour=6 FT /note="ctaaaggtttttag, splice branch and acceptor" FT misc_feature complement(544850..544855) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS complement(545805..547187) FT /colour=2 FT /gene="ef1-b" FT /gene="SPBC839.15c" FT /label=ef1 FT /note="SPBC839.15c, len:460aa" FT /product="elongation factor 1 alpha-b" FT /fasta_file="fasta/c839.tab.seq.03851.out" FT misc_feature complement(545943..547175) FT /note="Match to PF00009 GTP_EFTU, Elongation factor Tu FT family Score 542.15" FT misc_feature complement(546513..546536) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature complement(546960..547007) FT /colour=8 FT /note="PS00301 GTP-binding elongation factors signature" FT misc_feature complement(547125..547148) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS join(547729..547763,547814..547958,548237..550870) FT /colour=7 FT /gene="SPBC839.16" FT /label=SPBC839.16 FT /note="SPBC839.16, c-1-tetrahydrofolate synthase, FT len:937aa" FT /product="c-1-tetrahydrofolate synthase" FT /fasta_file="fasta/c839.tab.seq.03852.out" FT misc_feature 547764..547769 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 547798..547813 FT /colour=6 FT /note="ctaacagttgaattag, splice branch and acceptor" FT misc_feature join(547818..547958,548237..548917) FT /note="Match to PF00763 THF_DHG_CYH, Tetrahydrofolate FT dehydrogenase/cyclohydrolase Score 505.58" FT misc_feature 547959..547964 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 548225..548236 FT /colour=6 FT /note="ctaactgtttag, splice branch and acceptor" FT misc_feature 548984..550867 FT /note="Match to PF01268 FTHFS, Formate--tetrahydrofolate FT ligase Score 1307.97" FT misc_feature 549290..549322 FT /colour=8 FT /note="PS00721 Formate--tetrahydrofolate ligase signature FT 1" FT CDS complement(join(551541..551580,551628..551841, FT 551947..551966,552095..552132,552315..552341)) FT /colour=7 FT /gene="SPBC839.17c" FT /label=SPBC839.17c FT /note="SPBC839.17c, len:113aa, similar eg. to YNL135C, FKB FT P_YEAST, P20081, fk506-binding protein fkbp, (114aa), FT fasta scores, opt:543, E():0, (74.3% identity in 101 aa FT overlap)" FT /product="peptidyl-prolyl cis-trans isomerase; fk506- FT binding protein" FT /fasta_file="fasta/c839.tab.seq.03853.out" FT misc_feature complement(551581..551593) FT /colour=6 FT /note="ttaacctatatag, splice branch and acceptor" FT intron complement(551581..551627) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(551622..551627) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(551633..551854) FT /note="Match to PF00254 FKBP, FKBP-type peptidyl-prolyl FT cis-trans isomerases Score 117.67" FT misc_feature complement(551675..551761) FT /colour=8 FT /note="PS00454 FKBP-type peptidyl-prolyl cis-trans FT isomeras e signature 2" FT misc_feature complement(551842..551861) FT /colour=6 FT /note="ataaccgtgggatag, splice branch and acceptor" FT intron complement(551842..551946) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(551941..551946) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(551967..551980) FT /colour=6 FT /note="ctaacaccatttag, splice branch and acceptor" FT intron complement(551967..552094) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(552089..552094) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(552133..552148) FT /colour=6 FT /note="ctaacctttaaaaaag, splice branch and acceptor" FT misc_feature complement(552309..552314) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(553255..554681) FT /note="nominal overlap with cosmid SPBC115, EM:AL022105 S. FT pombe chromosome 2" FT misc_feature 553255..554681 FT /note="nominal overlap with cosmid SPBC839, EM:AL096796 FT S.pombe chromosome 2" FT misc_feature complement(554391..555140) FT /note="Match to PF01408 GFO_IDH_MocA, Oxidoreductase FT family Score 235.12" FT misc_feature complement(556134..556201) FT /note="simnialr to 241 (-1) 15464 15531 MISPCG X54421 S. FT pombe complete mitochondrial genome" FT CDS 557353..558717 FT /colour=7 FT /gene="SPBC115.02c" FT /label=SPBC115.02c FT /note="SPBC115.02c, len:454, SIMILARITY:Haematobia FT irritans, N2B_HAEIR, putative atpase n2b, (464 aa), fasta FT scores: opt: 678, E():0, (33.1% identity in 450 aa)" FT /product="putative atpase" FT /fasta_file="fasta/c115.tab.seq.02848.out" FT misc_feature 557725..557748 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS join(559073..559127,559211..559836) FT /colour=7 FT /gene="SPBC115.01c" FT /label=SPBC115.01c FT /note="SPBC115.01c, len:226, SIMILARITY:Saccharomyces FT cerevisiae, YG2N_YEAST, hypothetical 28.3 kD protein, (256 FT aa), fasta scores: opt: 300, E():6e-13, (32.5% identity in FT 212 aa)" FT /product="putative exosome 3'-5' exoribonuclease complex; FT possibly involved in 3'end processing of multiple small FT RNA species; similar to S. cerevisiae RRP46" FT /fasta_file="fasta/c115.tab.seq.02849.out" FT misc_feature 559128..559133 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 559196..559210 FT /colour=6 FT /note="ctaacatcattgtag, splice branch and acceptor" FT misc_feature 560153..560254 FT /note="nominal overlap with cosmid SPBC947, EM:AL021837 FT S.pombe chromosome 2" FT misc_feature complement(560153..560254) FT /note="nominal overlap with cosmid SPBC115, EM:AL096796 S. FT pombe chromosome 2" FT CDS 561385..563040 FT /colour=7 FT /gene="SPBC947.15c" FT /label=SPBC947.15c FT /note="SPBC947.15c, len:551, FT SIMILARITY:Schizosaccharomyces pombe, O14121, hypothetical FT 61.7 kD protein c3a11.07 in chromosome i., (551 aa), fasta FT scores: opt: 1382, E():0, (42.7% identity in 532 aa)" FT /product="putative mitochondrial NADH dehydrogenase; FT possibly catalyzes cytosolic NADH oxidation; similar to FT S. cerevisiae NDE1" FT /fasta_file="fasta/c947.tab.seq.02731.out" FT CDS join(563990..564178,564246..564368) FT /colour=9 FT /gene="SPBC947.14c" FT /label=SPBC947.14c FT /note="SPBC947.14c, len:103aa" FT /product="very hypothetical protein" FT /fasta_file="fasta/c947.tab.seq.02732.out" FT misc_feature 564179..564184 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 564231..564245 FT /colour=6 FT /note="ttaaccaaattgtag, splice branch and acceptor" FT CDS complement(564919..566277) FT /colour=10 FT /gene="SPBC947.13" FT /label=SPBC947.13 FT /note="SPBC947.13, len:452, SIMILARITY:Saccharomyces FT cerevisiae, Q04418, d9719.30p., (439 aa), fasta scores: FT opt: 425, E():1.2e-17, (27.8% identity in 467 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YDR527W" FT /fasta_file="fasta/c947.tab.seq.02733.out" FT CDS complement(join(567206..567769,567836..568582, FT 568626..568688)) FT /colour=2 FT /gene="kms2" FT /gene="SPBC947.12" FT /label=kms2 FT /note="SPBC947.12, len:457, SIMILARITY:Schizosaccharomyces FT pombe, P87245, kms1, (607 aa), fasta scores: opt: 168, FT E():0.022, (22.8% identity in 473 aa)" FT /product=" predicted coiled-coil; similar to S. pombe kms1 FT a protein required for the formation of meiotic prophase- FT specific nuclear architecture; subcellular localization of FT GFP fusion- Nucleus and cytoplasm" FT /fasta_file="fasta/c947.tab.seq.02734.out" FT misc_feature complement(567770..567785) FT /colour=6 FT /note="ctaatttgtttaatag, splice branch and acceptor" FT misc_feature complement(567830..567835) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(568575..568603) FT /colour=6 FT /note="ctaattttcgacag, splice branch and acceptor" FT misc_feature complement(568620..568625) FT /colour=6 FT /note="gtaatt, splice donor sequence" FT CDS join(569679..571263,571308..572151,572199..572532) FT /colour=7 FT /gene="SPBC947.11c" FT /label=SPBC947.11c FT /note="SPBC947.11c, len:920, SIMILARITY:Saccharomyces FT cerevisiae, Q12050, yor3510c from chromosome xv, (791 aa), FT fasta scores: opt: 334, E():2.8e-13, (24.6% identity in FT 285 aa)" FT /product="similar to S. cerevisiae EFD1 (required for FT stability of direct DNA repeats)" FT /fasta_file="fasta/c947.tab.seq.02735.out" FT misc_feature 570972..570995 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 571264..571269 FT /colour=6 FT /note="gtaggg, splice donor sequence" FT misc_feature 571293..571307 FT /colour=6 FT /note="ctaacataattttag, splice branch and acceptor" FT misc_feature 572152..572157 FT /colour=6 FT /note="gtacgg, splice donor sequence" FT misc_feature 572190..572198 FT /colour=6 FT /note="ttaatttag, splice branch and acceptor" FT CDS complement(join(572790..573062,573131..574888)) FT /colour=10 FT /gene="SPBC947.10" FT /label=SPBC947.10 FT /note="SPBC947.10, len:676, SIMILARITY:Saccharomyces FT cerevisiae, YkD4_YEAST, hypothetical 87.9 kD protein in FT ptm-irx1 intergenic region ., (758 aa), fasta scores: opt: FT 312, E():2.2e-11, (27.7% identity in 495 aa)" FT /product="zinc finger protein; zf-C3HC4 type (RING finger)" FT /fasta_file="fasta/c947.tab.seq.02736.out" FT misc_feature complement(572814..572915) FT /note="Match to PF00097 zf-C3HC4, zinc finger, C3HC4 type FT (RING finger) Score 29.64" FT misc_feature complement(573063..573077) FT /colour=6 FT /note="ctaactcaattttag, splice branch and acceptor" FT misc_feature complement(573125..573130) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature complement(574208..574243) FT /colour=8 FT /note="PS00276 Channel forming colicins signature" FT CDS complement(576022..576807) FT /colour=10 FT /gene="SPBC947.09" FT /label=SPBC947.09 FT /note="SPBC947.09, len:261, SIMILARITY:Schizosaccharomyces FT pombe, YAOD_SCHPO, hypothetical 24.2 kD protein c11d3.13 FT in chromosome i., (222 aa), fasta scores: opt: 617, E():0, FT (50.8% identity in 181 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YPL280W; possibly fungal specific" FT /fasta_file="fasta/c947.tab.seq.02737.out" FT tRNA 578150..578230 FT /note="tRNA Met anticodon CAT, Cove score 46.51" FT CDS 578784..579800 FT /colour=7 FT /gene="SPBC947.08c" FT /label=SPBC947.08c FT /note="SPBC947.08c, len:338, SIMILARITY:Saccharomyces FT cerevisiae, HPC2_YEAST, histone promoter control 2 FT protein., (623 aa), fasta scores: opt: 212, E():0.00054, FT (34.7% identity in 147 aa)" FT /product="putative histone promoter control protein; FT similar to S. cerevisiae HPC2" FT /fasta_file="fasta/c947.tab.seq.02738.out" FT CDS complement(580083..580784) FT /colour=7 FT /gene="SPBC947.07" FT /label=SPBC947.07 FT /note="SPBC947.07, len:233, SIMILARITY:Saccharomyces FT cerevisiae, YKI2_YEAST, hypothetical 50.5 kD protein, (434 FT aa), fasta scores: opt: 381, E():1e-13, (37.6% identity in FT 237 aa)" FT /product="possible involvement in ribosome biosynthesis; FT surf-like; similar to S. cerevisiae YKL082C" FT /fasta_file="fasta/c947.tab.seq.02739.out" FT CDS 582639..584135 FT /colour=7 FT /gene="SPBC947.06c" FT /label=SPBC947.06c FT /note="SPBC947.06c, len:498, FT SIMILARITY:Schizosaccharomyces pombe, CAB42066, membrane FT transporter., (576 aa), fasta scores: opt: 1103, E():0, FT (36.2% identity in 495 aa)" FT /product="MFS multidrug efflux transporter" FT /fasta_file="fasta/c947.tab.seq.02740.out" FT CDS 586824..588518 FT /colour=7 FT /gene="SPBC947.05c" FT /label=SPBC947.05c FT /note="SPBC947.05c, len:564, FT SIMILARITY:Schizosaccharomyces pombe, FRP1_SCHPO, ferric FT reductase transmembrane component., (564 aa), fasta FT scores: opt: 1758, E():0, (46.7% identity in 578 aa)" FT /product="putative ferric reductase transmembrane FT component" FT /fasta_file="fasta/c947.tab.seq.02741.out" FT CDS complement(589439..592360) FT /colour=12 FT /gene="SPBC947.04" FT /label=SPBC947.04 FT /note="SPBC947.04, len:973, SIMILARITY:Schizosaccharomyces FT pombe, CAB38695, hypothetical 129.5 kD protein., (1283 aa), FT fasta scores: opt: 2759, E():0, (53.5% identity in 961 FT aa)" FT /product="hypothetical serine/threonine rich repeat FT protein; similar to S. pombe SPBC1289.15, SPBC21D10.06, FT SPCC188.09C SPAP11E10.02C SPBC21D10.06C SPAC1348.08C FT SPAC977.07C; possibly S. pombe specific; serine/threonine- FT rich low similar to cell surface glycoproteins" FT /fasta_file="fasta/c947.tab.seq.02742.out" FT misc_feature complement(589517..589549) FT /colour=8 FT /note="PS00284 Serpins signature" FT LTR 595980..596333 FT /colour=4 FT /note="tf1 type LTR" FT CDS 596328..596630 FT /colour=9 FT /gene="SPBC947.03c" FT /label=SPBC947.03c FT /note="SPBC947.03c, len:100aa" FT /product="very hypothetical protein" FT /fasta_file="fasta/c947.tab.seq.02743.out" FT misc_feature 596511..596558 FT /colour=8 FT /note="PS00225 Crystallins beta and gamma 'Greek key' FT motif signature" FT CDS complement(597282..599333) FT /colour=2 FT /gene="apl2" FT /gene="SPBC947.02" FT /label=apl2 FT /note="SPBC947.02, len:683, SIMILARITY:Arabidopsis FT thaliana, O81742, beta adaptin - like protein., (719 aa), FT fasta scores: opt: 1894, E():0, (50.1% identity in 585 aa)" FT /product="Beta adaptin; large subunit of clathrin FT associated protein (AP) complex" FT /fasta_file="fasta/c947.tab.seq.02744.out" FT CDS complement(join(600248..600465,600513..600921, FT 600970..602325)) FT /colour=7 FT /gene="SPBC947.01" FT /label=SPBC947.01 FT /note="SPBC947.01, len:660, SIMILARITY:Saccharomyces FT cerevisiae, Q02845, yta6p., (754 aa), fasta scores: opt: FT 1217, E():0, (45.4% identity in 491 aa)" FT /product="putative ATPase involved in microtubule FT disassembly; similar to S. cerevisiae ATP6" FT /fasta_file="fasta/c947.tab.seq.02745.out" FT misc_feature complement(join(600407..600465,600513..600921, FT 600970..601086)) FT /note="Match to PF00004 AAA, ATPases associated with FT various cellular activities (AAA) Score 198.19" FT misc_feature complement(600466..600479) FT /colour=6 FT /note="ctaacgccatctag, splice branch and acceptor" FT misc_feature complement(600507..600512) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(600646..600702) FT /colour=8 FT /note="PS00674 AAA-protein family signature" FT misc_feature complement(600922..600936) FT /colour=6 FT /note="ctaaccttgatttag, splice branch and acceptor" FT misc_feature complement(600964..600969) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature complement(601048..601071) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 602987..603086 FT /note="nominal overlap with PCR product SPBPJ694, FT EM:AL136498 S. pombe chromosome 2" FT misc_feature 602987..603086 FT /note="nominal overlap with cosmid SPBC947, EM:AL021837 S. FT pombe chromosome 2" FT misc_feature join(604016..604086,604165..604852) FT /note="Match to PF00348 polyprenyl_synt, Polyprenyl FT synthetases Score 137.19" FT misc_feature 604817..604822 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT intron 604817..604897 FT /note="intron confirmed by EST" FT misc_feature 604882..604897 FT /colour=6 FT /note="ctaacatataatttag, splice branch and acceptor" FT misc_feature 604986..605083 FT /note="490 (+1) 2000 2097 SPBPJ694 S. pombe chromosome 2" FT CDS 607415..619330 FT /colour=8 FT /gene="SPBPJ4664.02" FT /label=SPBPJ4664.02 FT /product="hypothetical protein; sequence orphan; low FT similar to glycoamylases and other cell surface proteins; FT contains ~250-270 copies of a 13 AA repeat, NSSTPITSSSIL; FT predicted N-terminal signal sequence" FT /fasta_file="fasta/pJ4664.tab.seq.04376.out" FT misc_feature complement(608284..617910) FT /note="spurious ORF on reverse strand of SPBPJ4664.02" FT CDS join(620063..620175,620243..620255) FT /colour=2 FT /gene="mfm3" FT /gene="SPBPJ4664.03" FT /product="M-factor precursor 3; no apparent orthologs" FT /fasta_file="fasta/pJ4664.tab.seq.04377.out" FT misc_feature 620176..620181 FT /note="gtaagt, splice donor sequence" FT /colour=6 FT misc_feature 620228..620242 FT /note="ctaatttcattttag, splice branch and acceptor" FT /colour=6 FT CDS 621589..625212 FT /colour=7 FT /gene="SPBPJ4664.04" FT /label=SPBPJ4664.04 FT /product="putative coatomer alpha subunit" FT /fasta_file="fasta/pJ4664.tab.seq.04378.out" FT misc_feature 621721..621831 FT /note="Match to WD40 Score 34.10" FT misc_feature 621847..621957 FT /note="Match to WD40 Score 25.13" FT misc_feature 621973..622083 FT /note="Match to WD40 Score 38.53" FT misc_feature 622207..622308 FT /note="Match to WD40 Score 28.50" FT misc_feature 622333..622440 FT /note="Match to WD40 Score 37.26" FT CDS 625874..626365 FT /colour=10 FT /gene="SPBPJ4664.05" FT /label=SPBPJ4664.05 FT /product="conserved protein; similar to S. cerevisiae FT YHR140W; predicted transmembrane" FT /fasta_file="fasta/pJ4664.tab.seq.04379.out" FT CDS 627287..631633 FT /colour=2 FT /gene="gpt1" FT /gene="SPBPJ4664.06" FT /label=gpt1 FT /product="UDP-Glc-Glycoprotein Glucosyltransferase; FT induced by stress; non-essential" FT /fasta_file="fasta/pJ4664.tab.seq.04380.out" FT misc_feature 632230..632235 FT /note="gtttgt, splice donor sequence" FT /colour=6 FT misc_feature 632262..632275 FT /note="ttaacgttaaaaag, splice branch and acceptor" FT /colour=6 FT misc_feature 632372..632377 FT /note="gtgagt, splice donor sequence" FT /colour=6 FT misc_feature 632402..632415 FT /note="ctaacaaggatcag, splice branch and acceptor" FT /colour=6 FT misc_feature 632482..632540 FT /note="nominal overlap S.pombe chromosome II cosmid c119." FT misc_feature 633357..633596 FT /note="Match to PF01399 PCI, PCI domain Score 79.08" FT misc_feature join(635029..635151,635231..635308,635680..635913) FT /note="Match to PF00179 UQ_con, Ubiquitin-conjugating FT enzyme Score 257.97" FT CDS join(635032..635151,635231..635308,635680..635925) FT /EC_number="6.3.2.19" FT /colour=2 FT /gene="ubc4" FT /gene="SPBC119.02" FT /label=ubc4 FT /note="SPBC119.02, len:147" FT /product="ubiquitin-conjugating enzyme e2; similar to S. FT cerevisiae UBC4" FT /fasta_file="fasta/c119.tab.seq.02896.out" FT misc_feature 635152..635157 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT intron 635152..635230 FT /colour=2 FT /note="confirmed intron" FT misc_feature 635215..635230 FT /colour=6 FT /note="ctaacatgatatatag, splice branch and acceptor" FT misc_feature 635309..635314 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT intron 635309..635679 FT /colour=2 FT /note="confirmed intron" FT misc_feature 635662..635679 FT /colour=6 FT /note="ctaacagcatattcgtag, splice branch and acceptor" FT misc_feature 635701..635745 FT /colour=8 FT /note="PS00183 Ubiquitin-conjugating enzymes active site" FT tRNA 636775..636847 FT /note="tRNA Trp anticodon CCA, Cove score 65.98" FT CDS 637665..638465 FT /EC_number="2.1.1.6" FT /colour=7 FT /gene="SPBC119.03" FT /label=SPBC119.03 FT /note="SPBC119.03, len:266, SIMILARITY:Mus musculus, FT COMT_MOUSE, catechol o-methyltransferase, membrane-bound FT form, (265 aa), fasta scores: opt: 417, E():2.5e-20, FT (40.0% identity in 200 aa)" FT /product="putative catechol o-methyltransferase; no FT apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c119.tab.seq.02897.out" FT CDS 639505..639951 FT /colour=2 FT /gene="mei3" FT /gene="SPBC119.04" FT /label=mei3 FT /note="SPBC119.04, len:148" FT /product="induces meiosis and sporulation; no apparent FT orthologs" FT /fasta_file="fasta/c119.tab.seq.00040.out" FT CDS complement(641152..642042) FT /colour=7 FT /gene="SPBC119.05c" FT /gene="csh3" FT /label=csh3 FT /note="SPBC119.05c, len:296" FT /product="SH3 Src homology domain protein" FT /fasta_file="fasta/c119.tab.seq.02899.out" FT misc_feature complement(641452..641616) FT /note="Match to PF00018 SH3, Src homology domain 3 Score FT 83.38" FT CDS 643458..644249 FT /colour=7 FT /gene="sco1" FT /gene="SPBC119.06" FT /label=sco1 FT /note="SPBC119.06, len:263, SIMILARITY:Saccharomyces FT cerevisiae, SCO1_YEAST, sco1 protein ., (295 aa), fasta FT scores: opt: 710, E():0, (50.2% identity in 213 aa)" FT /product="putative cytochrome c oxidase assembly protein; FT similar to S. cerevisiae sco1" FT /fasta_file="fasta/c119.tab.seq.02900.out" FT CDS join(645042..645127,645180..645307,645382..645959, FT 646017..650345) FT /colour=7 FT /gene="SPBC119.07" FT /label=SPBC119.07 FT /note="SPBC119.07, len:1706, SIMILARITY:Pichia pastoris, FT CAB59206, vps15 protein., (1340 aa), fasta scores: opt: FT 890, E():0, (34.4% identity in 990 aa)" FT /product="putative serine/threonine protein kinase; EF FT hand; HEAT repeat" FT /fasta_file="fasta/c119.tab.seq.02901.out" FT misc_feature 645128..645133 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 645161..645179 FT /colour=6 FT /note="ctaacgttacgaaatttag, splice branch and acceptor" FT misc_feature 645308..645313 FT /colour=6 FT /note="gtaggt, splice donor sequence" FT misc_feature 645366..645381 FT /colour=6 FT /note="ctaactaaaacaacag, splice branch and acceptor" FT misc_feature 645411..645662 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 36.30" FT misc_feature 645591..645629 FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT misc_feature 645960..645965 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 645999..646016 FT /colour=6 FT /note="ctaacataatacttctag, splice branch and acceptor" FT misc_feature 648477..648500 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 649887..649925 FT /colour=8 FT /note="PS00018 EF-hand calcium-binding domain" FT CDS join(650559..650624,650725..650904,651178..651249, FT 651332..652282) FT /colour=2 FT /gene="spm1" FT /gene="pmk1" FT /gene="SPBC119.08" FT /label=spm1 FT /note="SPBC119.08, len:422" FT /product="serine/threonine protein kinase; MAP kinase; FT involved in cell wall formation" FT /fasta_file="fasta/c119.tab.seq.02902.out" FT misc_feature 650625..650630 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 650711..650724 FT /colour=6 FT /note="ctaacatagtttag, splice branch and acceptor" FT misc_feature 650725..650907 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 35.28" FT misc_feature 650737..650817 FT /colour=8 FT /note="PS00107 protein kinases ATP-binding region FT signature" FT misc_feature 650905..650910 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 651166..651177 FT /colour=6 FT /note="ctaacatggtag, splice branch and acceptor" FT misc_feature 651250..651255 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 651316..651331 FT /colour=6 FT /note="ctaactattataatag, splice branch and acceptor" FT misc_feature 651332..651955 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 193.61" FT misc_feature 651446..651484 FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT CDS complement(653374..653934) FT /colour=10 FT /gene="SPBC119.09c" FT /label=SPBC119.09c FT /note="SPBC119.09c, len:186, SIMILARITY:Saccharomyces FT cerevisiae, ORM1_YEAST, orm1 protein., (222 aa), fasta FT scores: opt: 622, E():0, (52.1% identity in 163 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YGR038W; contains 3 predicted transmembrane helices" FT /fasta_file="fasta/c119.tab.seq.02903.out" FT CDS 655115..656788 FT /EC_number="6.3.5.4" FT /colour=7 FT /gene="SPBC119.10" FT /label=SPBC119.10 FT /note="SPBC119.10, len:557, SIMILARITY:Schizosaccharomyces FT pombe, P78753, fission yeast, (559 aa), fasta scores: opt: FT 2924, E():0, (79.5% identity in 562 aa)" FT /product="asparagine synthetase" FT /fasta_file="fasta/c119.tab.seq.02904.out" FT misc_feature 655118..655561 FT /note="Match to PF00310 GATase_2, Glutamine FT amidotransferases class-II Score 138.25" FT misc_feature 655622..656770 FT /note="Match to PF00733 Asn_synthase, Asparagine synthase FT Score 853.03" FT CDS complement(657403..658494) FT /EC_number="3.1.26.3" FT /colour=2 FT /gene="pac1" FT /gene="hcs" FT /gene="SPBC119.11c" FT /label=pac1 FT /note="SPBC119.11c, len:363" FT /product="double-strand-specific ribonuclease" FT /fasta_file="fasta/c119.tab.seq.02905.out" FT misc_feature complement(657709..657981) FT /note="Match to PF00636 Ribonuclease_3, RNase3 domain. FT Score 159.96" FT misc_feature complement(657955..657981) FT /colour=8 FT /note="PS00517 Ribonuclease III family signature" FT LTR 659437..659795 FT /colour=4 FT /note="TF1 type" FT CDS 659974..661179 FT /colour=7 FT /gene="SPBC119.12" FT /label=SPBC119.12 FT /note="SPBC119.12, len:401, SIMILARITY:Saccharomyces FT cerevisiae, Q12234, chromosome xv reading frame orf FT yor216c., (484 aa), fasta scores: opt: 510, E():8.4e-21, FT (29.1% identity in 399 aa)" FT /product="putative ER to golgi transport protein; similar FT to S. cerevisiae RUD3" FT /fasta_file="fasta/c119.tab.seq.02906.out" FT CDS complement(661662..663218) FT /colour=2 FT /gene="prp31" FT /gene="SPBC119.13c" FT /label=prp31 FT /note="SPBC119.13c, len:518, SIMILARITY:Arabidopsis FT thaliana, O80740, t13d8.6 protein., (511 aa), fasta FT scores: opt: 1134, E():0, (40.2% identity in 475 aa)" FT /product="pre-mRNA splicing factor; general splicing FT factor; required for vegetative and meiotic growth; FT similar to S. cerevisiae PRP31" FT /fasta_file="fasta/c119.tab.seq.02907.out" FT CDS join(663768..663806,663869..664039) FT /colour=10 FT /gene="SPBC119.18" FT /label=SPBC119.18 FT /product="conserved protein; similar to S. cerevisiae FT YKL053C-A" FT /fasta_file="fasta/c119.tab.seq.02908.out" FT tRNA complement(664453..664534) FT /note="tRNA Ser anticodon AGA, Cove score 59.19" FT CDS join(665734..665964,666063..666146,666300..666479, FT 666538..666790,666843..666921,666967..667255) FT /colour=2 FT /gene="rti1" FT /gene="SPBC119.14" FT /label=rti1 FT /note="SPBC119.14, len:371, SIMILARITY:Schizosaccharomyces FT pombe, RA22_SCHPO, DNA repair and recombination protein FT rad22., (469 aa), fasta scores: opt: 746, E():0, (40.5% FT identity in 383 aa)" FT /product="double-strand break repair component; essential; FT required for S phase completion; similar to S. cerevisiae FT RAD52; S. pombe rad22 paralog" FT /fasta_file="fasta/c119.tab.seq.00041.out" FT misc_feature 665965..665970 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 666046..666062 FT /colour=6 FT /note="ctaatcattattaaaag, splice branch and acceptor" FT misc_feature 666147..666152 FT /colour=6 FT /note="gtaaac, splice donor sequence" FT misc_feature 666280..666299 FT /colour=6 FT /note="ctaacaaatggtttttctag, splice branch and acceptor" FT misc_feature 666480..666485 FT /colour=6 FT /note="gtaata, splice donor sequence" FT misc_feature 666517..666537 FT /colour=6 FT /note="ctgacagaaatgcaaaattag, splice branch and acceptor" FT misc_feature 666791..666796 FT /colour=6 FT /note="gtataa, splice donor sequence" FT misc_feature 666825..666842 FT /colour=6 FT /note="ctaaacataaaaatatag, splice branch and acceptor" FT misc_feature 666922..666927 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 666956..666966 FT /colour=6 FT /note="ctaactaatag, splice branch and acceptor" FT CDS join(667551..667608,667683..667836,667893..668784) FT /colour=10 FT /gene="SPBC119.15" FT /label=SPBC119.15 FT /note="SPBC119.15, len:367, SIMILARITY:Saccharomyces FT cerevisiae, YJ42_YEAST, hypothetical 43.2 kD protein, (385 FT aa), fasta scores: opt: 1208, E():0, (51.5% identity in FT 365 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YGR038W" FT /fasta_file="fasta/c119.tab.seq.02910.out" FT misc_feature 667609..667614 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 667662..667682 FT /colour=6 FT /note="ctaatcattttcatgtaatag, splice branch and acceptor" FT misc_feature 667837..667842 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 667880..667892 FT /colour=6 FT /note="ctaattcatttag, splice branch and acceptor" FT CDS complement(668944..670290) FT /colour=10 FT /gene="SPBC119.16c" FT /label=SPBC119.16c FT /note="SPBC119.16c, len:448, SIMILARITY:Saccharomyces FT cerevisiae, YKE7_YEAST, hypothetical 58.9 kD protein, (516 FT aa), fasta scores: opt: 141, E():0.051, (21.3% identity in FT 479 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YKL047W" FT /fasta_file="fasta/c119.tab.seq.02911.out" FT misc_feature 670605..670610 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 670641..670655 FT /colour=6 FT /note="ctaactgtttcctag, splice branch and acceptor" FT misc_feature 671148..671195 FT /colour=8 FT /note="PS00225 Crystallins beta and gamma 'Greek key' FT motif signature" FT misc_feature 671439..673180 FT /note="Overlap with SPBC577 EM:AL110506 S. pombe FT chromosome 2" FT misc_feature 671439..673180 FT /note="nominal overlap with cosmid SPBC119, EM:AL022117 S. FT pombe chromosome 2" FT CDS join(674351..674353,674483..674669,674849..674883) FT /colour=2 FT /gene="rpl38-1" FT /gene="SPBC577.02" FT /label=rpl38-1 FT /note="SPBC577.02, len:74, SIMILARITY:Schizosaccharomyces FT pombe, RL38_SCHPO, 60S ribosomal protein L38., (74 aa), FT fasta scores: opt: 398, E():5.6e-25, (83.8% identity in 74 FT aa)" FT /product="60S ribosomal protein L38" FT /fasta_file="fasta/c577.tab.seq.03997.out" FT misc_feature 674354..674359 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 674467..674482 FT /colour=6 FT /note="ctaatgcatgttttag, splice branch and acceptor" FT misc_feature 674670..674675 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT intron 674670..674848 FT /colour=2 FT /note="confirmed intron" FT misc_feature 674831..674848 FT /colour=6 FT /note="ctaacaagttttctatag, splice branch and acceptor" FT CDS complement(join(675259..675722,675796..675982)) FT /colour=7 FT /gene="SPBC577.03c" FT /label=SPBC577.03c FT /note="SPBC577.03c, len:216, SIMILARITY:Homo sapiens, FT CAB43370, hypothetical 23.3 kD protein., (206 aa), fasta FT scores: opt: 325, E():1.5e-14, (42.7% identity in 213 aa)" FT /product="GCN5-related N-acetyltransferase; contains FT PfamB-PB027336; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c577.tab.seq.00050.out" FT misc_feature complement(675723..675734) FT /colour=6 FT /note="ctaacgatatag, splice branch and acceptor" FT misc_feature complement(675790..675795) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS join(676359..676672,676756..677044) FT /colour=8 FT /gene="SPBC577.04" FT /label=SPBC577.04 FT /note="SPBC577.04, len:200, SIMILARITY: LOW to Homo FT sapiens, Q13769, anonymous., (683 aa), fasta scores: opt: FT 246, E():2.8e-08, (32.1% identity in 196 aa)" FT /product="hypothetical protein; sequence orphan; predicted FT coiled-coil protein" FT /fasta_file="fasta/c577.tab.seq.03999.out" FT misc_feature 676673..676678 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT CDS complement(join(677271..677445,677495..677650, FT 677829..677896)) FT /colour=8 FT /gene="SPBC577.05c" FT /label=SPBC577.05c FT /note="SPBC577.05c, len:134" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c577.tab.seq.04000.out" FT misc_feature complement(677446..677462) FT /colour=6 FT /note="ttaacatcaaattatag, splice branch and acceptor" FT misc_feature complement(677489..677494) FT /colour=6 FT /note="gtacga, splice donor sequence" FT misc_feature complement(677651..677663) FT /colour=6 FT /note="ctaattaaatcag, splice branch and acceptor" FT misc_feature complement(677823..677828) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS complement(join(678107..678120,678174..679194, FT 679234..680039,680081..683865,683921..683928)) FT /colour=7 FT /gene="SPBC577.06c" FT /label=SPBC577.06c FT /note="SPBC577.06c, len:1877, C-term SIMILARITY:Bos taurus, FT O02811, phosphatidylinositol 4-kinase., (2043 aa), fasta FT scores: opt: 1754, E():0, (28.5% identity in 1697 aa)" FT /product="putative phosphatidylinositol 4-kinase; similar FT to S. cerevisiae STT4" FT /fasta_file="fasta/c577.tab.seq.04001.out" FT misc_feature complement(678121..678134) FT /colour=6 FT /note="ctaacttttttaag, splice branch and acceptor" FT misc_feature complement(678168..678173) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature complement(678388..678942) FT /note="Match to PF00454 PI3_PI4_kinase, FT Phosphatidylinositol 3- and 4-kinases Score 312.21" FT misc_feature complement(679195..679207) FT /colour=6 FT /note="ctaacatttgtag, splice branch and acceptor" FT misc_feature complement(679228..679233) FT /colour=6 FT /note="gttagt, splice donor sequence" FT misc_feature complement(680040..680054) FT /colour=6 FT /note="ctaacaatattatag, splice branch and acceptor" FT misc_feature complement(680075..680080) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(683866..683879) FT /colour=6 FT /note="ctaattattattag, splice branch and acceptor" FT misc_feature complement(683915..683920) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS join(684295..684483,684532..684868,684970..685952) FT /colour=7 FT /gene="SPBC577.07" FT /label=SPBC577.07 FT /note="SPBC577.07, len:502, SIMILARITY:Caenorhabditis FT elegans., AAD34652, f09d1.1 protein., (602 aa), fasta FT scores: opt: 843, E():0, (41.1% identity in 501 aa)" FT /product="ubiquitin carboxyl-terminal hydrolase; zinc FT finger protein; zf-UBP type; putative snRNP assembly FT factor; possibly required for pre-mRNA splicing; similar FT to S. cerevisiae SAD1" FT /fasta_file="fasta/c577.tab.seq.04002.out" FT misc_feature 684484..684489 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 684518..684531 FT /colour=6 FT /note="ttaacgctaattag, splice branch and acceptor" FT misc_feature 684869..684874 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 684957..684969 FT /colour=6 FT /note="ctaacacttgtag, splice branch and acceptor" FT CDS complement(join(686253..686901,686954..687177)) FT /colour=7 FT /gene="SPBC577.08c" FT /label=SPBC577.08c FT /note="SPBC577.08c, len:290, SIMILARITY:Homo sapiens, FT O43396, thioredoxin-like protein., (289 aa), fasta scores: FT opt: 513, E():3.1e-26, (38.7% identity in 261 aa)" FT /product="thioredoxin-like protein" FT /fasta_file="fasta/c577.tab.seq.04003.out" FT misc_feature complement(686902..686913) FT /colour=6 FT /note="ctaacattttag, splice branch and acceptor" FT misc_feature complement(686948..686953) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(686953..687144) FT /note="Match to PF00085 thiored, Thioredoxin Score 67.47" FT CDS join(687481..687517,687568..687715,687779..687886, FT 687967..688084,688133..688211,688256..688980) FT /colour=7 FT /gene="SPBC577.09" FT /label=SPBC577.09 FT /note="SPBC577.09, len:404, SIMILARITY:Homo sapiens, FT CSA_HUMAN, cockayne syndrome wd-repeat protein csa., (396 FT aa), fasta scores: opt: 856, E():0, (35.1% identity in 399 FT aa)" FT /product="WD repeat protein; highly similar to human FT cockayne syndrome WD repeat protein; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c577.tab.seq.04004.out" FT misc_feature 687518..687523 FT /colour=6 FT /note="gtaatg, splice donor sequence" FT misc_feature 687555..687567 FT /colour=6 FT /note="ctcacatttgtag, splice branch and acceptor" FT misc_feature 687716..687721 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 687759..687778 FT /colour=6 FT /note="ttaacaatttctattgacag, splice branch and acceptor" FT misc_feature 687887..687892 FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature 687948..687966 FT /colour=6 FT /note="ctaacttgcggtgttttag, splice branch and acceptor" FT misc_feature 687971..688069 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 22.19" FT misc_feature 688085..688090 FT /colour=6 FT /note="gtaata, splice donor sequence" FT misc_feature 688120..688132 FT /colour=6 FT /note="ctaatattggtag, splice branch and acceptor" FT misc_feature 688212..688217 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 688246..688255 FT /colour=6 FT /note="ctaacgatag, splice branch and acceptor" FT misc_feature 688300..688419 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 46.48" FT misc_feature 688492..688587 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 30.24" FT CDS 689381..690169 FT /EC_number="3.4.25.1" FT /colour=7 FT /gene="SPBC577.10" FT /label=SPBC577.10 FT /note="SPBC577.10, len:262, SIMILARITY:Saccharomyces FT cerevisiae, PRCB_YEAST, proteasome component pre4, (266 FT aa), fasta scores: opt: 748, E():0, (46.9% identity in 262 FT aa)" FT /product="20S proteasome component (beta 7 )" FT /fasta_file="fasta/c577.tab.seq.04005.out" FT misc_feature 689513..689947 FT /note="Match to PF00227 proteasome, Proteasome A-type and FT B-type Score 118.55" FT CDS join(691017..691274,691455..691554,691685..692046) FT /colour=8 FT /gene="SPBC577.11" FT /label=SPBC577.11 FT /note="SPBC577.11, len:239" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c577.tab.seq.04006.out" FT misc_feature 691275..691280 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 691440..691454 FT /colour=6 FT /note="ctaacaacagcttag, splice branch and acceptor" FT misc_feature 691658..691663 FT /colour=6 FT /note="gtattt, splice donor sequence" FT CDS join(693179..694184,694280..695094) FT /colour=10 FT /gene="SPBC577.12" FT /label=SPBC577.12 FT /note="SPBC577.12, len:606, SIMILARITY:Saccharomyces FT cerevisiae, Q12429, orf ylr143w., (685 aa), fasta scores: FT opt: 562, E():2.9e-30, (36.9% identity in 594 aa)" FT /product="conserved protein; contains DUF10" FT /fasta_file="fasta/c577.tab.seq.04007.out" FT misc_feature 694040..694381 FT /colour=9 FT /note="Pfam match to entry PF01042 DUF10, Domain of FT unknown function, score 1.10, E-value 0.0002" FT misc_feature 694185..694190 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 694268..694279 FT /colour=6 FT /note="ctaacttcctag, splice branch and acceptor" FT CDS join(695472..697705,697751..697969,698015..698066, FT 698117..698281) FT /colour=7 FT /gene="SPBC577.13" FT /label=SPBC577.13 FT /note="SPBC577.13, len:889, SIMILARITY:Schizosaccharomyces FT pombe, O43001, hypothetical 121.8 kD protein., (1076 aa), FT fasta scores: opt: 1513, E():0, (34.0% identity in 896 aa)" FT /product="putative inositol polyphosphate phosphatase FT family member" FT /fasta_file="fasta/c577.tab.seq.04008.out" FT misc_feature join(697167..697705,697751..697969,698015..698089, FT 698125..698203) FT /note="Match to PF00783 IPPc, Inositol polyphosphate FT phosphatase family, catalytic domain Score 232.47" FT misc_feature 697706..697711 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 697738..697750 FT /colour=6 FT /note="ctgacaaacatag, splice branch and acceptor" FT misc_feature 697970..697975 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 698000..698014 FT /colour=6 FT /note="ttaacatggctatag, splice branch and acceptor" FT misc_feature 698067..698072 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 698101..698116 FT /colour=6 FT /note="ctaaccgaaactttag, splice branch and acceptor" FT CDS complement(join(698887..699366,699368..699568)) FT /blast_file="blast/c577.tab.seq.00001.out" FT /colour=2 FT /gene="spa1" FT /gene="spa" FT /gene="SPBC577.14c" FT /label=spa1 FT /note="SPBC577.14c, len:172" FT /product="ornithine decarboxylase antizyme Spa; antizyme FT with programmed ribosomal frameshift; involved in FT polyamine regulation; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c577.tab.seq.04009.out" FT misc_feature complement(699313..699394) FT /note="putative frameshifting signal- see bioinformatics FT vol 16. no 5 2000 Zhu et al" FT CDS complement(700771..701961) FT /colour=7 FT /gene="SPBC577.15c" FT /label=SPBC577.15c FT /note="SPBC577.15c, len:396, SIMILARITY:Homo sapiens, FT O95138, nuclear autoantigenic sperm protein autosomal FT variant, (310 aa), fasta scores: opt: 283, E():2.8e-09, FT (26.6% identity in 312 aa)" FT /product="histone binding protein; contains NASP domain; FT chromatin architecture; predicted coiled-coil region" FT /fasta_file="fasta/c577.tab.seq.04010.out" FT misc_feature 702952..703120 FT /note="flagged in c530 as rRNA" FT misc_feature 702998..703438 FT /note="nominal overlap with cosmid SPBC530, EM:AL023634 S. FT pombe chromosome 2" FT rRNA 702998..703197 FT /note="5s rRNA gene" FT misc_feature 702998..703438 FT /note="nominal overlap with SPBC577 EM:AL110506 S. pombe FT chromosome 2" FT CDS 704812..706356 FT /colour=7 FT /gene="SPBC530.01" FT /label=SPBC530.01 FT /note="SPBC530.01, len:514, SIMILARITY:Arabidopsis FT thaliana, O49336, t11j7.10 protein., (343 aa), fasta FT scores: opt: 1100, E():0, (46.9% identity in 341 aa)" FT /product="TBC domain protein; putative GTPase activating FT protein of Rab-like GTPase; similar to S. cerevisiae FT YOR070C" FT /fasta_file="fasta/c530.tab.seq.03114.out" FT misc_feature 705454..706209 FT /note="Match to PF00566 TBC, TBC domain Score 42.21" FT CDS 707377..709002 FT /colour=7 FT /gene="SPBC530.02" FT /label=SPBC530.02 FT /note="SPBC530.02, len:541, SIMILARITY:Schizosaccharomyces FT pombe, YAO5_SCHPO, hypothetical 61.1 kD protein c11d3.05 FT in chromosome i., (546 aa), fasta scores: opt: 2464, E():0, FT (65.9% identity in 548 aa)" FT /product="MFS drug efflux transporter of unknown FT specificity" FT /fasta_file="fasta/c530.tab.seq.03115.out" FT misc_feature 708868..708909 FT /colour=8 FT /note="PS00761 Signal peptidases I signature 3" FT CDS complement(710958..711578) FT /colour=2 FT /gene="bag1-b" FT /gene="SPBC530.03c" FT /label=bag1-b FT /note="SPBC530.03c, len:206, FT SIMILARITY:Schizosaccharomyces pombe, O60125, hypothetical FT 22.2 kD protein., (195 aa), fasta scores: opt: 139, FT E():0.044, (23.0% identity in 187 aa)" FT /product="ubiquitin family protein; BAG-family molecular FT chaperone regulator-1B protein; no apparent S. cerevisiae FT ortholog" FT /fasta_file="fasta/c530.tab.seq.03116.out" FT CDS join(712960..713019,713248..714756) FT /colour=8 FT /gene="SPBC530.04" FT /label=SPBC530.04 FT /note="SPBC530.04, len:522aa" FT /product="hypothetical protein; very low similarity FT (conserved putative active site residues) to eukaryotic FT RNA polymerase large subunit C terminal A/beta'/A domain; FT sequence orphan" FT /fasta_file="fasta/c530.tab.seq.03117.out" FT misc_feature 713020..713025 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 713237..713247 FT /colour=6 FT /note="ttaatgattag, splice branch and acceptor" FT CDS 716339..718570 FT /colour=7 FT /gene="SPBC530.05" FT /label=SPBC530.05 FT /note="SPBC530.05, len:743, SIMILARITY:Neurospora crassa., FT AC15_NEUCR, transcriptional activator protein acu-15., FT (865 aa), fasta scores: opt: 445, E():1e-20, (20.8% FT identity in 711 aa)" FT /product="putative transcriptional regulator; zinc finger FT protein; fungal binuclear cluster domain; similar to A FT Nidulans transcriptional activator required for growth on FT acetate" FT /fasta_file="fasta/c530.tab.seq.03118.out" FT misc_feature 716363..716479 FT /note="Match to PF00172 Zn_clus, fungal Zn(2)-Cys(6) FT binuclear cluster domain Score 72.89" FT misc_feature 716366..716452 FT /colour=8 FT /note="PS00463 fungal Zn(2)-Cys(6) binuclear cluster FT domain signature" FT CDS complement(join(718841..720537,720536..722350, FT 722538..722550)) FT /colour=7 FT /gene="SPBC530.06c" FT /label=SPBC530.06c FT /note="SPBC530.06c, len:1173, SIMILARITY:Caenorhabditis FT elegans., IF31_CAEEL, putative eukaryotic translation FT initiation factor 3 alpha subunit(eif-3 alpha)., (1247 aa), FT fasta scores: opt: 1086, E():0, (27.8% identity in 1215 FT aa)" FT /note="putative frameshift but didnt want to flag as FT pseudo" FT /product="putative eukaryotic translation initiation FT factor 3 alpha subunit (eif-3 alpha); similar to S. FT cerevisiae TIF31" FT /fasta_file="fasta/c530.tab.seq.03119.out" FT misc_feature complement(722351..722374) FT /colour=6 FT /note="ctaatacacatgttatatcttcag, splice branch and FT acceptor" FT misc_feature complement(722532..722537) FT /colour=6 FT /note="gtatga, splice donor sequence" FT CDS complement(724064..724792) FT /colour=8 FT /gene="SPBC530.07c" FT /label=SPBC530.07c FT /note="SPBC530.07c, len:242, SIMILARITY: LOW to Pyrococcus FT abyssi., CAB50004, transcriptional regulator., (224 aa), FT fasta scores: opt: 134, E():0.044, (23.7% identity in 219 FT aa)" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c530.tab.seq.03120.out" FT CDS 726533..728980 FT /colour=7 FT /gene="SPBC530.08" FT /label=SPBC530.08 FT /note="SPBC530.08, len:815, SIMILARITY:Schizosaccharomyces FT pombe, O60130, zinc finger protein., (827 aa), fasta FT scores: opt: 714, E():0, (25.6% identity in 843 aa)" FT /product="putative transcriptional regulator; zinc finger FT protein; fungal binuclear cluster domain; may bind Pst1 FT histone deacytylase B by similarity to S. cerevisiae SIN FT complex protein (transcriptional regulator of RNA FT polymerase II); predicted membrane-tethered transcription FT factor (PMID: 11790253); contains bipartite NLS; contains FT 1 predicted transmembrane helix" FT /fasta_file="fasta/c530.tab.seq.03121.out" FT misc_feature 726617..726733 FT /note="Match to PF00172 Zn_clus, fungal Zn(2)-Cys(6) FT binuclear cluster domain Score 63.01" FT misc_feature 726620..726703 FT /colour=8 FT /note="PS00463 fungal Zn(2)-Cys(6) binuclear cluster FT domain signature" FT CDS complement(join(729224..729349,729434..730198)) FT /colour=7 FT /gene="SPBC530.09c" FT /label=SPBC530.09c FT /note="SPBC530.09c, len:296, SIMILARITY:Saccharomyces FT cerevisiae, Q06815, chromosome xvi cosmid 9513., (381 aa), FT fasta scores: opt: 341, E():2.4e-15, (32.9% identity in FT 219 aa)" FT /product="putative cation dependent mannose-6-phosphate FT receptor; involved in gogi-lysosomal transport" FT /fasta_file="fasta/c530.tab.seq.03122.out" FT misc_feature complement(729350..729367) FT /colour=6 FT /note="ctaacagttataatttag, splice branch and acceptor" FT misc_feature complement(729428..729433) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS complement(731112..732080) FT /colour=2 FT /gene="anc1" FT /gene="SPBC530.10c" FT /label=anc1 FT /note="SPBC530.10c, len:322" FT /product="adenine nucleotide carrier; mitochondrial FT carrier (MCF) family" FT /fasta_file="fasta/c530.tab.seq.03123.out" FT misc_feature complement(731130..732005) FT /note="Match to PF00153 mito_carr, Mitochondrial carrier FT proteins Score 439.39" FT misc_feature complement(731913..731942) FT /colour=8 FT /note="PS00215 Mitochondrial energy transfer proteins FT signa ture" FT CDS complement(join(734518..736842,736898..736978, FT 737115..737168)) FT /colour=7 FT /gene="SPBC530.11c" FT /label=SPBC530.11c FT /note="SPBC530.11c, len:819, FT SIMILARITY:Schizosaccharomyces pombe, O94540, putative FT transcriptional regulator, (736 aa), fasta scores: opt: FT 608, E():2.4e-27, (31.2% identity in 554 aa)" FT /product="putative transcriptional regulator" FT /fasta_file="fasta/c530.tab.seq.03124.out" FT misc_feature complement(736843..736855) FT /colour=6 FT /note="ctaattgccatag, splice branch and acceptor" FT misc_feature complement(736892..736897) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(736979..736995) FT /colour=6 FT /note="ctgacctatttggatag, splice branch and acceptor" FT misc_feature complement(737109..737114) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 737168..740983 FT /colour=3 FT /note="low complexity gene-free region containing single FT tRNA" FT tRNA 740190..740261 FT /note="tRNA Glu anticodon CTC, Cove score 59.76" FT misc_feature complement(740980..741891) FT /colour=6 FT /fasta_file="fasta/c530.tab.seq.00063.out" FT CDS complement(740980..742791) FT /colour=7 FT /gene="SPBC530.12c" FT /label=SPBC530.12c FT /note="SPBC530.12c, palmitoyl-protein thioesterase FT precurso r, len:603aa, similar eg. to H. sapiens, FT PPT_HUMAN, P50897, palmitoyl-protein thioesterase , FT (306aa), fasta s cores, opt:502, E():2.5e-24, (31.4% FT identity in 277 aa over lap), also similar eg. to , FT YGR036C, YG1P_YEAST, P53223, re quired for full levels of FT dolichol-linked oligosa ccharides in the FT endoplasmic reticulum, (239aa), fasta scores, opt:375, FT E():4.7e-23, (33.5% identity in 221 aa overlap)" FT /note="SPBC530.12c, len:603, SIMILARITY:Homo sapiens, FT PPT_HUMAN, palmitoyl-protein thioesterase , (306 aa), FT fasta scores: opt: 502, E():2.9e-25, (31.4% identity in FT 277 aa)" FT /product="N-terminal palmitoyl-protein thioesterase FT domain; C-terminal phoshphatidic acid phosphatase domain FT (PAP2); domain combination not observed in other organisms" FT /fasta_file="fasta/c530.tab.seq.03125.out" FT misc_feature complement(741892..742791) FT /colour=6 FT /fasta_file="fasta/c530.tab.seq.00064.out" FT CDS join(744073..744233,744278..744359,744573..744698, FT 744782..744887,744944..745446) FT /colour=7 FT /gene="SPBC530.13" FT /label=SPBC530.13 FT /note="SPBC530.13, len:325, SIMILARITY:Saccharomyces FT cerevisiae, CTK2_YEAST, ctd kinase beta subunit, (323 aa), FT fasta scores: opt: 322, E():2.8e-14, (29.8% identity in FT 299 aa)" FT /product="cyclin homolog" FT /fasta_file="fasta/c530.tab.seq.03126.out" FT misc_feature 744234..744239 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 744263..744277 FT /colour=6 FT /note="ctaacttttttttag, splice branch and acceptor" FT misc_feature 744360..744365 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 744560..744572 FT /colour=6 FT /note="ctaacacatttag, splice branch and acceptor" FT misc_feature 744699..744704 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 744764..744781 FT /colour=6 FT /note="ctaatcgaagagaacaag, splice branch and acceptor" FT misc_feature 744888..744893 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 744929..744943 FT /colour=6 FT /note="ctaatttactttcag, splice branch and acceptor" FT CDS complement(745878..747512) FT /colour=2 FT /gene="dsk1" FT /gene="SPBC530.14c" FT /label=dsk1 FT /note="SPBC530.14c, len:544" FT /product="serine/threonine protein kinase; pre-mRNA FT splicing factor specific kinase" FT /fasta_file="fasta/c530.tab.seq.03127.out" FT misc_feature complement(745965..746450) FT /colour=9 FT /note="Pfam match to entry pkinase PF00069, Eukaryotic FT prot ein kinase domain" FT misc_feature complement(746283..746450) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 40.84" FT misc_feature complement(746847..746885) FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT misc_feature complement(746847..747272) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 112.21" FT misc_feature complement(747183..747254) FT /colour=8 FT /note="PS00107 protein kinases ATP-binding region FT signature" FT misc_feature 748992..749840 FT /note="nominal overlap with cosmid SPBC661, EM:AL031741 S. FT pombe chromosome 2" FT misc_feature 748992..749840 FT /note="nominal overlap with cosmid SPBC530, EM:AL023634 FT S.pombe chromosome 2" FT misc_feature 750765..751491 FT /note="nominal overlap with cosmid SPBC36, EM:AL023589 FT S.pombe chromosome 2" FT misc_feature 750765..751491 FT /note="nominal overlap with cosmid SPBC661, EM:A031741 S. FT pombe chromosome 2" FT CDS complement(752861..754603) FT /colour=7 FT /gene="SPBC36.01c" FT /label=SPBC36.01c FT /note="SPBC36.01c, len:580, SIMILARITY:Schizosaccharomyces FT pombe, Q9Y7S4, membrane transporter., (576 aa), fasta FT scores: opt: 2377, E():0, (61.8% identity in 568 aa)" FT /product="MFS drug efflux transporter of unknown FT specificity" FT /fasta_file="fasta/c36.tab.seq.02470.out" FT misc_feature complement(752864..754186) FT /colour=9 FT /note="Pfam match to entry sugar_tr PF00083, Sugar (and FT oth er) transporters" FT CDS complement(757251..758984) FT /colour=7 FT /gene="SPBC36.02c" FT /label=SPBC36.02c FT /note="SPBC36.02c, len:577, SIMILARITY:Schizosaccharomyces FT pombe, Q9Y7S4, membrane transporter., (576 aa), fasta FT scores: opt: 3245, E():0, (83.7% identity in 576 aa)" FT /product="MFS drug efflux transporter of unknown FT specificity" FT /fasta_file="fasta/c36.tab.seq.02471.out" FT misc_feature complement(757254..758573) FT /colour=9 FT /note="Pfam match to entry sugar_tr PF00083, Sugar (and FT oth er) transporters" FT misc_feature 759004..763225 FT /colour=3 FT /note="low complexity gene-free region" FT CDS complement(763207..764823) FT /colour=7 FT /gene="SPBC36.03c" FT /label=SPBC36.03c FT /note="SPBC36.03c, len:538, SIMILARITY:Schizosaccharomyces FT pombe, Q9Y7S4, membrane transporter., (576 aa), fasta FT scores: opt: 2090, E():0, (58.6% identity in 548 aa)" FT /product="MFS drug efflux transporter of unknown FT specificity" FT /fasta_file="fasta/c36.tab.seq.02472.out" FT LTR complement(766404..766750) FT /colour=4 FT /note="TF2 type lone LTR" FT CDS join(767684..767816,767962..768884) FT /colour=7 FT /gene="SPBC36.04" FT /label=SPBC36.04 FT /note="SPBC36.04, len:351, SIMILARITY:Emericella nidulans, FT CYSK_EMENI, cysteine synthase, (371 aa), fasta scores: FT opt: 1490, E():0, (66.4% identity in 345 aa)" FT /product="cysteine synthase" FT /fasta_file="fasta/c36.tab.seq.02473.out" FT misc_feature join(767738..767816,767962..768776) FT /note="Match to PF00291 S_T_dehydratase, Pyridoxal- FT phosphate dependent enzyme Score 281.70" FT misc_feature 767817..767822 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT intron 767817..767961 FT /colour=2 FT /note="confirmed intron" FT misc_feature 767942..767961 FT /colour=6 FT /note="ctaattgcaaattttttaag, splice branch and acceptor" FT CDS complement(join(769208..769287,769339..769397, FT 769445..769553,769594..769734,769779..769887, FT 769933..770025,770072..770306,770362..770407, FT 770498..770541,770584..770614,770658..770775, FT 770818..770868,770914..770975,771018..771057)) FT /colour=2 FT /gene="clr6" FT /gene="SPBC36.05c" FT /label=clr6 FT /note="SPBC36.05c, len:405" FT /product="histone deacetylase; RPD3-like (class 1); FT localized exclusively on the chromosomes (PMID: 1188460) FT (IDA); similar to S. cerevisiae RPD3" FT /fasta_file="fasta/c36.tab.seq.02474.out" FT misc_feature complement(769288..769309) FT /colour=6 FT /note="ctaacaaatactcttacattag, splice branch and acceptor" FT misc_feature complement(769333..769338) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(769398..769411) FT /colour=6 FT /note="ctgaccaaatttag, splice branch and acceptor" FT misc_feature complement(769439..769444) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature complement(769554..769567) FT /colour=6 FT /note="ttaacccatccaag, splice branch and acceptor" FT misc_feature complement(769588..769593) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(join(769610..769734,769779..769887, FT 769933..770025,770072..770306,770362..770407, FT 770498..770541,770584..770614,770658..770868, FT 770914..770976)) FT /note="Match to PF00850 Hist_deacetyl, Histone deacetylase FT family Score 380.19" FT misc_feature complement(769735..769751) FT /colour=6 FT /note="ctaattcccctcaacag, splice branch and acceptor" FT misc_feature complement(769773..769778) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(769888..769904) FT /colour=6 FT /note="ctaacaatctgaattag, splice branch and acceptor" FT misc_feature complement(769927..769932) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(770026..770037) FT /colour=6 FT /note="ctaatattttag, splice branch and acceptor" FT misc_feature complement(770066..770071) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature complement(770307..770323) FT /colour=6 FT /note="ctaaccacttaattaag, splice branch and acceptor" FT misc_feature complement(770356..770361) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(770408..770422) FT /colour=6 FT /note="ctaacattggtttag, splice branch and acceptor" FT misc_feature complement(770492..770497) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature complement(770542..770556) FT /colour=6 FT /note="ctaacaattgtttag, splice branch and acceptor" FT misc_feature complement(770578..770583) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(770615..770630) FT /colour=6 FT /note="ataaccgtgattttag, splice branch and acceptor - FT devia tion from branch consensus confirmed by homology" FT misc_feature complement(770652..770657) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature complement(770776..770792) FT /colour=6 FT /note="ctaataaagtatacaag, splice branch and acceptor" FT misc_feature complement(770812..770817) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(770869..770881) FT /colour=6 FT /note="ttaacctacttag, splice branch and acceptor" FT misc_feature complement(770908..770913) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(770976..770991) FT /colour=6 FT /note="ctaatttttgaaatag, splice branch and acceptor" FT misc_feature complement(771012..771017) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT CDS complement(join(771724..772305,772346..772546, FT 772615..772752,772802..772936)) FT /colour=7 FT /gene="SPBC36.06c" FT /label=SPBC36.06c FT /note="SPBC36.06c, len:351, SIMILARITY:Schizosaccharomyces FT pombe, FPPS_SCHPO, putative farnesyl pyrophosphate FT synthetase, (347 aa), fasta scores: opt: 965, E():0, FT (45.8% identity in 334 aa)" FT /product="farnesyl pyrophosphate synthetase" FT /fasta_file="fasta/c36.tab.seq.02475.out" FT misc_feature complement(join(771844..772305,772346..772539, FT 772611..772740)) FT /note="Match to PF00348 polyprenyl_synt, Polyprenyl FT synthetases Score 109.25" FT misc_feature complement(772051..772089) FT /colour=8 FT /note="PS00444 Polyprenyl synthetases signature 2" FT misc_feature complement(772306..772325) FT /colour=6 FT /note="ctaaaaagcttactttcaag, splice branch and acceptor" FT intron complement(772306..772345) FT /note="comfirmed by mRNA" FT misc_feature complement(772340..772345) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(772487..772531) FT /colour=8 FT /note="PS00723 Polyprenyl synthetases signature 1" FT misc_feature complement(772523..772780) FT /colour=9 FT /note="Pfam match to entry polyprenyl_synt PF00348, FT Polypre nyl synthetases" FT misc_feature complement(772547..772561) FT /colour=6 FT /note="ctgacggatgttcag, splice branch and acceptor" FT misc_feature complement(772609..772614) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(772753..772767) FT /colour=6 FT /note="ctaaccttcatttag, splice branch and acceptor" FT misc_feature complement(772796..772801) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS 773330..777091 FT /colour=7 FT /gene="SPBC36.07" FT /label=SPBC36.07 FT /note="SPBC36.07, len:1253, SIMILARITY:Homo sapiens, FT O95163, ikappab kinase complex associated protein., (1332 FT aa), fasta scores: opt: 1109, E():0, (28.2% identity in FT 1335 aa)" FT /product="human ikappab kinase complex associated protein FT homolog; similar to S. cerevisiae IKI3" FT /fasta_file="fasta/c36.tab.seq.02476.out" FT CDS complement(join(777230..777409,777461..777541, FT 777604..777918)) FT /colour=8 FT /gene="SPBC36.08c" FT /label=SPBC36.08c FT /note="SPBC36.08c, len:191aa" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c36.tab.seq.02477.out" FT intron complement(777714..777768) FT /colour=7 FT /note="Intron predicted by HMM_intron, Score=7.15" FT CDS join(778187..778386,778439..779583,779639..779772) FT /colour=2 FT /gene="sap61" FT /gene="SPBC36.09" FT /label=sap61 FT /note="SPBC36.09, len:492, SIMILARITY:Caenorhabditis FT elegans., CAA91420, t13h5.4 protein., (500 aa), fasta FT scores: opt: 779, E():0, (34.9% identity in 518 aa)" FT /product="spliceosome associated protein; zinc finger FT protein; zf-C2H2 type; RNA-binding" FT /fasta_file="fasta/c36.tab.seq.02478.out" FT misc_feature 778387..778392 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 778421..778438 FT /colour=6 FT /note="ctaacttgaattcgctag, splice branch and acceptor" FT misc_feature 778971..779039 FT /colour=8 FT /note="PS00028 zinc finger, C2H2 type, domain" FT misc_feature 779584..779589 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 779622..779638 FT /colour=6 FT /note="ctaacgaaaatttttag, splice branch and acceptor" FT CDS 780930..781484 FT /colour=10 FT /gene="SPBC36.10" FT /label=SPBC36.10 FT /note="SPBC36.10, putative intra mitochondrial sorting FT role (by similarity), len:184aa, similar eg. to YLR168C, FT MSF1_Y EAST, P35200, probably involved in FT intramitochondrial prote in sorting, (230aa), fasta scores, FT opt:557, E():0, (50.6% i dentity in 168 aa overlap)" FT /note="SPBC36.10, len:184, SIMILARITY:Saccharomyces FT cerevisiae, MSF1_YEAST, msf1 protein., (230 aa), fasta FT scores: opt: 557, E():1.1e-32, (50.6% identity in 168 aa)" FT /product="conserved protein" FT /fasta_file="fasta/c36.tab.seq.02479.out" FT CDS 782973..784004 FT /colour=8 FT /gene="SPBC36.11" FT /label=SPBC36.11 FT /note="SPBC36.11, len:343" FT /product="hypothetical protein; sequence orphan; predicted FT coiled-coil region" FT /fasta_file="fasta/c36.tab.seq.02480.out" FT misc_feature complement(784944..784956) FT /colour=6 FT /note="ctaaccattttag, splice branch and acceptor" FT misc_feature complement(784981..784986) FT /colour=6 FT /note="gtaagg, splice donor sequence" FT misc_feature complement(785381..785397) FT /colour=6 FT /note="ctgactatgttttacag, splice branch and acceptor" FT misc_feature complement(785431..785436) FT /colour=6 FT /note="gtaaat, splice donor sequence" FT CDS complement(join(786239..789534,789639..789729, FT 789779..789781)) FT /EC_number="3.1.2.15" FT /colour=2 FT /gene="ubpd" FT /gene="SPBC713.02c" FT /label=ubpd FT /note="SPBC713.02c, len:1130" FT /product="ubiquitin carboxyl-terminal hydrolase; similar FT to S. cerevisiae UBP15; similar to S. pombe SPCC188.08c FT paralog" FT /fasta_file="fasta/c713.tab.seq.03235.out" FT misc_feature 784491..786304 FT /note="nominal overlap with SPBC36 S. pombe chromosome 2" FT misc_feature complement(788003..788248) FT /note="Match to PF00443 UCH-2, Ubiquitin carboxyl-terminal FT hydrolase family 2 Score 102.00" FT misc_feature complement(788846..788941) FT /note="Match to PF00442 UCH-1, Ubiquitin carboxyl-terminal FT hydrolases family 2 Score 53.43" FT CDS join(791245..792808,792856..792872) FT /colour=7 FT /gene="SPBC713.03" FT /label=SPBC713.03 FT /note="SPBC713.03, len:527, SIMILARITY:Saccharomyces FT cerevisiae, AIP2_YEAST, actin interacting protein 2.actin FT interacting protein 2., (530 aa), fasta scores: opt: 1906, FT E():0, (55.3% identity in 494 aa)" FT /product="putative D-lactate dehydrogenase (cytochrome); FT mitochondrial matrix; similar to S. cerevisiae DLD2" FT /fasta_file="fasta/c713.tab.seq.03236.out" FT misc_feature 791455..792036 FT /note="Match to PF01565 FAD_binding_4, FAD binding domain FT Score 286.45" FT CDS complement(793057..795621) FT /colour=7 FT /gene="SPBC713.04c" FT /label=SPBC713.04c FT /note="SPBC713.04c, len:855, SIMILARITY:Saccharomyces FT cerevisiae, PWP2_YEAST, periodic tryptophan protein 2., FT (923 aa), fasta scores: opt: 3134, E():0, (52.5% identity FT in 852 aa)" FT /product="WD repeat protein; possibly involved in FT cytokinesis; possibly involved in establishment of cell FT polarity; similar to S. cerevisiae PWP2" FT /fasta_file="fasta/c713.tab.seq.03237.out" FT misc_feature complement(794137..794247) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 43.21" FT misc_feature complement(794395..794505) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 32.73" FT misc_feature complement(794521..794628) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 24.54" FT misc_feature complement(795100..795210) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 20.62" FT CDS join(796049..796394,796440..796476,796520..796677, FT 796718..797070) FT /colour=10 FT /gene="SPBC713.05" FT /label=SPBC713.05 FT /note="SPBC713.05, len:298, SIMILARITY:Arabidopsis FT thaliana, BAB10306, similar to unknown protein., (343 aa), FT fasta scores: opt: 677, E():0, (35.1% identity in 265 aa)" FT /product="WD repeat protein" FT /fasta_file="fasta/c713.tab.seq.03238.out" FT misc_feature 796190..796300 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 26.72" FT misc_feature 796560..796640 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 20.29" FT CDS 797203..799527 FT /colour=7 FT /gene="SPBC713.06" FT /label=SPBC713.06 FT /note="SPBC713.06, len:775, SIMILARITY:Schizosaccharomyces FT pombe, DNLI_SCHPO, DNA ligase, (768 aa), fasta scores: FT opt: 1442, E():0, (33.0% identity in 719 aa)" FT /product="DNA ligase" FT /fasta_file="fasta/c713.tab.seq.03239.out" FT misc_feature 798412..799452 FT /note="Match to PF01068 DNA_ligase, DNA ligase Score FT 391.03" FT CDS complement(799618..801351) FT /colour=7 FT /gene="SPBC713.07c" FT /label=SPBC713.07c FT /note="SPBC713.07c, len:578, SIMILARITY:Saccharomyces FT cerevisiae, Q04119, d9461.37p., (674 aa), fasta scores: FT opt: 858, E():0, (36.0% identity in 586 aa)" FT /product="putative vacuolar polyphosphatase; similar to S. FT cerevisiae PHM5" FT /fasta_file="fasta/c713.tab.seq.03240.out" FT CDS 802159..802374 FT /colour=10 FT /gene="SPBC713.08" FT /label=SPBC713.08 FT /note="SPBC713.08, len:72, SIMILARITY:Saccharomyces FT cerevisiae, Q08176, chromosome xv reading frame orf FT yol026c., (113 aa), fasta scores: opt: 153, E():4.8e-05, FT (40.0% identity in 65 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YOL026C" FT /fasta_file="fasta/c713.tab.seq.03241.out" FT CDS join(804658..804699,804741..805886) FT /colour=8 FT /gene="SPBC713.09" FT /label=SPBC713.09 FT /note="SPBC713.09, len:396" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c713.tab.seq.03242.out" FT CDS join(806315..806363,806429..806766) FT /colour=10 FT /gene="SPBC713.10" FT /label=SPBC713.10 FT /note="SPBC713.10, len:129, SIMILARITY:Saccharomyces FT cerevisiae, YJK4_YEAST, hypothetical 16.2 kDa protein in FT ime2-mef2 intergenic region., (149 aa), fasta scores: opt: FT 294, E():3.2e-12, (45.2% identity in 124 aa)" FT /product="conserved protein; similar to S. cerevisiae FT YJL104W" FT /fasta_file="fasta/c713.tab.seq.03243.out" FT CDS complement(807698..807850) FT /colour=10 FT /gene="SPBC713.11c" FT /label=SPBC713.11c FT /note="SPBC713.11c, len:51, SIMILARITY:Caenorhabditis FT elegans., Q9XUB4, w02a2.5 protein., (551 aa), fasta FT scores: opt: 212, E():4.5e-10, (54.0% identity in 50 aa)" FT /product="UPF0057 family; putative stress response protein" FT /fasta_file="fasta/c713.tab.seq.03244.out" FT misc_feature complement(807707..807841) FT /note="Match to PF01679 UPF0057, Uncharacterized protein FT family UPF0057 Score 102.57" FT misc_feature complement(808884..808985) FT /note="222 (-1) 123015 123116 AL355485 AL355485 Human DNA FT sequence from clone RP11-240M20 on chromosome 13, centre FT of strand switch region" FT CDS 812378..813751 FT /colour=7 FT /gene="SPBC713.12" FT /label=SPBC713.12 FT /note="SPBC713.12, len:458, SIMILARITY:Homo sapiens, FT Q9UNR6, squalene epoxidase, (574 aa), fasta scores: opt: FT 696, E():0, (42.6% identity in 451 aa)" FT /product="squalene epoxidase; ergosterol biosynthesis FT protein" FT /fasta_file="fasta/c713.tab.seq.03245.out" FT misc_feature 815583..815688 FT /note="nominal overlap with SPBC216 S. pombe chromosome 2" FT misc_feature complement(815583..815688) FT /note="nominal overlap with cosmid SPBC713 S. pombe FT chromosome 2" FT misc_feature complement(816063..816076) FT /colour=6 FT /note="ctaatcgctgtcag, splice branch and acceptor" FT misc_feature complement(816115..816120) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS 817774..820680 FT /colour=7 FT /gene="SPBC216.02" FT /label=SPBC216.02 FT /note="SPBC216.02, len:968, SIMILARITY:Saccharomyces FT cerevisiae, Q03767, num1p., (2748 aa), fasta scores: opt: FT 259, E():2.2e-07, (19.8% identity in 945 aa)" FT /product="predicted coiled-coil protein; similar to C-term FT of nuclear migration protein" FT /fasta_file="fasta/c216.tab.seq.03804.out" FT CDS 821641..822384 FT /colour=7 FT /gene="SPBC216.03" FT /label=SPBC216.03 FT /note="SPBC216.03, len:247, SIMILARITY:Bacillus subtilis., FT O07609, hypothetical 22.8 kD protein., (214 aa), fasta FT scores: opt: 234, E():5.1e-09, (31.2% identity in 234 aa)" FT /product=" similar to malate dehydrogenases" FT /fasta_file="fasta/c216.tab.seq.03805.out" FT CDS complement(822855..823271) FT /colour=7 FT /gene="SPBC216.04c" FT /label=SPBC216.04c FT /note="SPBC216.04c, len:138, SIMILARITY:Arabidopsis FT thaliana, G4115934, t4b21.5 protein., (139 aa), fasta FT scores: opt: 552, E():3.2e-31, (56.7% identity in 127 aa)" FT /product="putative transcriptional regulator" FT /fasta_file="fasta/c216.tab.seq.03806.out" FT CDS 824064..831224 FT /colour=2 FT /gene="rad3" FT /gene="SPBC216.05" FT /label=rad3 FT /note="SPBC216.05, len:2386" FT /product="ATR (ATM) checkpoint kinase; similar to S. FT cerevisiae MEC1" FT /fasta_file="fasta/c216.tab.seq.03807.out" FT misc_feature 830610..830960 FT /colour=9 FT /note="Pfam match to entry PF00454 PI3_PI4_kinase, FT Phosphatidylinositol 3- and 4-kinases" FT CDS complement(join(831302..833269,833345..834292)) FT /colour=2 FT /gene="swi1" FT /gene="SPBC216.06c" FT /label=swi1 FT /note="SPBC216.06c, len:971, SIMILARITY:Mus musculus, FT G3818539, timeless protein., (1197 aa), fasta scores: opt: FT 258, E():4.2e-09, (25.0% identity in 545 aa)" FT /product="mating-type switching protein" FT /fasta_file="fasta/c216.tab.seq.03808.out" FT misc_feature complement(833270..833282) FT /colour=6 FT /note="ctaacaatattag, splice branch and acceptor" FT misc_feature complement(833339..833344) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(835354..836007) FT /colour=9 FT /note="Pfam match to entry PF00454 PI3_PI4_kinase, FT Phosphatidylinositol 3- and 4-kinases" FT misc_feature 840789..840893 FT /note="nominal overlap with cosmid SPBC646, EM:AL035216 S. FT pombe chromosome 2" FT misc_feature 840789..840893 FT /note="nominal overlap with cosmid SPBC216, EM:AL049558 S. FT pombe chromosome 2" FT CDS 842424..846278 FT /colour=10 FT /gene="SPBC646.02" FT /label=SPBC646.02 FT /note="SPBC646.02, len:1284, SIMILARITY:Arabidopsis FT thalian a, G3785995, t6a23.3 protein., (1444 aa), fasta FT scores: opt : 606, E():1.2e-31, (24.8% identity in 1357 FT aa)" FT /product="hypothetical protein; aquarius ortholog; FT possibly involved in PTGS; no apparent S. cerevisiae FT ortholog" FT /fasta_file="fasta/c646.tab.seq.03651.out" FT CDS join(846549..846795,846842..847667,847715..848057) FT /colour=7 FT /gene="SPBC646.03" FT /label=SPBC646.03 FT /note="SPBC646.03, len:471, SIMILARITY:Saccharomyces FT cerevisiae, GATH_YEAST, putative glutamyl-tRNA(gln) FT amidotransferase subunit a, mitochondrial, (464 aa), fasta FT scores: opt: 872, E():0, (36.2% identity in 464 aa)" FT /product="putative glutamyl-tRNA amidotransferase subunit" FT /fasta_file="fasta/c646.tab.seq.03652.out" FT misc_feature join(846618..846795,846842..847667,847715..848033) FT /note="Match to PF01425 Amidase, Amidase Score 316.48" FT misc_feature 846796..846801 FT /colour=6 FT /note="gtagac, splice donor sequence" FT misc_feature 846823..846841 FT /colour=6 FT /note="ctaattgcggtttaactag, splice branch and acceptor" FT misc_feature 846892..846915 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A" FT misc_feature 847009..847104 FT /colour=8 FT /note="PS00571 Amidases signature" FT misc_feature 847668..847673 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 847698..847714 FT /colour=6 FT /note="ctaatatttacaaatag, splice branch and acceptor" FT CDS join(848688..850143,850187..850304,850344..850437, FT 850479..850511) FT /colour=2 FT /gene="pla1" FT /gene="SPBC646.04" FT /label=pla1 FT /note="SPBC646.04, len:566" FT /product="poly A polymerase; nucleotidyltransferase; FT polyadenylation factor; similar to S. cerevisiae PAP1" FT /fasta_file="fasta/c646.tab.seq.03653.out" FT misc_feature 848877..849170 FT /colour=9 FT /note="Pfam match to entry PF01909 NTP_transf_2, FT Nucleotidyltransferase domain, score 32.60, E-value 8.9e- FT 06" FT misc_feature 850144..850149 FT /colour=6 FT /note="gcaaga, splice donor sequence" FT misc_feature 850174..850186 FT /colour=6 FT /note="ctaactttattag, splice branch and acceptor" FT misc_feature 850305..850310 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT intron 850305..850343 FT /colour=2 FT /note="confirmed intron" FT misc_feature 850330..850343 FT /colour=6 FT /note="ctcacacattttag, splice branch and acceptor" FT misc_feature 850438..850443 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT intron 850438..850478 FT /colour=2 FT /note="confirmed intron" FT misc_feature 850465..850478 FT /colour=6 FT /note="ctaacgatctttag, splice branch and acceptor" FT CDS complement(850759..852141) FT /EC_number="2.5.1.21" FT /colour=2 FT /gene="erg9" FT /gene="SPBC646.05c" FT /label=erg9 FT /note="SPBC646.05c, len:460" FT /product="farnesyl-diphosphate farnesyltransferase" FT /fasta_file="fasta/c646.tab.seq.03654.out" FT misc_feature complement(851128..852018) FT /note="Match to PF00494 SQS_PSY, Squalene and phytoene FT synthases Score 510.17" FT misc_feature complement(851434..851511) FT /colour=8 FT /note="PS01045 Squalene and phytoene synthases signature 2" FT misc_feature complement(851572..851619) FT /colour=8 FT /note="PS01044 Squalene and phytoene synthases signature 1" FT CDS complement(852558..853781) FT /colour=7 FT /gene="SPBC646.06c" FT /label=SPBC646.06c FT /note="SPBC646.06c, len:407, FT SIMILARITY:Schizosaccharomyces pombe, YDZ9_SCHPO, FT hypothetical 44.5 kD protein c14c4.09 in chromosome i., FT (402 aa), fasta scores: opt: 735, E():0, (36.9% identity FT in 396 aa)" FT /product="putative glucanase; by similar to Penicillium FT purpurogenum mutanase; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c646.tab.seq.03655.out" FT CDS complement(854415..855302) FT /colour=7 FT /gene="SPBC646.07c" FT /label=SPBC646.07c FT /note="SPBC646.07c, len:295, SIMILARITY:Rattus norvegicus, FT Q64232, sc2=synaptic glycoprotein., (308 aa), fasta FT scores: opt: 476, E():1.4e-24, (41.7% identity in 254 aa)" FT /product="3-oxo-5-alpha-steroid 4-dehydrogenase similar to FT rat synaptic glycoprotein sc2" FT /fasta_file="fasta/c646.tab.seq.03656.out" FT CDS complement(856240..857790) FT /colour=7 FT /gene="SPBC646.08c" FT /label=SPBC646.08c FT /note="SPBC646.08c, len:516, SIMILARITY:Saccharomyces FT cerevisiae, KES1_YEAST, kes1 protein., (434 aa), fasta FT scores: opt: 228, E():8.3e-07, (28.4% identity in 264 aa)" FT /product="possibly involved in ergosterol biosynthesis" FT /fasta_file="fasta/c646.tab.seq.03657.out" FT misc_feature complement(856252..857379) FT /colour=9 FT /note="Pfam match to entry PF01237 Oxysterol_BP, Oxysterol- FT binding protein, score -47.80, E-value 7.4e-07" FT CDS complement(join(858399..859870,859927..859960)) FT /colour=2 FT /gene="int6" FT /gene="yin6" FT /gene="SPBC646.09c" FT /label=int6 FT /note="SPBC646.09c, len:501" FT /product="eIF3 p48 subunit eIF3/signalosome component; FT potential regulator for microtubule function and FT chromosome segregation; complexes with moe1; no apparent FT S. cerevisiae ortholog" FT /fasta_file="fasta/c646.tab.seq.03658.out" FT misc_feature complement(859020..859061) FT /colour=8 FT /note="PS00036 bZIP transcription factors basic domain FT sign ature" FT misc_feature complement(859871..859883) FT /colour=6 FT /note="ctaacctttatag, splice branch and acceptor" FT intron complement(859871..859926) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(859921..859926) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT CDS complement(860524..862017) FT /colour=7 FT /gene="SPBC646.10c" FT /label=SPBC646.10c FT /note="SPBC646.10c, len:497, SIMILARITY:Saccharomyces FT cerevisiae, SIK1_YEAST, sik1 protein., (504 aa), fasta FT scores: opt: 1939, E():0, (59.5% identity in 499 aa)" FT /product="putative U3 snoRNP component; putative component FT of box C/D snoRNPs; involved in 2'-O-methylation of FT ribosomal RNAs; similar to S. cerevisiae SIK1" FT /fasta_file="fasta/c646.tab.seq.03659.out" FT misc_feature complement(860776..861222) FT /note="Match to PF01798 Nop, putative snoRNA-binding FT domain Score 306.92" FT LTR 862175..862519 FT /colour=4 FT /note="Tf2-type LTR" FT CDS join(862641..862697,862743..862816,862855..862918, FT 863060..864472) FT /colour=2 FT /gene="cct6" FT /gene="SPBC646.11" FT /label=cct6 FT /note="SPBC646.11, len:535, SIMILARITY:Mus musculus, FT BAA81877, chaperonin containing tcp-1 zeta-1 subunit., FT (531 aa), fasta scores: opt: 2162, E():0, (64.4% identity FT in 528 aa)" FT /product="t-complex protein 1, zeta subunit" FT /fasta_file="fasta/c646.tab.seq.03660.out" FT misc_feature 862698..862703 FT /colour=6 FT /note="gttggt, splice donor sequence" FT misc_feature 862730..862742 FT /colour=6 FT /note="ctaacgttggcag, splice branch and acceptor" FT misc_feature join(862767..862816,862855..862918) FT /note="Match to PF00118 cpn60_TCP1, TCP-1/cpn60 chaperonin FT family Score 36.01" FT misc_feature join(862767..862816,862855..862918,863060..864442) FT /note="Pfam match to entry PF00118 cpn60_TCP1, TCP-1/cpn60 FT chaperonin family" FT misc_feature 862817..862822 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 862842..862854 FT /colour=6 FT /note="ctcataattttag, splice branch and acceptor" FT misc_feature 862919..862924 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 863044..863059 FT /colour=6 FT /note="ctaactttattggtag, splice branch and acceptor" FT misc_feature 863060..864442 FT /note="Match to PF00118 cpn60_TCP1, TCP-1/cpn60 chaperonin FT family Score 535.19" FT CDS complement(864801..867101) FT /colour=2 FT /gene="gap1" FT /gene="src1" FT /gene="sar1" FT /gene="SPBC646.12c" FT /label=gap1 FT /note="SPBC646.12c, len:766" FT /product="GTPase-activating protein; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c646.tab.seq.03661.out" FT misc_feature complement(865962..866579) FT /note="Match to PF00616 RasGAP, GTPase-activator protein FT for Ras-like GTPase Score 408.99" FT misc_feature complement(868344..879292) FT /note="nominal overlap with cosmid SP23729, EM:U23729 S. FT pombe chromosome 2" FT CDS 870580..871806 FT /colour=2 FT /gene="sds23" FT /gene="psp1" FT /gene="moc1" FT /gene="SPBC646.13" FT /label=sds23 FT /note="SPBC646.13, len:408" FT /product="CBS-domain protein; possibly involved in FT destruction box mediated ubiquitinylation" FT /fasta_file="fasta/c646.tab.seq.03662.out" FT misc_feature 870994..871152 FT /note="Pfam match to entry PF00571 CBS, CBS domain" FT misc_feature 871003..871152 FT /note="Match to PF00571 CBS, CBS domain Score 23.92" FT misc_feature 871213..871368 FT /note="Match to PF00571 CBS, CBS domain Score 32.66" FT misc_feature 871213..871374 FT /note="Pfam match to entry PF00571 CBS, CBS domain" FT CDS complement(join(872515..873450,873491..873565, FT 873619..873975)) FT /colour=2 FT /gene="orc5" FT /gene="SPBC646.14c" FT /label=orc5 FT /note="SPBC646.14c, len:455" FT /product="origin recognition complex subunit 5" FT /fasta_file="fasta/c646.tab.seq.03663.out" FT misc_feature complement(873451..873463) FT /colour=6 FT /note="ttaactattttag, splice branch and acceptor" FT misc_feature complement(873485..873490) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(873566..873581) FT /colour=6 FT /note="ctaatatgagttatag, splice branch and acceptor" FT misc_feature complement(873613..873618) FT /colour=6 FT /note="gtactt, splice donor sequence" FT CDS complement(join(874827..874909,874956..875068, FT 875134..875691,875769..876000,876043..876187)) FT /colour=8 FT /gene="SPBC646.15c" FT /label=SPBC646.15c FT /note="SPBC646.15c, len:376" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c646.tab.seq.03664.out" FT misc_feature complement(874910..874929) FT /colour=6 FT /note="ctaacctttcattcagttag, splice branch and acceptor" FT misc_feature complement(874950..874955) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(875069..875081) FT /colour=6 FT /note="ctaactaatttag, splice branch and acceptor" FT misc_feature complement(875128..875133) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(875692..875705) FT /colour=6 FT /note="ttaacaaatattag, splice branch and acceptor" FT misc_feature complement(875763..875768) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(876001..876016) FT /colour=6 FT /note="ctaaccttttgtttag, splice branch and acceptor" FT misc_feature complement(876037..876042) FT /colour=6 FT /note="gtatgg, splice donor sequence" FT misc_feature 877462..877902 FT /note="Match to PF00227 proteasome, Proteasome A-type and FT B-type Score 140.28" FT misc_feature 877462..877932 FT /note="Pfam match to PF00227 Proteasome A-type and B-type" FT misc_feature complement(879274..879286) FT /colour=6 FT /note="ctaaccattaaag, splice branch and acceptor" FT CDS 877357..878091 FT /EC_number="3.4.25.1" FT /colour=7 FT /gene="SPBC646.16" FT /note="SPBC646.16, len:244, SIMILARITY:Mus musculus, FT AAF21459, proteasome subunit iota., (246 aa), fasta FT scores: opt: 934, E():0, (58.8% identity in 240 aa)" FT /product="20S proteasome component (alpha 1)" FT /fasta_file="fasta/c646.tab.seq.03665.out" FT misc_feature 877970..879292 FT /note="nominal overlap with cosmid SPBC646 S. pombe FT chromosome 2" FT misc_feature 879603..880690 FT /note="nominal overlap with cosmid p35G2 S. pombe FT chromosome 2" FT tRNA 880428..880499 FT /note="tRNA His anticodon GTG, Cove score 69.87" FT misc_feature complement(879603..913255) FT /note="nominal overlap with cosmid SP23729 S. pombe FT chromosome 2" FT misc_feature complement(879916..879929) FT /colour=6 FT /note="ctaacctaaaatag, splice branch and acceptor" FT misc_feature complement(879957..879962) FT /colour=6 FT /note="gttatt, splice donor sequence" FT misc_feature 880500..886409 FT /note="low complexity gene free region" FT CDS 886410..887033 FT /colour=7 FT /gene="SPBP35G2.02" FT /label=SPBP35G2.02 FT /note="SPBP35G2.02, len:208, SIMILARITY:Drosophila FT melanogaster, AAF53211, cg6153 protein., (211 aa), fasta FT scores: opt: 372, E():3.6e-19, (35.2% identity in 193 aa)" FT /product="thioredoxin-like protein; Pfam-B_11753; no FT apparent S. cerevisiae ortholog" FT /fasta_file="fasta/p35G2.tab.seq.04160.out" FT CDS complement(join(887445..888303,888366..888466)) FT /colour=8 FT /gene="SPBP35G2.03c" FT /label=SPBP35G2.03c FT /note="SPBP35G2.03c, len:319" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/p35G2.tab.seq.04161.out" FT misc_feature complement(888304..888314) FT /colour=6 FT /note="ctaactttcag, splice branch and acceptor" FT misc_feature complement(888360..888365) FT /colour=6 FT /note="gtaagg, splice donor sequence" FT CDS complement(join(888707..888964,889150..889570, FT 889663..889733)) FT /colour=8 FT /gene="SPBP35G2.04c" FT /label=SPBP35G2.04c FT /note="SPBP35G2.04c, len:249, SIMILARITY:Chlamydia FT pneumoniae., Q9Z8J1, hypothetical 47.8 kD protein., (419 FT aa), fasta scores: opt: 110, E():1.8, (30.4% identity in FT 138 aa)" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/p35G2.tab.seq.04162.out" FT misc_feature complement(888965..888984) FT /colour=6 FT /note="ctaaccgactacttacttag, splice branch and acceptor" FT misc_feature complement(889144..889149) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(889571..889583) FT /colour=6 FT /note="ctaactttattag, splice branch and acceptor" FT misc_feature complement(889655..889660) FT /colour=6 FT /note="gtgtgt, splice donor sequence" FT intron complement(889803..889926) FT /colour=7 FT /note="Intron predicted by HMM_intron, Score=20.04" FT CDS complement(join(890656..891618,891684..891832, FT 891900..891969,892022..892147)) FT /colour=2 FT /gene="cki2" FT /gene="SPBP35G2.05c" FT /label=cki2 FT /note="SPBP35G2.05c, len:435" FT /product="serine/threonine protein kinase; casein kinase I FT homolog" FT /fasta_file="fasta/p35G2.tab.seq.04163.out" FT misc_feature complement(891193..891618) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 60.16" FT misc_feature complement(891619..891632) FT /colour=6 FT /note="ctgacatttcaaag, splice branch and acceptor" FT misc_feature complement(891678..891683) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(891833..891852) FT /colour=6 FT /note="ctaaccgtatttgcaaatag, splice branch and acceptor" FT intron complement(891833..891899) FT /note="confirmed by EST" FT misc_feature complement(891894..891899) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(891970..891986) FT /colour=6 FT /note="ctaacaatggacgttag, splice branch and acceptor" FT intron complement(891970..892021) FT /note="confirmed by mRNA" FT misc_feature complement(892016..892021) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(892019..892114) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 31.20" FT CDS complement(join(892748..893880,893922..894276, FT 894316..894701,894743..894836,894871..896331)) FT /colour=7 FT /gene="SPBP35G2.06c" FT /label=SPBP35G2.06c FT /note="SPBP35G2.06c, len:1142, SIMILARITY:Saccharomyces FT cerevisiae, N133_YEAST, nucleoporin nup133, (1157 aa), FT fasta scores: opt: 444, E():1e-20, (21.7% identity in 1057 FT aa)" FT /product="putative nucleoporin" FT /fasta_file="fasta/p35G2.tab.seq.04164.out" FT misc_feature complement(893881..893892) FT /colour=6 FT /note="ctaacaaagaag, splice branch and acceptor" FT misc_feature complement(893916..893921) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature complement(894277..894286) FT /colour=6 FT /note="ctaatattag, splice branch and acceptor" FT misc_feature complement(894310..894315) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(894702..894715) FT /colour=6 FT /note="ctaattgcaatcag, splice branch and acceptor" FT misc_feature complement(894737..894742) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature complement(894837..894847) FT /colour=6 FT /note="ctaacatatag, splice branch and acceptor" FT misc_feature complement(894865..894870) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS 896808..898817 FT /EC_number="4.1.3.18" FT /colour=2 FT /gene="ilv1" FT /gene="SPBP35G2.07" FT /label=ilv1 FT /note="SPBP35G2.07, len:669" FT /product="acetolactate synthase (acetohydroxyacid FT synthase); first step in valine and isoleucine FT biosynthesis pathway; similar to S. cerevisiae ILV2" FT /fasta_file="fasta/p35G2.tab.seq.04165.out" FT misc_feature 897096..898730 FT /note="Match to PF00205 TPP_enzymes, Thiamine FT pyrophosphate enzymes Score 967.41" FT CDS complement(join(899228..899851,899907..900008, FT 900058..900273)) FT /colour=7 FT /gene="SPBP35G2.08c" FT /label=SPBP35G2.08c FT /note="SPBP35G2.08c, len:313, SIMILARITY:Saccharomyces FT cerevisiae, YIH9_YEAST, hypothetical 41.6 kD protein in FT sds3-ths1 intergenic region., (360 aa), fasta scores: opt: FT 453, E():4.1e-20, (32.4% identity in 284 aa)" FT /product="zinc finger protein; zf-CCHC type (zinc knuckle)" FT /fasta_file="fasta/p35G2.tab.seq.04166.out" FT misc_feature complement(899852..899866) FT /colour=6 FT /note="ctaactgtattacag, splice branch and acceptor" FT misc_feature complement(899901..899906) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature complement(900009..900022) FT /colour=6 FT /note="ctaataaaatttag, splice branch and acceptor" FT misc_feature complement(900052..900057) FT /colour=6 FT /note="gtatgg, splice donor sequence" FT CDS join(900939..900948,900995..901210,901270..901592) FT /colour=7 FT /gene="SPBP35G2.09" FT /label=SPBP35G2.09 FT /note="SPBP35G2.09, len:182, SIMILARITY:Xenopus laevis, FT RU1C_XENLA, u1 small nuclear ribonucleoprotein c, (159 aa), FT fasta scores: opt: 271, E():5.6e-10, (39.3% identity in FT 122 aa)" FT /product="putative u1 snRNP-specific C protein; U1 snRNP FT component; possibly required for spliceosome assembly" FT /fasta_file="fasta/p35G2.tab.seq.04167.out" FT misc_feature 900949..900954 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 900984..900994 FT /colour=6 FT /note="ttaatgcttag, splice branch and acceptor" FT misc_feature 901211..901216 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 901251..901269 FT /colour=6 FT /note="ctaatattccgaattttag, splice branch and acceptor" FT CDS 901767..906023 FT /colour=7 FT /gene="SPBP35G2.10" FT /label=SPBP35G2.10 FT /note="SPBP35G2.10, len:1418, SIMILARITY:Drosophila FT melanogaster, O16102, chd3, (1518 aa), fasta scores: opt: FT 1418, E():0, (33.8% identity in 945 aa)" FT /product="zinc finger protein; zf-PHD finger; helicase C FT SNF2 domain" FT /fasta_file="fasta/p35G2.tab.seq.04168.out" FT misc_feature 903441..904310 FT /note="Match to PF00176 SNF2_N, SNF2 and others N-terminal FT domain Score 287.78" FT misc_feature 904467..904721 FT /note="Match to PF00271 helicase_C, Helicases conserved C- FT terminal domain Score 97.68" FT CDS complement(906343..907536) FT /colour=10 FT /gene="SPBP35G2.11c" FT /label=SPBP35G2.11c FT /note="SPBP35G2.11c, len:398, SIMILARITY:Caenorhabditis FT elegans., Q9XXG8, y32b12a.1 protein., (177 aa), fasta FT scores: opt: 191, E():3.6e-05, (35.7% identity in 98 aa)" FT /product="protein containing 3 ZZ domain zinc finger FT domains" FT /fasta_file="fasta/p35G2.tab.seq.04169.out" FT misc_feature complement(906790..906918) FT /note="Match to PF00569 ZZ, zinc finger present in FT dystrophin, CBP/p300 Score 64.17" FT misc_feature complement(907033..907143) FT /note="Match to PF00569 ZZ, zinc finger present in FT dystrophin, CBP/p300 Score 49.93" FT misc_feature complement(907270..907359) FT /note="Match to PF00569 ZZ, zinc finger present in FT dystrophin, CBP/p300 Score 31.49" FT conflict complement(908260..908262) FT /citation=[2] FT /note="conflict with cosmid SP23729. p23G2 sequence FT correct" FT CDS 909257..909874 FT /colour=7 FT /gene="SPBP35G2.12" FT /label=SPBP35G2.12 FT /note="SPBP35G2.12, len:206, SIMILARITY:Saccharomyces FT cerevisiae, YSA1_YEAST, ysa1 protein., (231 aa), fasta FT scores: opt: 612, E():0, (43.3% identity in 203 aa)" FT /product="nucleoside diphosphate-sugar hydrolase of the FT MutT (nudix) family" FT /fasta_file="fasta/p35G2.tab.seq.04170.out" FT misc_feature 909464..909589 FT /note="Match to PF00293 mutT, Bacterial mutT protein FT Score 43.36" FT CDS complement(910116..911066) FT /colour=10 FT /gene="SPBP35G2.13c" FT /label=SPBP35G2.13c FT /note="SPBP35G2.13c, len:317, predicted to contain coiled- FT coil region, LOW SIMILARITY:Drosophila melanogaster, FT AAF51469, cg2839 protein, (554 aa), fasta scores: opt: 187, FT E():0.0061, (26.1% identity in 203 aa)" FT /product="hypothetical protein; similar to A. thaliana FT F13K3.14, and Drosophila CG4621; glutamate-rich; predicted FT coiled-coil region; conserved FT C{VP}IT{GR}{LK}PA.Y.DP.T..P.....AF...RE" FT /fasta_file="fasta/p35G2.tab.seq.04171.out" FT CDS 912586..915768 FT /colour=10 FT /gene="SPBP35G2.14" FT /label=SPBP35G2.14 FT /note="SPBP35G2.14, len:1060, FT SIMILARITY:Schizosaccharomyces pombe, O60059, RNA binding FT protein., (661 aa), fasta scores: opt: 1000, E():0, (41.7% FT identity in 480 aa)" FT /product="RNA binding Puf domains" FT /fasta_file="fasta/p35G2.tab.seq.04172.out" FT misc_feature 914350..914535 FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 53.45" FT misc_feature 914893..914991 FT /note="Match to PF00806 PUF, Pumilio-family RNA-binding FT domains (aka PUM-HD, Pumilio homology domain) Score 25.62" FT misc_feature 914998..915099 FT /note="Match to PF00806 PUF, Pumilio-family RNA-binding FT domains (aka PUM-HD, Pumilio homology domain) Score 21.75" FT misc_feature 915109..915207 FT /note="Match to PF00806 PUF, Pumilio-family RNA-binding FT domains (aka PUM-HD, Pumilio homology domain) Score 27.22" FT misc_feature 915214..915315 FT /note="Match to PF00806 PUF, Pumilio-family RNA-binding FT domains (aka PUM-HD, Pumilio homology domain) Score 24.11" FT misc_feature 916719..916724 FT /colour=6 FT /note="gtattg, splice donor sequence" FT misc_feature 916751..916764 FT /colour=6 FT /note="cttaccagtaatag, splice branch and acceptor" FT misc_feature 918442..918546 FT /note="nominal overlap with cosmid SPBC146 S. pombe FT chromosome 2" FT CDS 920710..921501 FT /colour=8 FT /gene="SPBC146.02" FT /label=SPBC146.02 FT /note="SPBC146.02, len:263," FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c146.tab.seq.03856.out" FT CDS complement(922188..926162) FT /colour=2 FT /gene="cut3" FT /gene="SPBC146.03c" FT /label=cut3 FT /note="SPBC146.03c, len:1324, identical to FT Schizosaccharomyces pombe, CUT3_SCHPO, chromosome FT segregation protein CUT3, except for a single amino acid FT discrepency at position 393 (C-F)" FT /product="condensin; SMC4 subunit; chromosome segregation FT protein; similar to S. cerevisiae SMC4" FT /fasta_file="fasta/c146.tab.seq.03857.out" FT CDS 927717..928295 FT /colour=7 FT /gene="SPBC146.04" FT /label=SPBC146.04 FT /note="SPBC146.04, len:192, SIMILARITY:Saccharomyces FT cerevisiae, ERV2_YEAST, erv2 protein ., (196 aa), fasta FT scores: opt: 263, E():2.6e-11, (32.3% identity in 133 aa)" FT /product="putative mitochondrial protein; similar to S. FT cerevisiae ERV2; contains 1 predicted transmembrane helix" FT /fasta_file="fasta/c146.tab.seq.03858.out" FT CDS complement(join(928498..929593,929656..929690)) FT /colour=10 FT /gene="SPBC146.05c" FT /label=SPBC146.05c FT /note="SPBC146.05c, len:376, SIMILARITY:Arabidopsis FT thaliana, O64855, f4i1.1 protein., (493 aa), fasta scores: FT opt: 376, E():1.4e-13, (28.6% identity in 402 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YNL245C null lethal; predicted coiled-coil" FT /fasta_file="fasta/c146.tab.seq.03859.out" FT misc_feature complement(929594..929609) FT /colour=6 FT /note="ctaatattatgattag, splice branch and acceptor" FT misc_feature complement(929650..929655) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS complement(930300..932411) FT /colour=10 FT /gene="SPBC146.06c" FT /label=SPBC146.06c FT /note="SPBC146.06c, len:703, SIMILARITY:Homo sapiens, FT BAA76862, kiaa1018 protein., (1017 aa), fasta scores: opt: FT 560, E():8.4e-31, (27.7% identity in 676 aa)" FT /product="conserved protein; similar to O sativa Q9LWI8; FT Arabidopsis thaliana F11A17.9; human KIAA1018 and C FT elegans C01G5.8; has conserved motifs at C terminal one- FT DY{K/R}{S/G}.PDL..W{.*}EVK...D{R/Q}LS{EHT}.Q..W{I?L}..{L/ FT F}.VE{I/V}C{K/HV; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c146.tab.seq.03860.out" FT CDS 933254..934807 FT /colour=2 FT /gene="prp2" FT /gene="mis11" FT /gene="SPBC146.07" FT /label=prp2 FT /note="SPBC146.07, len:443" FT /product="involved in pre-mRNA splicing; U2AF subunit; FT similar to S. cerevisiae MUD2" FT /fasta_file="fasta/c146.tab.seq.03861.out" FT misc_feature 934187..934402 FT /colour=9 FT /note="Pfam match to entry PF00076 rrm, RNA recognition FT motif. (a.k.a. RRM, RBD, or RNP domain)," FT CDS complement(join(935031..935115,935168..935466)) FT /colour=7 FT /gene="SPBC146.08c" FT /label=SPBC146.08c FT /note="SPBC146.08c, len:127," FT /product="putative elongation initation factor eIF1a" FT /fasta_file="fasta/c146.tab.seq.03862.out" FT misc_feature complement(935116..935130) FT /colour=6 FT /note="ctaactagtttaaag, splice branch and acceptor" FT misc_feature complement(935162..935167) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT CDS complement(935699..938701) FT /colour=7 FT /gene="SPBC146.09c" FT /label=SPBC146.09c FT /note="SPBC146.09c, len:1000, FT SIMILARITY:Schizosaccharomyces pombe, YAR2_SCHPO, FT hypothetical 142.5 kD protein c23e2.02 in chromosome i., FT (1273 aa), fasta scores: opt: 687, E():0, (31.8% identity FT in 1018 aa)" FT /product="putative L-amino acid oxidase; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c146.tab.seq.03863.out" FT CDS 939452..940021 FT /colour=10 FT /gene="SPBC146.10" FT /label=SPBC146.10 FT /note="SPBC146.10, len:189, overlaps CDS SPBC146.11c at FT the 5' end by 7 aa" FT /product="hypothetical protein; similar to S. cerevisiae FT YDR262W (low)" FT /fasta_file="fasta/c146.tab.seq.03864.out" FT CDS complement(939995..941002) FT /colour=8 FT /gene="SPBC146.11c" FT /label=SPBC146.11c FT /note="SPBC146.11c, len:335, overlaps CDS SPBC146.10 at FT the 5' end by 7 aa" FT /product="hypothetical protein; sequence orphan; contains FT 2 predicted transmembrane helices at C-term" FT /fasta_file="fasta/c146.tab.seq.03865.out" FT CDS 942154..943554 FT /colour=7 FT /gene="coq6" FT /gene="SPBC146.12" FT /label=coq6 FT /note="SPBC146.12, len:466, SIMILARITY:Homo sapiens, FT AAD27719, cgi-10 protein., (468 aa), fasta scores: opt: FT 780, E():0, (34.5% identity in 440 aa) and to FT Caenorhabditis elegans, COQ6_CAEEL, putative ubiquinone FT biosynthesis monooxygenase, (466 aa), fasta scores: opt: FT 680, E():0, (31.3% identity in 450 aa overlap)" FT /product="putative coenzyme Q monooxygenase (ubiquinone) FT biosynthesis monooxygenase" FT /fasta_file="fasta/c146.tab.seq.03866.out" FT misc_feature 942724..943425 FT /colour=9 FT /note="Pfam match to entry PF01360 Monooxygenase," FT CDS complement(join(943932..947582,947627..947629)) FT /colour=2 FT /gene="myo1" FT /gene="SPBC146.13c" FT /label=myo1 FT /note="SPBC146.13c, len:1217, SIMILARITY:Emericella FT nidulans, Q00647, myosin I heavy chain., (1249 aa), fasta FT scores: opt: 4021, E():0, (54.6% identity in 1203 aa)" FT /product="myosin I; possibly involved in F-actin assembly; FT appears to control the distribution of F- actin patches FT during the cell cycle; type I myosin; SH3 domain; IQ FT domains" FT /fasta_file="fasta/c146.tab.seq.03867.out" FT misc_feature complement(944141..944305) FT /colour=9 FT /note="Pfam match to entry PF00018 SH3, Src homology FT domain 3," FT misc_feature complement(945509..947506) FT /colour=9 FT /note="Pfam match to entry PF00063 myosin_head, Myosin FT head (motor domain)," FT misc_feature complement(947583..947594) FT /colour=6 FT /note="ttaataaattag, splice branch and acceptor" FT misc_feature complement(947621..947626) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 950362..952042 FT /note="nominal overlap with cosmid SPBC337, EM:AL031854 S. FT pombe chromosome 2" FT misc_feature 950362..952042 FT /note="nominal overlap with cosmid SPBC146, EM:AL096797 S. FT pombe chromosome 2" FT misc_feature 952513..954064 FT /note="region duplicated in S. pombe cosmid c569." FT misc_feature complement(join(952556..953305,953309..953326, FT 953326..953475)) FT /note="SPBC337.02c, len:305, pseudo" FT CDS complement(952556..953475) FT /colour=4 FT /gene="SPBC337.02c" FT /label=SPBC337.02c FT /note="SPBC337.02c, len:305, FT SIMILARITY:Schizosaccharomyces pombe, Q9Y7S2, hypothetical FT repeat containing protein., (396 aa), fasta scores: opt: FT 758, E():0, (46.7% identity in 396 aa)" FT /product="pseudogene; possibly S. pombe specific" FT /pseudo FT /fasta_file="fasta/c337.tab.seq.03485.out" FT LTR complement(954119..954430) FT /note="393 (-1) 44 358 TF1" FT CDS join(955237..955384,955433..955533,955602..955796, FT 955844..956563) FT /colour=7 FT /gene="SPBC337.03" FT /label=SPBC337.03 FT /note="SPBC337.03, len:387, SIMILARITY:Saccharomyces FT cerevisiae, Q05543, CHROMOSOME IV COSMID 9819,(409 aa), FT fasta sco res: opt: 340, E():0.0036, (22.9%% identity in FT 385 aa)" FT /product="similar to S. cerevisiae RTT103- regulator of FT Ty1 transposition" FT /fasta_file="fasta/c337.tab.seq.03486.out" FT misc_feature 955385..955390 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 955416..955432 FT /colour=6 FT /note="ctaactaatttaaccag, splice branch and acceptor" FT misc_feature 955534..955539 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 955584..955601 FT /colour=6 FT /note="ctaataatatttgcatag, splice branch and acceptor" FT misc_feature 955797..955802 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 955832..955843 FT /colour=6 FT /note="ctaattgcatag, splice branch and acceptor" FT CDS join(956776..957481,957549..958084) FT /colour=7 FT /gene="SPBC337.04" FT /label=SPBC337.04 FT /note="SPBC337.04, len:413, SIMILARITY:Saccharomyces FT cerevisiae, YKL116C, KKL6_YEAST, putative serine/threonine- FT protein kinase ykl116c, (518 aa), fasta scores: opt: 413, FT E():1e- 20, (33.0% identity in 261 aa)" FT /product="putative serine/threonine protein kinase; FT similar to S. cerevisiae PRR1" FT /fasta_file="fasta/c337.tab.seq.03487.out" FT misc_feature join(957208..957481,957549..958030) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 116.09" FT misc_feature 957482..957487 FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature 957531..957548 FT /colour=6 FT /note="ctaacactttgtctttag, splice branch and acceptor" FT CDS complement(join(958246..959601,959888..960009, FT 960062..960101,960155..960277)) FT /colour=2 FT /gene="cct8" FT /gene="SPBC337.05c" FT /label=cct8 FT /note="SPBC337.05c, len:546" FT /product="t-complex protein 1, theta subunit" FT /fasta_file="fasta/c337.tab.seq.03488.out" FT misc_feature complement(join(958297..959601,959888..960009, FT 960062..960098)) FT /note="Match to PF00118 cpn60_TCP1, TCP-1/cpn60 chaperonin FT family Score 409.19" FT misc_feature complement(958688..960166) FT /colour=9 FT /note="Pfam match to entry PF00118 cpn60_TCP1, Chaperonins FT cpn60 and TCP-1" FT misc_feature complement(959602..959612) FT /colour=6 FT /note="ctaaccattag, splice branch and acceptor" FT intron complement(959602..959887) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(959882..959887) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(960010..960024) FT /colour=6 FT /note="ctaacacacacatag, splice branch and acceptor" FT intron complement(960010..960061) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(960056..960061) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(960102..960114) FT /colour=6 FT /note="ctgatacttttag, splice branch and acceptor" FT intron complement(960102..960154) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(960149..960154) FT /colour=6 FT /note="gtaagg, splice donor sequence" FT CDS complement(join(960816..961598,961658..961672)) FT /colour=10 FT /gene="SPBC337.06c" FT /label=SPBC337.06c FT /note="SPBC337.06c, len:265, SIMILARITY:C. elegans, O45766, FT hypothetical protein (230 aa), fasta scores: opt: 375, FT E( ):3.6e-32, (37.2% identity in 277 aa)" FT /product="hypothetical protein; Pfam-B_1; highly conserved FT N-terminal domain FT MTTA{AH}RT{PQ}{FW}.PA{RK}G{GH}.*SSR....H...K.R and C FT terminal domain FT {VI}KRRWD{DE}DVVF{RK}N.*F{VI}ND.{LI}R{SN}{DE}FH{KR}KF{LM} FT .{RK}{FY}{VIM}{DK} with human HSPC148 cDNA cloned from FT cd34+ stem cells, D. melanogasta CG12135 C. elegans FT T10C6.5 and Arabidopsis thaliana DBJ|BAA90629.1; no FT apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c337.tab.seq.03489.out" FT misc_feature complement(961599..961613) FT /colour=6 FT /note="ctaactcatgtttag, splice branch and acceptor" FT intron complement(961599..961657) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(961652..961657) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT CDS complement(join(961994..962092,962133..962380, FT 962422..962550,962600..962705,962747..963658)) FT /colour=7 FT /gene="SPBC337.07c" FT /label=SPBC337.07c FT /note="SPBC337.07c, len:497, SIMILARITY:Saccharomyces FT cerevisiae, YHR132C, YHT2_YEAST, hypothetical 49.8 kD FT protein pr ecursor., (430 aa), fasta scores: opt: 852, FT E():0, (35.8% i dentity in 424 aa)" FT /product="putative carboxypeptidase; similar to S. FT cerevisiae ECM14" FT /fasta_file="fasta/c337.tab.seq.03490.out" FT misc_feature complement(962093..962105) FT /colour=6 FT /note="ctaattaaacaag, splice branch and acceptor" FT misc_feature complement(962127..962132) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(962381..962393) FT /colour=6 FT /note="ctaattaagttag, splice branch and acceptor" FT misc_feature complement(962416..962421) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(962551..962564) FT /colour=6 FT /note="ctaacaaactcaag, splice branch and acceptor" FT misc_feature complement(962594..962599) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature complement(962706..962720) FT /colour=6 FT /note="ctaattatttgtcag, splice branch and acceptor" FT misc_feature complement(962741..962746) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(962747..963112) FT /note="Match to PF00246 Zn_carbOpept, zinc FT carboxypeptidase Score 94.61" FT CDS complement(964117..965265) FT /colour=2 FT /gene="ubi4" FT /gene="SPBC337.08c" FT /label=ubi4 FT /note="SPBC337.08c, len:382" FT /product="ubiquitin family protein" FT /fasta_file="fasta/c337.tab.seq.03491.out" FT misc_feature complement(964126..964353) FT /note="Match to PF00240 ubiquitin, Ubiquitin family Score FT 180.83" FT misc_feature complement(964354..964581) FT /note="Match to PF00240 ubiquitin, Ubiquitin family Score FT 180.83" FT misc_feature complement(964582..964809) FT /note="Match to PF00240 ubiquitin, Ubiquitin family Score FT 180.83" FT misc_feature complement(964810..965037) FT /note="Match to PF00240 ubiquitin, Ubiquitin family Score FT 180.83" FT misc_feature complement(965038..965265) FT /note="Match to PF00240 ubiquitin, Ubiquitin family Score FT 180.83" FT CDS join(967234..967375,967487..967577,967642..967819) FT /colour=2 FT /gene="erg28" FT /gene="SPBC337.09" FT /label=erg28 FT /note="SPBC337.09, len:136, SIMILARITY:Saccharomyces FT cerevisiae, YER044C, YEN4_YEAST, hypothetical 17.1 kD FT protein in sah1-mei4 intergenic region, (148 aa), fasta FT scores: opt: 3 63, E():7.9e-24, (39.1% identity in 133 aa)" FT /product="involved in synthesis of ergosterol; similar to FT S. cerevisiae ERG28" FT /fasta_file="fasta/c337.tab.seq.03492.out" FT misc_feature 967376..967381 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 967469..967486 FT /colour=6 FT /note="ctgactttatatctgtag, splice branch and acceptor" FT misc_feature 967578..967583 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 967628..967641 FT /colour=6 FT /note="ctaacttctattag, splice branch and acceptor" FT CDS complement(968263..969129) FT /colour=10 FT /gene="SPBC337.10c" FT /label=SPBC337.10c FT /note="SPBC337.10c, len:288, SIMILARITY:Homo sapiens, FT G3252 825, hypothetical 33.6 kD protein., (312 aa), fasta FT scores: opt: 227, E():6.6e-21, (44.7% identity in 123 aa)" FT /product="conserved protein; similar to S. cerevisiae FT YKR071C; Pfam-B_6232 and signal peptide" FT /fasta_file="fasta/c337.tab.seq.03493.out" FT misc_feature complement(969091..969138) FT /colour=8 FT /note="PS00012 Phosphopantetheine attachment site" FT CDS 970014..970991 FT /colour=7 FT /gene="SPBC337.11" FT /label=SPBC337.11 FT /note="SPBC337.11, len:325, SIMILARITY:Phaseolus aureus, FT Q4 3677, auxin-induced protein., (317 aa), fasta scores: FT opt: 342, E():1.2e-19, (34.8% identity in 227 aa)" FT /product="zinc binding dehydrogenase" FT /fasta_file="fasta/c337.tab.seq.03494.out" FT misc_feature 970029..970976 FT /colour=9 FT /note="Pfam match to entry PF00107 adh_zinc, zinc binding FT d ehydrogenases" FT CDS join(971779..971821,972038..972067,972110..973170) FT /colour=7 FT /gene="SPBC337.12" FT /label=SPBC337.12 FT /note="SPBC337.12, len:377, SIMILARITY:Homo sapiens, FT Q14163 , kiaa0150 protein, (944 aa), fasta scores: opt: FT 438, E():6 .6e-09, (41.7% identity in 127 aa)" FT /product="zinc finger protein; zf-CCCH type (4); putative FT cleavage and polyadenylation specific factor" FT /fasta_file="fasta/c337.tab.seq.03495.out" FT CDS complement(973477..974403) FT /colour=2 FT /gene="gtr1" FT /gene="SPBC337.13c" FT /label=gtr1 FT /note="SPBC337.13c, len:308, SIMILARITY:Homo sapiens, FT Q1534 7, raga., (313 aa), fasta scores: opt: 1347, E():0, FT (66.4% identity in 295 aa)" FT /product="putative ras related GTP-binding protein; binds FT C-terminal domain of Gtr2p in a two-hybrid assay" FT /fasta_file="fasta/c337.tab.seq.03496.out" FT misc_feature complement(974356..974379) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS join(975361..975412,975451..975556,975602..975679, FT 975754..975925) FT /EC_number="2.7.7.6" FT /colour=2 FT /gene="rpb4" FT /gene="SPBC337.14" FT /label=rpb4 FT /note="SPBC337.14, len:135" FT /product="DNA-directed RNA polymerase II subunit" FT /fasta_file="fasta/c337.tab.seq.03497.out" FT misc_feature 975413..975418 FT /colour=6 FT /note="gttgga, splice donor sequence" FT intron 975413..975450 FT /colour=2 FT /note="confirmed intron" FT misc_feature 975438..975450 FT /colour=6 FT /note="ctaatataaaaag, splice branch and acceptor" FT misc_feature 975557..975562 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT intron 975557..975601 FT /colour=2 FT /note="confirmed intron" FT misc_feature 975589..975601 FT /colour=6 FT /note="ttaactaggatag, splice branch and acceptor" FT misc_feature 975680..975685 FT /colour=6 FT /note="gtacat, splice donor sequence" FT misc_feature 975742..975753 FT /colour=6 FT /note="ctaacctcatag, splice branch and acceptor" FT CDS complement(976324..976974) FT /colour=7 FT /gene="coq7" FT /gene="SPBC337.15c" FT /label=coq7 FT /note="SPBC337.15c, len:216, SIMILARITY:Saccharomyces FT cerev isiae, YOR125C, CAT5_YEAST, cat5 protein, (272 aa), FT fasta s cores: opt: 530, E():0, (50.5% identity in 192 aa)" FT /product="putative ubiquinone biosynthesis protein; FT putative respiration and gluconeogenesis protein; similar FT to S. cerevisiae CAT5" FT /fasta_file="fasta/c337.tab.seq.03498.out" FT CDS join(978046..978650,978706..978766) FT /EC_number="2.1.1.16" FT /colour=2 FT /gene="cho1" FT /gene="SPBC337.16" FT /label=cho1 FT /note="SPBC337.16, len:221" FT /product="phospholipid methyltransferase" FT /fasta_file="fasta/c337.tab.seq.03499.out" FT misc_feature 978651..978656 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 978692..978705 FT /colour=6 FT /note="ctaaccattaatag, splice branch and acceptor" FT misc_feature 980681..987703 FT /note="nominal overlap with cosmid SPBC1734, EM:AL031856 FT S. pombe chromosome 2" FT misc_feature complement(982335..982348) FT /colour=6 FT /note="ctaacttattgtag, splice branch and acceptor" FT misc_feature complement(982403..982408) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(982517..982534) FT /colour=6 FT /note="ctaattgatttaattaag, splice branch and acceptor" FT misc_feature complement(982567..982572) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(982641..982654) FT /colour=6 FT /note="ctaactatttgtag, splice branch and acceptor" FT misc_feature complement(982689..982694) FT /colour=6 FT /note="gtttgt, splice donor sequence" FT misc_feature complement(982862..982881) FT /colour=6 FT /note="ttaataattcatactttcag, splice branch and acceptor" FT misc_feature complement(982912..982917) FT /colour=6 FT /note="gtaagg, splice donor sequence" FT misc_feature complement(982974..982988) FT /colour=6 FT /note="ctaactgtataaaag, splice branch and acceptor" FT misc_feature complement(983017..983022) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 984784..985233 FT /note="Match to PF01288 HPPK, 7,8-dihydro-6- FT hydroxymethylpterin-pyrophosphokinase (HPPK) Score 243.73" FT misc_feature 985300..986082 FT /note="Match to PF00809 DHPS, Dihydropteroate synthase FT Score 415.89" FT misc_feature 980681..987703 FT /note="nominal overlap with cosmid SPBC337, EM:AL031854 S. FT pombe chromosome 2" FT misc_feature complement(982335..982348) FT /colour=6 FT /note="ctaacttattgtag, splice branch and acceptor" FT misc_feature complement(982403..982408) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT mRNA 982409..982516 FT /colour=3 FT /note="mRNA from SPCDC27B 453 346" FT misc_feature complement(982517..982534) FT /colour=6 FT /note="ctaattgatttaattaag, splice branch and acceptor" FT misc_feature complement(982567..982572) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(982641..982655) FT /colour=6 FT /note="ctaactatttgtag, splice branch and acceptor" FT misc_feature complement(982689..982694) FT /colour=6 FT /note="gtttgt, splice donor sequence" FT misc_feature complement(982862..982881) FT /colour=6 FT /note="ttaataattcatactttcag, splice branch and acceptor" FT misc_feature complement(982912..982917) FT /colour=6 FT /note="gtaagg, splice donor sequence" FT misc_feature complement(982974..982986) FT /colour=6 FT /note="ctaactgtataaaag, splice branch and acceptor" FT misc_feature complement(983017..983022) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 984784..985233 FT /note="Match to PF01288 HPPK, 7,8-dihydro-6- FT hydroxymethylpterin-pyrophosphokinase (HPPK) Score 243.73" FT misc_feature 985300..986082 FT /note="Match to PF00809 DHPS, Dihydropteroate synthase FT Score 415.89" FT CDS complement(join(988809..989387,989591..989641)) FT /colour=2 FT /gene="spf31" FT /gene="SPBC1734.05c" FT /label=spf31 FT /note="SPBC1734.05c, len:208, SIMILARITY:Homo sapiens, FT O75937, spf31., (264 aa), fasta scores: opt: 204, E():4.8e- FT 06, (33.3% identity in 216 aa)" FT /product="putative spliceosome associated protein; DNAJ FT domain protein; putative pre-mRNA splicing factor; no FT apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c1734.tab.seq.03285.out" FT misc_feature complement(989157..989342) FT /note="Match to PF00226 DnaJ, DnaJ domain Score 25.41" FT misc_feature complement(989388..989402) FT /colour=6 FT /note="ctaacctttacttag, splice branch and acceptor" FT intron complement(989388..989590) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(989585..989590) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS 989957..991120 FT /colour=2 FT /gene="rhp18" FT /gene="SPBC1734.06" FT /label=SPBC1734.06 FT /note="SPBC1734.06, len:386, SIMILARITY:Emericella FT nidulans, Q02398, DNA repair/zinc finger protein uvsh., FT (443 aa), fasta scores: opt: 586, E():9.1e-29, (28.8% FT identity in 399 aa)" FT /product="DNA repair protein; PRR protein; zinc finger FT protein; zf-C3HC4 type (RING finger); SAP domain; DNA- FT binding; similar to S. cerevisiae RAD18" FT /fasta_file="fasta/c1734.tab.seq.03286.out" FT misc_feature 990041..990154 FT /note="Match to PF00097 zf-C3HC4, zinc finger, C3HC4 type FT (RING finger) Score 53.00" FT CDS complement(991270..993126) FT /colour=7 FT /gene="SPBC1734.07c" FT /label=SPBC1734.07c FT /note="SPBC1734.07c, len:618" FT /note="SPBC1734.07c, len:617, FT SIMILARITY:Schizosaccharomyces pombe, O94731, hypothetical FT 76.0 kD protein., (658 aa), fasta scores: opt: 312, FT E():1.1e-13, (27.3% identity in 612 aa)" FT /product="putative subunit of the Transport protein FT Particle (TRAPP) complex; similar to S. cerevisiae GSG1" FT /fasta_file="fasta/c1734.tab.seq.03287.out" FT LTR 993568..993773 FT /note="Tf2-type LTR- fragment" FT misc_feature join(994098..994225,994270..994345,994519..994740) FT /note="Match to PF00790 VHS, VHS domain Score 65.85" FT CDS join(994098..994225,994270..994345,994519..994738, FT 994797..995494) FT /colour=7 FT /gene="SPBC1734.08" FT /label=SPBC1734.08 FT /note="SPBC1734.08, len:372, SIMILARITY:Saccharomyces FT cerevisiae, YHA2_YEAST, hypothetical 51.2 kD protein, (452 FT aa), fasta scores: opt: 771, E():0, (35.1% identity in 367 FT aa)" FT /product="similar to mammalian signal transducing adaptor; FT contains VHS domain; contains SH3 domain; similar to S. FT cerevisiae YHL002W" FT /fasta_file="fasta/c1734.tab.seq.03288.out" FT misc_feature 994226..994231 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 994255..994269 FT /colour=6 FT /note="ctaactggttggtag, splice branch and acceptor" FT misc_feature 994346..994351 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 994503..994518 FT /colour=6 FT /note="ctaacgtttgttttag, splice branch and acceptor" FT misc_feature 994739..994744 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 994785..994796 FT /colour=6 FT /note="ctaacctcttag, splice branch and acceptor" FT misc_feature 995027..995188 FT /note="Match to PF00018 SH3, Src homology domain 3 Score FT 92.45" FT CDS 996046..996996 FT /colour=7 FT /gene="SPBC1734.09" FT /label=SPBC1734.09 FT /note="SPBC1734.09, len:315, SIMILARITY:Caenorhabditis FT elegans., O44166, f15b10.1 protein., (324 aa), fasta FT scores: opt: 582, E():0, (35.0% identity in 320 aa)" FT /product="NST UDP-N-acetylglucosamine transporter" FT /fasta_file="fasta/c1734.tab.seq.03289.out" FT CDS complement(join(997138..997665,998147..998617)) FT /colour=10 FT /gene="SPBC1734.10c" FT /label=SPBC1734.10c FT /note="SPBC1734.10c, len:331, SIMILARITY: LOW to FT Saccharomyces cerevisiae, YJ9I_YEAST, hypothetical 39.9 kD FT protein in hom6-pmt4 intergenic region., (347 aa), fasta FT scores: opt: 178, E():0.0001, (21.2% identity in 264 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YJR141W null lethal, and may have vacuolar FT function/location from 2-hybrid data" FT /fasta_file="fasta/c1734.tab.seq.03290.out" FT misc_feature complement(997666..997680) FT /colour=6 FT /note="ctaacaagattttag, splice branch and acceptor" FT misc_feature complement(998141..998146) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT LTR 998888..999225 FT /note="tf2-type LTR" FT mRNA 1000494..1000737 FT /colour=3 FT /note="mRNA from AU008429 333 90" FT CDS 1001418..1002641 FT /colour=7 FT /gene="SPBC1734.11" FT /label=SPBC1734.11 FT /note="SPBC1734.11, len:406, SIMILARITY:Saccharomyces FT cerevisiae, MAS5_YEAST, mitochondrial protein import FT protein mas5, (409 aa), fasta scores: opt: 1543, E():0, FT (53.7% identity in 415 aa)" FT /product="putative mitochondrial chaperone; cytoplasmic FT localisation; similar to S. cerevisiae MAS5; contains DNAj FT domain, DNAj C terminal region, DNAj central domain" FT /fasta_file="fasta/c1734.tab.seq.03291.out" FT misc_feature 1001436..1001621 FT /note="Match to PF00226 DnaJ, DnaJ domain Score 125.78" FT misc_feature 1001787..1002044 FT /note="Match to PF00684 DnaJ_CXXCXGXG, DnaJ central domain FT (4 repeats) Score 131.32" FT misc_feature 1002081..1002452 FT /note="Match to PF01556 DnaJ_C, DnaJ C terminal region FT Score 71.64" FT CDS complement(join(1003284..1003780,1003826..1004810, FT 1004859..1005017)) FT /colour=7 FT /gene="SPBC1734.12c" FT /label=SPBC1734.12c FT /note="SPBC1734.12c, len:546, SIMILARITY:Saccharomyces FT cerevisiae, YN8I_YEAST,involved in cell wall biogenesis FT and architecture , (551 aa), fasta scores: opt: 617, FT E():3.3e-32, (35.0% identity in 508 aa)" FT /product="possibly involved in cell wall biogenesis and FT architecture; subcellular localization of GFP fusion - FT Membrane; similar to S. cerevisiae ECM39" FT /fasta_file="fasta/c1734.tab.seq.00062.out" FT misc_feature complement(1003781..1003793) FT /colour=6 FT /note="ctaacgtacttag, splice branch and acceptor" FT misc_feature complement(1003820..1003825) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1004811..1004824) FT /colour=6 FT /note="ctcacatattttag, splice branch and acceptor" FT intron complement(1004811..1004858) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1004850..1004855) FT /colour=6 FT /note="gtagtt, splice donor sequence" FT CDS join(1005635..1005714,1005794..1006619) FT /colour=2 FT /gene="atp3" FT /gene="SPBC1734.13" FT /label=atp3 FT /note="SPBC1734.13, len:300, SIMILARITY:Kluyveromyces FT lactis, ATPG_KLULA, atp synthase gamma chain, FT mitochondrial , (289 aa), fasta scores: opt: 781, E():0, FT (46.8% identity in 295 aa)" FT /product="putative mitochondrial F1-ATPase; gamma subunit" FT /fasta_file="fasta/c1734.tab.seq.03293.out" FT misc_feature 1005715..1005720 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1005777..1005793 FT /colour=6 FT /note="ctaacgattttttatag, splice branch and acceptor" FT misc_feature 1005807..1006613 FT /note="Match to PF00231 ATP-synt, ATP synthase Score FT 262.59" FT CDS complement(join(1007970..1008077,1008129..1008273, FT 1008389..1008477)) FT /colour=2 FT /gene="suc1" FT /gene="SPBC1734.14c" FT /label=suc1 FT /note="SPBC1734.14c, len:113" FT /product="cyclin-dependent kinases regulatory subunit; FT similar to S. cerevisiae CKS1" FT /fasta_file="fasta/c1734.tab.seq.03294.out" FT misc_feature complement(join(1008006..1008077,1008129..1008278)) FT /note="Match to PF01111 CKS, Cyclin-dependent kinase FT regulatory subunit Score 132.07" FT misc_feature complement(1008078..1008092) FT /colour=6 FT /note="ctgacatttatttag, splice branch and acceptor" FT misc_feature complement(1008123..1008128) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1008274..1008289) FT /colour=6 FT /note="ctaatcgatgaaatag, splice branch and acceptor" FT misc_feature complement(1008383..1008388) FT /colour=6 FT /note="gtatga, splice donor sequence" FT CDS join(1008887..1008889,1008938..1009020,1009081..1010623) FT /colour=2 FT /gene="brd1" FT /gene="SPBC1734.15" FT /label=brd1 FT /note="SPBC1734.15, len:542" FT /product="putative transcriptional activator; putative FT chromatin remodeling complex subunit; bromodomain protein FT (PMID: 7565614); contains BHA domain; similar to S. FT cerevisiae RSC4" FT /fasta_file="fasta/c1734.tab.seq.03295.out" FT misc_feature 1008890..1008895 FT /colour=6 FT /note="gtatat, splice donor sequence" FT misc_feature 1008925..1008937 FT /colour=6 FT /note="ctaatatttatag, splice branch and acceptor" FT misc_feature 1009021..1009026 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1009060..1009080 FT /colour=6 FT /note="ctaataatttatttaaaatag, splice branch and acceptor" FT misc_feature 1009076..1009303 FT /note="Match to PF00439 bromodomain, Bromodomain Score FT 121.54" FT misc_feature 1009436..1009705 FT /note="Match to PF00439 bromodomain, Bromodomain Score FT 147.00" FT CDS complement(join(1010797..1014215,1014307..1014352)) FT /colour=2 FT /gene="pst3" FT /gene="SPBC1734.16c" FT /label=pst3 FT /note="SPBC1734.16c, len:1153, FT SIMILARITY:Schizosaccharomyces pombe, O13919, hypothetical FT 124.8 kD protein c23c11.15 in chromosome i., (1075 aa), FT fasta scores: opt: 420, E():1.1e-17, (22.6% identity in FT 1131 aa)" FT /product="putative SIN3 family co-repressor; putative FT transcriptional regulation protein;contains a paired FT amphipathic helix; putative histone deacetylase pathway" FT /fasta_file="fasta/c1734.tab.seq.03296.out" FT misc_feature complement(1014216..1014227) FT /colour=6 FT /note="ctaatattatag, splice branch and acceptor" FT misc_feature complement(1014301..1014306) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1015822..1016304 FT /note="Match to PF01644 Chitin_synth, Chitin synthase FT Score 228.08" FT misc_feature 1017057..1017062 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 1017092..1017103 FT /colour=6 FT /note="ctaattgtttag, splice branch and acceptor" FT misc_feature 1017309..1021955 FT /note="nominal overlap with cosmid SPBC1709, EM:AL031852 FT S. pombe chromosome 2" FT misc_feature complement(1018575..1020629) FT /note="Match to PF00133 tRNA-synt_1, tRNA synthetases FT class I (I, L, M and V) Score 1056.92" FT misc_feature complement(1020780..1020795) FT /colour=6 FT /note="ctaatcattttattag, splice branch and acceptor" FT misc_feature complement(1020905..1020910) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature complement(1020985..1020999) FT /colour=6 FT /note="ctaacatctatatag, splice branch and acceptor" FT misc_feature complement(1021038..1021043) FT /colour=6 FT /note="gtgagt, splice donor sequence" FT misc_feature complement(1021096..1021108) FT /colour=6 FT /note="ctaataattgaag, splice branch and acceptor" FT misc_feature complement(1021130..1021135) FT /colour=6 FT /note="gtgagt, splice donor sequence" FT misc_feature 1017309..1021955 FT /note="nominal overlap with cosmid SPBC1734, EM:AL031856 FT S. pombe chromosome 2" FT misc_feature complement(1018575..1020629) FT /note="Match to PF00133 tRNA-synt_1, tRNA synthetases FT class I (I, L, M and V) Score 1056.92" FT misc_feature complement(1020780..1020795) FT /colour=6 FT /note="ctaatcattttattag, splice branch and acceptor" FT misc_feature complement(1020905..1020910) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature complement(1020985..1020999) FT /colour=6 FT /note="ctaacatctatatag, splice branch and acceptor" FT misc_feature complement(1021038..1021043) FT /colour=6 FT /note="gtgagt, splice donor sequence" FT misc_feature complement(1021096..1021108) FT /colour=6 FT /note="ctaataattgaag, splice branch and acceptor" FT misc_feature complement(1021130..1021135) FT /colour=6 FT /note="gtgagt, splice donor sequence" FT CDS join(1022148..1022774,1022813..1023382) FT /colour=8 FT /gene="SPBC1709.03" FT /label=SPBC1709.03 FT /note="SPBC1709.03, len:398" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c1709.tab.seq.03262.out" FT misc_feature 1022775..1022780 FT /colour=6 FT /note="gtatgg, splice donor sequence" FT misc_feature 1022801..1022812 FT /colour=6 FT /note="ttaacaccttag, splice branch and acceptor" FT CDS complement(join(1023469..1023762,1023840..1023907, FT 1023959..1024005,1024058..1024075,1024160..1024224, FT 1024277..1024306)) FT /EC_number="5.2.1.8" FT /colour=2 FT /gene="cyp3" FT /gene="SPBC1709.04c" FT /label=cyp3 FT /note="SPBC1709.04c, len:173, SIMILARITY:Homo sapiens, FT O43447, u-snrnp-associated cyclophilin, (177 aa), fasta FT scores: opt: 742, E():0, (62.1% identity in 169 aa)" FT /product="cyclophilin-3; u-snrnp-associated; peptidyl- FT prolyl cis-trans isomerase" FT /fasta_file="fasta/c1709.tab.seq.03263.out" FT misc_feature complement(1023472..1023762) FT /note="Match to PF00160 pro_isomerase, Cyclophilin type FT peptidyl-prolyl cis-trans isomerase Score 182.62" FT misc_feature complement(1023763..1023777) FT /colour=6 FT /note="ttaactgatgattag, splice branch and acceptor" FT misc_feature complement(1023834..1023839) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1023843..1023917) FT /note="Match to PF00160 pro_isomerase, Cyclophilin type FT peptidyl-prolyl cis-trans isomerase Score 42.63" FT misc_feature complement(1023908..1023927) FT /colour=6 FT /note="ctaattattaaaatcaaaag, splice branch and acceptor" FT misc_feature complement(1023953..1023958) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature complement(1024076..1024091) FT /colour=6 FT /note="ctgacattgaatttag, splice branch and acceptor" FT misc_feature complement(1024154..1024159) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1024225..1024241) FT /colour=6 FT /note="ctaattttggacaatag, splice branch and acceptor" FT misc_feature complement(1024271..1024276) FT /colour=6 FT /note="gtatgg, splice donor sequence" FT CDS 1026155..1027996 FT /colour=2 FT /gene="sks2" FT /gene="hsc1" FT /gene="SPBC1709.05" FT /label=sks2 FT /note="SPBC1709.05, len:613 ask2 is the name which was FT given to the spurious orf on the opposite strand" FT /product="heat shock protein 70 family" FT /fasta_file="fasta/c1709.tab.seq.03264.out" FT misc_feature 1026176..1027993 FT /note="Match to PF00012 HSP70, Hsp70 protein Score 1193.00" FT CDS join(1028427..1028595,1028834..1029483,1029525..1030145) FT /colour=10 FT /gene="SPBC1709.06" FT /label=SPBC1709.06 FT /note="SPBC1709.06, len:479, SIMILARITY:Saccharomyces FT cerevisiae, SMM1_YEAST, smm1 protein., (384 aa), fasta FT scores: opt: 847, E():0, (43.3% identity in 342 aa)" FT /product="conserved protein; UPF0034 family; similar to S. FT cerevisiae SMM1" FT /fasta_file="fasta/c1709.tab.seq.03265.out" FT misc_feature join(1028460..1028595,1028906..1029558) FT /note="Match to PF01207 UPF0034, Uncharacterized protein FT family UPF0034 Score 127.25" FT misc_feature 1028596..1028601 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1028815..1028833 FT /colour=6 FT /note="ttgactcaatttaaaatag, splice branch and acceptor" FT misc_feature 1029484..1029489 FT /colour=6 FT /note="gtttgt, splice donor sequence" FT misc_feature 1029511..1029524 FT /colour=6 FT /note="ctaattgttgatag, splice branch and acceptor" FT CDS join(1030589..1030629,1030677..1031115,1031164..1031700) FT /colour=7 FT /gene="SPBC1709.07" FT /note="SPBC1709.07, len:338, SIMILARITY:Saccharomyces FT cerevisiae, Q12452, orf ylr100w., (347 aa), fasta scores: FT opt: 641, E():0, (31.7% identity in 344 aa)" FT /product="putative 3-keto sterol reductase; possibly FT involved in ergosterol biosynthesis; similar to S. FT cerevisiae ERG27" FT /fasta_file="fasta/c1709.tab.seq.03266.out" FT misc_feature 1030601..1031176 FT /colour=9 FT /note="Pfam match to entry PF00106 adh_short, FT Alcohol/other dehydrogenases, short chain type" FT misc_feature 1030630..1030635 FT /colour=6 FT /note="gtaaaa, splice donor sequence" FT intron 1030630..1030676 FT /note="confirmed by mRNA" FT misc_feature 1030656..1030676 FT /colour=6 FT /note="aacacagttaatgattacag, splice branch and acceptor" FT misc_feature 1031116..1031121 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT intron 1031116..1031164 FT /note="confirmed by mRNA" FT misc_feature 1031150..1031163 FT /colour=6 FT /note="ctaatttacataag, splice branch and acceptor" FT CDS join(1032434..1032486,1032528..1032686,1032744..1032858) FT /colour=7 FT /gene="SPBC1709.20" FT /label=SPBC1709.20 FT /product="RNase P and RNase MRP subunit; similar to S. FT cerevisiae POP8" FT /fasta_file="fasta/c1709.tab.seq.03267.out" FT CDS 1033038..1037363 FT /colour=7 FT /gene="SPBC1709.08" FT /label=SPBC1709.08 FT /note="SPBC1709.08, len:1441, SIMILARITY:Homo sapiens, FT CPSA _HUMAN, cleavage and polyadenylation specificity FT factor, 16 0 kD subunit, (1442 aa), fasta scores: opt: 619, FT E():0, (26 .8% identity in 1408 aa)" FT /product="putative cleavage and polyadenylation factor; FT CFII component; similar to S. cerevisiae CFT1" FT /fasta_file="fasta/c1709.tab.seq.03268.out" FT CDS 1038260..1038994 FT /colour=7 FT /gene="SPBC1709.09" FT /label=SPBC1709.09 FT /note="SPBC1709.09, len:244" FT /note="SPBC1709.09, len:244, SIMILARITY:Saccharomyces FT cerevisiae, FIL1_YEAST, fil1 protein ., (230 aa), fasta FT scores: opt: 166, E():0.0018, (25.9% identity in 220 aa)" FT /product="putative mitochondrial translation termination FT factor; similar to prokaryotic ribosome FT releasing/recycling factor; similar to S. cerevisiae FIL1" FT /fasta_file="fasta/c1709.tab.seq.03269.out" FT misc_feature 1038473..1038991 FT /note="Match to PF01765 RRF, Ribosome recycling factor FT Score 200.07" FT CDS complement(join(1039551..1039681,1039805..1039880)) FT /colour=7 FT /gene="SPBC1709.10c" FT /label=SPBC1709.10c FT /note="SPBC1709.10c, len:68, SIMILARITY:Saccharomyces FT cerevisiae, ATX1_YEAST, metal homeostasis factor atx1., FT (73 aa), fasta scores: opt: 228, E():2.4e-10, (56.7% FT identity in 67 aa)" FT /product="putative metal homeostasis factor; similar to S. FT cerevisiae ATX1" FT /fasta_file="fasta/c1709.tab.seq.03270.out" FT misc_feature complement(1039682..1039703) FT /colour=6 FT /note="ctaattaagtaatgtcgagtag, splice branch and acceptor" FT misc_feature complement(1039799..1039804) FT /colour=6 FT /note="gtgcgt, splice donor sequence" FT LTR 1040114..1040369 FT /note="Tf1-type LTR; partial" FT CDS complement(join(1040644..1041437,1041485..1041556, FT 1041597..1041648)) FT /colour=2 FT /gene="png2" FT /gene="SPBC1709.11c" FT /label=png2 FT /note="SPBC1709.11c, len:305, SIMILARITY:Saccharomyces FT cerevisiae, YNJ7_YEAST, hypothetical 37.0 kD protein, (330 FT aa), fasta scores: opt: 339, E():2.9e-12, (29.7% identity FT in 327 aa)" FT /product="zinc finger protein; zf-PHD finger; similar to FT human candidate tumor suppressor p33(ING1) in their C- FT terminal regions; possibly involved in chromatin mediated FT transcriptional regulation; associated with histone FT acetyltransferase activities; similar to S. cerevisiae FT PHO23" FT /fasta_file="fasta/c1709.tab.seq.03271.out" FT misc_feature complement(1040674..1040814) FT /note="Match to PF00628 PHD, PHD-finger Score 53.15" FT misc_feature complement(1041438..1041452) FT /colour=6 FT /note="ttaacaaaatcttag, splice branch and acceptor" FT misc_feature complement(1041479..1041484) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1041557..1041570) FT /colour=6 FT /note="ttaacattttacag, splice branch and acceptor" FT misc_feature complement(1041591..1041596) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT CDS join(1042527..1042945,1043084..1043231,1043300..1043836) FT /colour=8 FT /gene="SPBC1709.12" FT /label=SPBC1709.12 FT /note="SPBC1709.12, len:367" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c1709.tab.seq.03272.out" FT misc_feature 1042946..1042951 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1043069..1043083 FT /colour=6 FT /note="ctaactgcaatacag, splice branch and acceptor" FT misc_feature 1043232..1043237 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 1043284..1043299 FT /colour=6 FT /note="ctaacgtttttcctag, splice branch and acceptor" FT CDS complement(1044143..1045786) FT /colour=10 FT /gene="SPBC1709.13c" FT /label=SPBC1709.13c FT /note="SPBC1709.13c, len:547, SIMILARITY:Saccharomyces FT cerevisiae, Q08961, ypl208w, (583 aa), fasta scores: opt: FT 303, E():1.2e-12, (26.2% identity in 432 aa)" FT /product="hypothetical protein; Pfam-B_2703; putative FT methyltransferase; similar to S. cerevisiae YPL208W" FT /fasta_file="fasta/c1709.tab.seq.03273.out" FT CDS join(1046327..1046653,1046729..1046905,1046952..1047111, FT 1047157..1047195,1047241..1047539) FT /colour=10 FT /gene="SPBC1709.14" FT /label=SPBC1709.14 FT /note="SPBC1709.14, len:333, SIMILARITY:Saccharomyces FT cerevisiae, Q02890, lpg12p., (363 aa), fasta scores: opt: FT 838, E():0, (40.9% identity in 362 aa)" FT /product="zinc finger protein; zf-PHD type" FT /fasta_file="fasta/c1709.tab.seq.03274.out" FT misc_feature 1046654..1046659 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1046715..1046728 FT /colour=6 FT /note="ttgacaatgtgtag, splice branch and acceptor" FT misc_feature 1046906..1046911 FT /colour=6 FT /note="gtgagt, splice donor sequence" FT misc_feature 1046937..1046951 FT /colour=6 FT /note="ctaacattttcttag, splice branch and acceptor" FT misc_feature 1046952..1047071 FT /note="Match to PF00628 Transglut_core, PHD-finger Score FT 51.41" FT misc_feature 1047112..1047117 FT /colour=6 FT /note="gtagag, splice donor sequence" FT misc_feature 1047144..1047156 FT /colour=6 FT /note="ctaacagcattag, splice branch and acceptor" FT misc_feature 1047196..1047201 FT /colour=6 FT /note="gtacgg, splice donor sequence" FT misc_feature 1047226..1047240 FT /colour=6 FT /note="ctaatgcaaaaatag, splice branch and acceptor" FT CDS complement(join(1047668..1049688,1049752..1050124)) FT /colour=7 FT /gene="SPBC1709.15c" FT /label=SPBC1709.15c FT /note="SPBC1709.15c, len:797, SIMILARITY:Xenopus laevis, FT Q9W799, cleavage and polyadenylation specificity factor FT 100 kDa subunit., (783 aa), fasta scores: opt: 734, E():0, FT (32.2% identity in 825 aa)" FT /product="putative cleavage and polyadenylation factor FT subunit; CFII component; similar to S. cerevisiae CFT2" FT /fasta_file="fasta/c1709.tab.seq.03275.out" FT misc_feature complement(1049689..1049704) FT /colour=6 FT /note="ctaattcatgatttag, splice branch and acceptor" FT misc_feature complement(1049746..1049751) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT CDS complement(join(1050595..1050777,1050851..1051159, FT 1051215..1051522,1051678..1051735)) FT /colour=10 FT /gene="SPBC1709.16c" FT /label=SPBC1709.16c FT /note="SPBC1709.16c, len:285, SIMILARITY:Streptomyces FT griseus., Q54224, unknown gene., (253 aa), fasta scores: FT opt: 383, E():7.5e-19, (34.5% identity in 255 aa)" FT /product="conserved protein; Pfam-B_11186; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c1709.tab.seq.03276.out" FT misc_feature complement(1050778..1050795) FT /colour=6 FT /note="ctaatttcgaacctatag, splice branch and acceptor" FT misc_feature complement(1050845..1050850) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1051160..1051171) FT /colour=6 FT /note="ctaacccaatag, splice branch and acceptor" FT misc_feature complement(1051209..1051214) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature complement(1051523..1051552) FT /colour=6 FT /note="ttgatactagaataactaaaaattgtttag, splice branch and FT ac ceptor" FT misc_feature complement(1051672..1051677) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS join(1051869..1051952,1051999..1052130,1052440..1053741) FT /colour=7 FT /gene="SPBC1709.17" FT /note="SPBC1709.17, len:505, SIMILARITY:Saccharomyces FT cerevisiae, FOLE_YEAST, putative folylpolyglutamate FT synthase, (548 aa), fasta scores: opt: 1299, E():0, (43.9% FT identity in 512 aa)" FT /product="folypolyglutamate synthase; subcellular FT localization of GFP fusion- Cytoplasmic dots or lines; FT similar to S. cerevisiae MET7" FT /fasta_file="fasta/c1709.tab.seq.03277.out" FT misc_feature 1051953..1051958 FT /colour=6 FT /note="gtatta, splice donor sequence" FT misc_feature 1051982..1051998 FT /colour=6 FT /note="ctaactaatgctttaag, splice branch and acceptor" FT misc_feature 1052131..1052136 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1052422..1052439 FT /colour=6 FT /note="tactaactaataaatctcag, splice branch and acceptor" FT misc_feature 1052464..1053273 FT /note="Match to PF01225 Mur_ligase, Mur ligase family FT Score 40.86" FT misc_feature join(1054303..1054674,1054765..1054904,1054962..1055073) FT /note="Match to PF01652 IF4E, Eukaryotic initiation factor FT 4E Score 261.73" FT misc_feature 1054591..1056797 FT /note="nominal overlap with cosmid SPBC409, EM:AL109822 S. FT pombe chromosome 2" FT misc_feature 1054675..1054680 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1054748..1054764 FT /colour=6 FT /note="ttaacgtatggaaatag, splice branch and acceptor" FT misc_feature 1054905..1054910 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1054947..1054961 FT /colour=6 FT /note="ctaacaaacatgtag, splice branch and acceptor" FT misc_feature complement(1056596..1056796) FT /note="Match to PF01106 NifU-like, NifU-like domain Score FT 110.31" FT intron 1054905..1054961 FT /note="confirmed by mRNA" FT misc_feature 1054591..1056797 FT /note="nominal overlap with cosmid SPBC1709, EM:AL031852 FT S. pombe chromosome 2" FT misc_feature 1054675..1054680 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1054748..1054764 FT /colour=6 FT /note="ttaacgtatggaaatag, splice branch and acceptor" FT misc_feature 1054905..1054910 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1054947..1054961 FT /colour=6 FT /note="ctaacaaacatgtag, splice branch and acceptor" FT misc_feature complement(1056596..1056808) FT /note="Match to PF01106 NifU-like, NifU-like domain Score FT 117.22" FT misc_RNA join(1057700..1057763,1057816..1057901,1058067..1058243) FT /colour=4 FT /note="mRNA from spc08410 - encodes 85 aa predicted no FT homology" FT CDS join(1057755..1057763,1057816..1057901,1058067..1058229) FT /colour=8 FT /gene="SPBC409.03" FT /note="SPBC409.03, len:120" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c409.tab.seq.00060.out" FT misc_feature 1057764..1057769 FT /colour=6 FT /note="gtaagc, splice donor sequence" FT intron 1057764..1057815 FT /colour=2 FT /note="confirmed intron" FT misc_feature 1057799..1057815 FT /colour=6 FT /note="ctgatgaattactgcag, splice branch and acceptor" FT misc_feature 1057902..1057907 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT intron 1057902..1058066 FT /colour=2 FT /note="confirmed intron" FT misc_feature 1058051..1058066 FT /colour=6 FT /note="ttgacaaatgatttag, splice branch and acceptor" FT CDS complement(1058447..1059226) FT /colour=2 FT /gene="mis12" FT /gene="SPBC409.04c" FT /label=mis12 FT /note="SPBC409.04c, len:259, SIMILARITY:Saccharomyces FT cerevisiae, YADA_YEAST, hypothetical 33.2 kD protein in FT pyk1-snc1 intergenic region, (289 aa), fasta scores: opt: FT 234, E():1.1e-07, (23.9% identity in 268 aa)" FT /product="inner centromere protein; required for FT maintaining centromere structure; similar to S. cerevisiae FT MTW1" FT /fasta_file="fasta/c409.tab.seq.03930.out" FT CDS join(1059847..1059895,1059949..1059996,1060071..1060438, FT 1060484..1060504) FT /colour=2 FT /gene="shp1" FT /gene="psh1" FT /gene="SPBC409.05" FT /label=shp1 FT /note="SPBC409.05, len:159, SIMILARITY:Emericella nidulans, FT Q92229, sulphur metabolite repression regulation protein FT sconcp., (160 aa), fasta scores: opt: 709, E():0, (68.4% FT identity in 155 aa)" FT /product="essential; required for degradation of cig2; FT similar to S. cerevisiae SKP1; skp1 family" FT /fasta_file="fasta/c409.tab.seq.03931.out" FT misc_feature join(1059850..1059895,1059949..1059996,1060071..1060303) FT /note="Match to PF01466 Skp1, Skp1 family Score 123.02" FT misc_feature 1059896..1059901 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1059931..1059948 FT /colour=6 FT /note="ttgacaaactgtttatag, splice branch and acceptor" FT misc_feature 1059997..1060002 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 1060050..1060070 FT /colour=6 FT /note="ctaaaatctcaatttcaatag, splice branch and acceptor" FT misc_feature 1060337..1060360 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 1060439..1060444 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 1060470..1060483 FT /colour=6 FT /note="ctaaccgcttgcag, splice branch and acceptor" FT CDS join(1061919..1062043,1062195..1062972) FT /colour=2 FT /gene="uch2" FT /gene="SPBC409.06" FT /label=uch2 FT /note="SPBC409.06, len:300, SIMILARITY:Arabidopsis FT thaliana, O04482, ests gb|t45673., (330 aa), fasta scores: FT opt: 778, E():0, (44.2% identity in 330 aa)" FT /product="ubiquitin carboxyl-terminal hydrolase; 26S FT proteasome associated" FT /fasta_file="fasta/c409.tab.seq.03932.out" FT misc_feature 1062044..1062049 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1062176..1062194 FT /colour=6 FT /note="ctgatttccttgcaattag, splice branch and acceptor" FT misc_feature 1062277..1062672 FT /note="Match to PF01088 UCH, Ubiquitin carboxyl-terminal FT hydrolase, family 1 Score 29.44" FT misc_feature 1062364..1062387 FT /colour=8 FT /note="PS00297 Heat shock hsp70 proteins family signature FT 1" FT CDS complement(1063666..1065483) FT /colour=2 FT /gene="wis1" FT /gene="spc2" FT /gene="smf2" FT /gene="SPBC409.07c" FT /label=wis1 FT /note="SPBC409.07c, len:605" FT /product="serine/threonine protein kinase; stress FT activated MAP kinase kinase; involved in cell cycle FT progression; involved in mitotic control" FT /fasta_file="fasta/c409.tab.seq.03933.out" FT misc_feature complement(1063747..1064526) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 237.59" FT misc_feature 1065484..1071777 FT /note="low-complexity gene-free region" FT CDS join(1071778..1071872,1071915..1073439) FT /colour=7 FT /gene="SPBC409.08" FT /label=SPBC409.08 FT /note="SPBC409.08, len:539. Sequence has been checked and FT is accurate with good coverage - putative pseudogene, FT SIMILARITY:Saccharomyces cerevisiae, YG3F_YEAST, FT hypothetical 67.6 kD protein in pas5-cbf2 intergenic FT region, (614 aa), fasta scores: opt: 1362, E():0, (44.9% FT identity in 486 aa)" FT /note="was originally annotated as a pseudogene, but now FT has putative predicted splice with no branch site" FT /product="MFS transporter of unknown specificity; similar FT to S. cerevisiae YGR138C" FT /fasta_file="fasta/c409.tab.seq.03934.out" FT misc_feature 1072288..1072338 FT /colour=8 FT /note="PS00216 Sugar transport proteins signature 1" FT CDS complement(1074311..1075300) FT /colour=10 FT /gene="SPBC409.09c" FT /label=SPBC409.09c FT /note="SPBC409.09c, len:329, LOW SIMILARITY:Caenorhabditis FT elegans., HM32_CAEEL, homeobox protein ceh-32., (429 aa), FT fasta scores: opt: 134, E():0.33, (27.8% identity in 133 FT aa)" FT /product="hypothetical protein; conserved in N. crassa; no FT apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c409.tab.seq.00057.out" FT CDS 1076817..1077716 FT /colour=7 FT /gene="ade7" FT /gene="SPBC409.10" FT /label=SPBC409.10 FT /note="SPBC409.10, len:299, SIMILARITY:Pichia jadinii, FT PUR7_PICJA, phosphoribosylamidoimidazole- FT succinocarboxamide synthase, (301 aa), fasta scores: opt: FT 1132, E():0, (57.4% identity in 303 aa)" FT /product="putative phosphoribosylamidoimidazole- FT succinocarboxamide synthase; SAICAR synthetase; similar to FT S. cerevisiae ADE1" FT /fasta_file="fasta/c409.tab.seq.03936.out" FT misc_feature 1076856..1077644 FT /note="Match to PF01259 SAICAR_synt, SAICAR synthetase FT Score 403.26" FT CDS 1078293..1079954 FT /colour=2 FT /gene="meu18" FT /gene="SPBC409.11" FT /label=meu18 FT /note="SPBC409.11, len:553" FT /product="predicted coiled-coil; NLS (2); meiotic FT expression upregulated; no apparent orthologs" FT /fasta_file="fasta/c409.tab.seq.00058.out" FT tRNA complement(1080592..1080693) FT /note="tRNA Arg anticodon CCT, Cove score 57.05" FT intron complement(1080628..1080657) FT /note="intron tRNA Arg anticodon CCT" FT CDS complement(1081595..1082284) FT /colour=8 FT /gene="SPBC409.12c" FT /label=SPBC409.12c FT /note="SPBC409.12c, len:229" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c409.tab.seq.03938.out" FT CDS join(1085180..1085221,1085509..1085946) FT /colour=7 FT /gene="SPBC409.13" FT /label=SPBC409.13 FT /note="SPBC409.13, len:159, SIMILARITY:Saccharomyces FT cerevisiae, RIB4_YEAST, 6,7-dimethyl-8-ribityllumazine FT synthase, (169 aa), fasta scores: opt: 488, E():3.2e-27, FT (51.2% identity in 162 aa)" FT /product="putative 6,7-dimethyl-8-ribityllumazine FT synthase; DMRL synthase family; similar to S. cerevisiae FT RIB4" FT /fasta_file="fasta/c409.tab.seq.03939.out" FT misc_feature 1085222..1085227 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 1085489..1085508 FT /colour=6 FT /note="ctaatcaattttttttatag, splice branch and acceptor" FT misc_feature 1085509..1085925 FT /note="Match to PF00885 DMRL_synthase, 6,7-dimethyl-8- FT ribityllumazine synthase Score 172.05" FT CDS complement(1086631..1086903) FT /colour=7 FT /gene="SPBC409.14c" FT /label=SPBC409.14c FT /note="SPBC409.14c, len:89, SIMILARITY:Odontella sinensis., FT RR17_ODOSI, chloroplast 30s ribosomal protein s17., (84 FT aa), fasta scores: opt: 216, E():3.8e-10, (41.0% identity FT in 78 aa)" FT /product="mitochondrial ribosomal protein S17" FT /fasta_file="fasta/c409.tab.seq.03940.out" FT misc_feature complement(1086682..1086885) FT /note="Match to PF00366 Ribosomal_S17, Ribosomal protein FT S17 Score 57.38" FT CDS join(1087233..1087499,1087761..1088033) FT /colour=10 FT /gene="SPBC409.15" FT /label=SPBC409.15 FT /note="SPBC409.15, len:179, SIMILARITY:Saccharomyces FT cerevisiae, Q06672, highly acidic c-terminus., (249 aa), FT fasta scores: opt: 302, E():3.4e-13, (31.1% identity in FT 183 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YLR435W; highly acidic C terminus" FT /fasta_file="fasta/c409.tab.seq.03941.out" FT misc_feature 1087500..1087505 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1087745..1087760 FT /colour=6 FT /note="ttaacagtctatttag, splice branch and acceptor" FT CDS complement(1088386..1088748) FT /colour=9 FT /gene="SPBC409.16c" FT /label=SPBC409.16c FT /note="SPBC409.16c, len:120" FT /product="very hypothetical protein" FT /fasta_file="fasta/c409.tab.seq.03942.out" FT CDS complement(1089253..1089921) FT /colour=8 FT /gene="SPBC409.17c" FT /label=SPBC409.17c FT /note="SPBC409.17c, len:222" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c409.tab.seq.03943.out" FT CDS join(1091301..1091495,1091556..1092200) FT /colour=7 FT /gene="SPBC409.18" FT /label=SPBC409.18 FT /note="SPBC409.18, len:279, SIMILARITY:Saccharomyces FT cerevisiae, Q05521, similar to nadh-ubiquinone FT oxidoreductase chain 4., (289 aa), fasta scores: opt: 577, FT E():2.1e-32, (36.8% identity in 261 aa)" FT /product="similar to phosphatidic acid phosphatase" FT /fasta_file="fasta/c409.tab.seq.03944.out" FT misc_feature 1091496..1091501 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1091544..1091555 FT /colour=6 FT /note="ctaaccctctag, splice branch and acceptor" FT CDS complement(1092431..1093783) FT /colour=7 FT /gene="SPBC409.19c" FT /label=SPBC409.19c FT /note="SPBC409.19c, len:450, SIMILARITY:Mus musculus, FT MTXN_MOUSE, metaxin., (317 aa), fasta scores: opt: 280, FT E():1.6e-10, (30.0% identity in 287 aa)" FT /product="similar to mammalian mitochondrial outer FT membrane protein, metaxin; no apparent S. cerevisiae FT ortholog" FT /fasta_file="fasta/c409.tab.seq.00059.out" FT CDS complement(join(1094528..1095064,1095454..1095564)) FT /colour=7 FT /gene="psh3" FT /gene="SPBC409.20c" FT /label=psh3 FT /note="SPBC409.20c, len:215, LOW SIMILARITY:Saccharomyces FT cerevisiae, Q12413, chromosome iv reading frame orf FT ydl212w., (210 aa), fasta scores: opt: 237, E():1.4e-09, FT (23.6% identity in 212 aa)" FT /product="possibly required for exit of amino acid FT permeases from the endoplasmic reticulum and appearance on FT the cell surface; similar to S. cerevisiae SHR3" FT /fasta_file="fasta/c409.tab.seq.03946.out" FT misc_feature complement(1095065..1095078) FT /colour=6 FT /note="ctaatgtcatttag, splice branch and acceptor" FT misc_feature complement(1095448..1095453) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS 1096560..1097138 FT /colour=2 FT /gene="sec66" FT /gene="SPBC409.21" FT /label=sec66 FT /note="SPBC409.21, len:192, SIMILARITY:Saccharomyces FT cerevisiae, SC66_YEAST, translocation protein sec66, (206 FT aa), fasta scores: opt: 302, E():7e-14, (31.6% identity in FT 171 aa)" FT /product="putative protein translocation protein; possible FT endoplasmic reticulum; similar to S. cerevisiae SEC66" FT /fasta_file="fasta/c409.tab.seq.03947.out" FT misc_feature complement(1097830..1098303) FT /note="Match to PF00679 EFG_C, Elongation factor G C- FT terminus Score 237.73" FT misc_feature complement(1098430..1099455) FT /colour=9 FT /note="Pfam match to entry PF00009 GTP_EFTU, Elongation FT factor Tu family," FT misc_feature 1099337..1099455 FT /note="nominal overlap with cosmid SPBC1306, EM:AL133303 FT S. pombe chromosome 2" FT misc_feature 1099337..1099455 FT /note="nominal overlap with cosmid SPBC409, EM:AL109822 S. FT pombe chromosome 2" FT misc_feature complement(1099339..1099923) FT /colour=9 FT /note="Pfam match to entry PF00009 GTP_EFTU, Elongation FT factor Tu family," FT intron complement(1100072..1100279) FT /colour=7 FT /note="Intron predicted by HMM_intron, Score=10.50" FT misc_feature 1101310..1101408 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 33.63" FT misc_feature 1101445..1101531 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 26.94" FT misc_feature 1101559..1101669 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 22.29" FT misc_feature 1101789..1101794 FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature 1101824..1101841 FT /colour=6 FT /note="ctaacccaattaatttag, splice branch and acceptor" FT misc_feature 1102491..1102496 FT /colour=6 FT /note="gtgagt, splice donor sequence" FT misc_feature 1102530..1102543 FT /colour=6 FT /note="ctaacatatgctag, splice branch and acceptor" FT misc_feature 1102799..1102882 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 23.51" FT misc_feature 1103731..1103831 FT /note="nominal overlap with cosmid SPBC4, EM:AL121863 S. FT pombe chromosome 2" FT misc_feature 1103731..1103831 FT /note="nominal overlap with cosmid SPBC1306, EM:AL133303 FT S. pombe chromosome 2" FT CDS join(1104126..1104814,1104966..1105023) FT /colour=8 FT /gene="SPBC4.01" FT /label=SPBC4.01 FT /note="SPBC4.01, len:248" FT /product="hypothetical protein; sequence orphan; contains FT 4 predicted transmembrane helices; predicted N-terminal FT signal sequence" FT /fasta_file="fasta/c4.tab.seq.03884.out" FT misc_feature 1104815..1104820 FT /colour=6 FT /note="gtaatt, splice donor sequence" FT misc_feature 1104950..1104965 FT /colour=6 FT /note="ttaacacataaaacag, splice branch and acceptor" FT CDS complement(join(1105316..1106339,1106437..1106545, FT 1106786..1107023)) FT /colour=8 FT /gene="SPBC4.02c" FT /label=SPBC4.02c FT /note="SPBC4.02c, len:456" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c4.tab.seq.03885.out" FT misc_feature complement(1106340..1106352) FT /colour=6 FT /note="ttaatgtgtatag, splice branch and acceptor" FT misc_feature complement(1106431..1106436) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1106546..1106564) FT /colour=6 FT /note="ctaaccttttttttttaag, splice branch and acceptor" FT misc_feature complement(1106780..1106785) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS complement(1107836..1110511) FT /colour=7 FT /gene="SPBC4.03c" FT /label=SPBC4.03c FT /note="SPBC4.03c, len:891, SIMILARITY:Caenorhabditis FT elegans., Q19371, f12f6.6 protein., (1126 aa), fasta FT scores: opt: 1311, E():0, (32.0% identity in 827 aa)" FT /product="putative component of COPII vesicles" FT /fasta_file="fasta/c4.tab.seq.03886.out" FT CDS complement(join(1111096..1113355,1113575..1113807)) FT /colour=2 FT /gene="mcm2" FT /gene="cdc19" FT /gene="nda1" FT /gene="SPBC4.04c" FT /label=mcm2 FT /note="SPBC4.04c, len:830" FT /product="MCM complex subunit; required for the initiation FT of DNA replication" FT /fasta_file="fasta/c4.tab.seq.03887.out" FT misc_feature complement(1111159..1112706) FT /note="Match to PF00493 MCM, MCM2/3/5 family Score 1129.10" FT misc_feature complement(1113356..1113367) FT /colour=6 FT /note="ctaactgtatag, splice branch and acceptor" FT misc_feature complement(1113569..1113574) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS 1114053..1115042 FT /colour=2 FT /gene="mlo2" FT /gene="SPBC4.05" FT /label=mlo2 FT /note="SPBC4.05, len:329" FT /product="zinc finger protein; zf-UBR1 type; zf-PHD FT finger; interferes with mitotic chromosome segregation FT when overexpressed; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c4.tab.seq.03888.out" FT CDS 1115713..1117101 FT /colour=7 FT /gene="SPBC4.06" FT /label=SPBC4.06 FT /note="SPBC4.06, len:462, SIMILARITY:Drosophila FT madeirensis, O97186, acid phosphatase-1, (447 aa), fasta FT scores: opt: 265, E():3e-10, (25.8% identity in 310 aa)" FT /product="putative acid phosphatase; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c4.tab.seq.03889.out" FT misc_feature 1115797..1115838 FT /colour=9 FT /note="Pfam match to entry PF00328 acid_phosphat, FT Histidine acid phosphatase," FT misc_feature 1116670..1116786 FT /colour=9 FT /note="Pfam match to entry PF00328 acid_phosphat, FT Histidine acid phosphatase," FT CDS complement(join(1117597..1118940,1119076..1119078)) FT /colour=2 FT /gene="rpt2" FT /gene="mts2" FT /gene="SPBC4.07c" FT /label=rpt2 FT /note="SPBC4.07c, len:448" FT /product="19S proteasome regulatory subunit" FT /fasta_file="fasta/c4.tab.seq.03890.out" FT misc_feature complement(1117699..1118265) FT /note="Match to PF00004 AAA, ATPases associated with FT various cellular activities (AAA) Score 297.08" FT misc_feature complement(1118941..1118955) FT /colour=6 FT /note="ctaactctcctatag, splice branch and acceptor" FT intron complement(1118941..1119075) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1119070..1119075) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1119666..1119767 FT /note="nominal overlap with cosmid SPBC725, EM:AL034352 S. FT pombe chromosome 2" FT misc_feature 1119666..1119767 FT /note="nominal overlap with cosmid SPBC4, EM:AL121863 S. FT pombe chromosome 2" FT CDS 1120360..1121673 FT /EC_number="2.6.1.1" FT /colour=7 FT /gene="SPBC725.01" FT /label=SPBC725.01 FT /note="SPBC725.01, len:437, SIMILARITY:Bos taurus, FT AATM_BOVIN, aspartate aminotransferase, mitochondrial , FT (430 aa), fasta scores: opt: 1585, E():0, (54.1% identity FT in 429 aa)" FT /product="aspartate aminotransferase, mitochondrial" FT /fasta_file="fasta/c725.tab.seq.03389.out" FT misc_feature 1120465..1121670 FT /colour=9 FT /note="Pfam match to entry PF00155 aminotran_1, FT Aminotransf erases class-I" FT misc_feature 1120471..1121670 FT /note="Match to PF00155 aminotran_1, Aminotransferases FT class-I Score 512.53" FT CDS 1123456..1124343 FT /colour=2 FT /gene="mpr1" FT /gene="spy1" FT /gene="SPBC725.02" FT /label=mpr1 FT /note="SPBC725.02, len:295, SIMILARITY:Saccharomyces FT cerevi siae, YDL235c, Q07688, phosphorelay intermediate FT between Sl n1p and Ssk1p, (167 aa), fasta scores: opt: 273, FT E():1.9e-0 7, (39.0% identity in 118 aa)" FT /product="stress response regulator phosphotransmitter; FT respone regulator phospotransferase; similar to S. FT cerevisiae YPD1" FT /fasta_file="fasta/c725.tab.seq.03390.out" FT misc_feature 1125293..1125370 FT /note="mRNA not asssociated with an orf" FT CDS 1126739..1127512 FT /colour=10 FT /gene="SPBC725.03" FT /label=SPBC725.03 FT /note="SPBC725.03, len:257, SIMILARITY:Saccharomyces FT cerevisiae, YG1B_YEAST, hypothetical 34.7 kD protein in FT msb2-uga1 intergenic region., (297 aa), fasta scores: opt: FT 139, E():0.02, (25.2% identity in 266 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YGR017W" FT /fasta_file="fasta/c725.tab.seq.03391.out" FT CDS join(1128664..1130325,1130377..1130421) FT /colour=7 FT /gene="SPBC725.04" FT /label=SPBC725.04 FT /note="SPBC725.04, len:568, SIMILARITY:Homo sapiens, FT CAB60200, 2-hydroxyphytanoyl-coa lyase., (578 aa), fasta FT scores: opt: 1543, E():0, (44.2% identity in 577 aa)" FT /product="putative oxalyl-CoA decarboxylase" FT /fasta_file="fasta/c725.tab.seq.03392.out" FT misc_feature 1128700..1129620 FT /note="Match to PF00205 TPP_enzymes, Thiamine FT pyrophosphate enzymes Score 298.46" FT misc_feature 1129834..1130295 FT /note="Match to PF00205 TPP_enzymes, Thiamine FT pyrophosphate enzymes Score 120.61" FT intron 1130326..1130376 FT /colour=2 FT /note="confirmed intron" FT CDS complement(1130594..1132051) FT /colour=7 FT /gene="SPBC725.05c" FT /label=SPBC725.05c FT /note="SPBC725.05c, len:485, SIMILARITY:Oryza sativa, FT Q42974, nucleotide pyrophosphatase , (479 aa), fasta FT scores: opt: 865, E():0, (36.2% identity in 392 aa)" FT /product="putative nucleotide pyrophosphatase" FT /fasta_file="fasta/c725.tab.seq.03393.out" FT misc_feature complement(1130783..1131862) FT /note="Match to PF01663 Phosphodiest, Type I FT phosphodiesterase / nucleotide pyrophosphatase Score FT 384.89" FT CDS complement(1132522..1135620) FT /colour=7 FT /gene="SPBC725.06c" FT /label=SPBC725.06c FT /note="SPBC725.06c, len:1032, SIMILARITY:Saccharomyces FT cerevisiae, RI15_YEAST, serine/threonine-protein kinase FT rim15, (1770 aa), fasta scores: opt: 494, E():7.4e-20, FT (31.3% identity in 502 aa)" FT /product="putative serine/threonine protein kinase" FT /fasta_file="fasta/c725.tab.seq.03394.out" FT misc_feature complement(1132990..1133301) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 92.94" FT misc_feature complement(1133560..1134039) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 129.81" FT misc_feature complement(1133641..1133679) FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT CDS 1136718..1138514 FT /colour=2 FT /gene="pex5" FT /gene="SPBC725.07" FT /label=pex5 FT /note="SPBC725.07, len:598, SIMILARITY:Pichia angusta, FT PEX5_PICAN, peroxisomal targeting signal receptor, (569 FT aa), fasta scores: opt: 624, E():2.6e-30, (25.6% identity FT in 594 aa)" FT /product="putative peroxisomal targeting signal receptor FT similar to S. cerevisiae pex5" FT /fasta_file="fasta/c725.tab.seq.03395.out" FT misc_feature 1138038..1138124 FT /colour=9 FT /note="Pfam match to entry PF00515 TPR, TPR Domain" FT misc_feature 1138140..1138226 FT /colour=9 FT /note="Pfam match to entry PF00515 TPR, TPR Domain" FT CDS join(1139208..1139271,1139324..1139431,1139486..1139516, FT 1139588..1141214) FT /colour=10 FT /gene="SPBC725.08" FT /label=SPBC725.08 FT /note="SPBC725.08, len:609" FT /product="zinc finger protein; zf-C2H2 zinc finger protein" FT /fasta_file="fasta/c725.tab.seq.03396.out" FT misc_feature 1139272..1139277 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1139292..1139323 FT /colour=6 FT /note="ttgatagaaatactcatcctttttttgcatag, splice branch and FT acceptor" FT misc_feature 1139432..1139437 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 1139467..1139485 FT /colour=6 FT /note="ttaactacaatacgtctag, splice branch and acceptor" FT misc_feature 1139517..1139522 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1139572..1139587 FT /colour=6 FT /note="ctaacaaggagactag, splice branch and acceptor" FT misc_feature 1140810..1140881 FT /colour=8 FT /note="PS00028 zinc finger, C2H2 type, domain" FT CDS complement(join(1142059..1142805,1142848..1142895)) FT /colour=2 FT /gene="hob3" FT /gene="SPBC725.09c" FT /label=hob3 FT /note="SPBC725.09c, len:264, SIMILARITY:Saccharomyces FT cerevisiae, R161_YEAST, reduced viability upon starvation FT protein 161., (265 aa), fasta scores: opt: 1057, E():0, FT (58.3% identity in 264 aa)" FT /product="involved in cell cycle regulation; cytokinesis FT and cytoskeletal organization" FT /fasta_file="fasta/c725.tab.seq.03397.out" FT misc_feature complement(1142806..1142820) FT /colour=6 FT /note="ctaacattgtggtag, splice branch and acceptor" FT intron complement(1142806..1142847) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1142842..1142847) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS 1144673..1145161 FT /colour=7 FT /gene="SPBC725.10" FT /label=SPBC725.10 FT /note="SPBC725.10, len:162, SIMILARITY:Bos taurus, FT PKBS_BOVIN, peripheral-type benzodiazepine receptor, (169 FT aa), fasta scores: opt: 303, E():4.1e-14, (36.1% identity FT in 144 aa)" FT /product="similar to peripheral-type benzodiazepine FT receptor; predicted transmembrane; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c725.tab.seq.00040.out" FT CDS complement(1145609..1146613) FT /colour=2 FT /gene="php2" FT /gene="SPBC725.11c" FT /label=php2 FT /note="SPBC725.11c, len:334" FT /product="CCAAT-box binding factor subunit; required for FT growth on non-fermentable carbon sources; transcriptional FT activator; similar to S. cerevisiae HAP2" FT /fasta_file="fasta/c725.tab.seq.03399.out" FT misc_feature complement(1146521..1146583) FT /colour=8 FT /note="PS00686 CBF-B/NF-YA subunit signature" FT CDS join(1147461..1147575,1147625..1147797) FT /colour=8 FT /gene="SPBC725.12" FT /label=SPBC725.12 FT /note="SPBC725.12, len:95" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c725.tab.seq.03400.out" FT misc_feature 1147576..1147581 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1147607..1147624 FT /colour=6 FT /note="ttaacgggtatttttcag, splice branch and acceptor" FT CDS complement(1148175..1148726) FT /colour=10 FT /gene="SPBC725.13c" FT /label=SPBC725.13c FT /note="SPBC725.13c, len:183, SIMILARITY:Homo sapiens, FT Q9Y248, hspc037 protein., (185 aa), fasta scores: opt: 380, FT E():8.3e-19, (35.5% identity in 166 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YJL072C null lethal" FT /fasta_file="fasta/c725.tab.seq.03401.out" FT CDS 1148990..1150492 FT /EC_number="2.3.1.1" FT /colour=7 FT /gene="SPBC725.14" FT /label=SPBC725.14 FT /note="SPBC725.14, len:487, SIMILARITY:Neurospora crassa., FT Q12643, acetylglutamate synthase, (712 aa), fasta scores: FT o pt: 498, E():0, (39.2% identity in 355 aa)" FT /note="SPBC725.14, len:500, SIMILARITY:Neurospora crassa., FT Q12643, acetylglutamate synthase, (712 aa), fasta scores: FT opt: 503, E():7.2e-26, (30.9% identity in 582 aa)" FT /product="acetylglutamate synthase" FT /fasta_file="fasta/c725.tab.seq.03402.out" FT CDS 1150778..1151425 FT /EC_number="2.4.2.10" FT /colour=7 FT /gene="ura5" FT /gene="SPBC725.15" FT /label=ura5 FT /note="SPBC725.15, len:215, SIMILARITY:Yarrowia lipolytica, FT PYRE_YARLI, orotate phosphoribosyltransferase, (219 aa), FT fasta scores: opt: 676, E():0, (49.3% identity in 217 aa)" FT /product="putative orotate phosphoribosyltransferase; FT fifth step in pyrimidine synthesis pathway" FT /fasta_file="fasta/c725.tab.seq.03403.out" FT misc_feature 1150868..1151338 FT /note="Match to PF00156 Pribosyltran, Phosphoribosyl FT transferase domain Score 84.87" FT CDS join(1153034..1153259,1153387..1155074) FT /colour=2 FT /gene="res1" FT /gene="sct1" FT /gene="SPBC725.16" FT /label=res1 FT /note="SPBC725.16, len:637" FT /product="cell division cycle related-protein res1-sct1; FT partner of Cdc10p transcription factor; ankyrin repeat FT protein; yeast DNA-binding domain; regulator of mitotic FT cell cycle (positive); Mlu1-box binding factor (MBF); FT transcriptional activation complex; involved in control of FT START; similar to S. cerevisiae SWI4" FT /fasta_file="fasta/c725.tab.seq.03404.out" FT misc_feature 1153260..1153265 FT /colour=6 FT /note="gtttgt, splice donor sequence" FT intron 1153260..1153386 FT /note="confirmed intron" FT misc_feature 1153371..1153386 FT /colour=6 FT /note="ctaactattcattcag, splice branch and acceptor" FT misc_feature 1153866..1153964 FT /note="Match to PF00023 ank, Ank repeat Score 52.21" FT misc_feature 1154229..1154327 FT /note="Match to PF00023 ank, Ank repeat Score 28.36" FT CDS complement(join(1155350..1155595,1155710..1156066)) FT /colour=7 FT /gene="SPBC725.17c" FT /label=SPBC725.17c FT /note="SPBC725.17c, len:200" FT /product="putative homolog of S. cerevisiae (component of FT RNA polymerase I core transcription factor (CF) along with FT Rrn6 and Rrn7p-by low similar to RRN11 and shared FT occurance of Pfam-B_25288" FT /fasta_file="fasta/c725.tab.seq.03405.out" FT misc_feature complement(1155596..1155608) FT /colour=6 FT /note="ctaacatttacag, splice branch and acceptor" FT misc_feature complement(1155704..1155709) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1156595..1156618) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 1157490..1157614 FT /note="nominal overlap with cosmid SPBC651, EM:AL035570 S. FT pombe chromosome 2" FT misc_feature 1157490..1157614 FT /note="nominal overlap with cosmid SPBC725, EM:AL034352 S. FT pombe chromosome 2" FT misc_feature complement(1157966..1157989) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature complement(1158300..1158314) FT /colour=6 FT /note="ctaacaatttcttag, splice branch and acceptor" FT misc_feature complement(1158514..1158519) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1158615..1158630) FT /colour=6 FT /note="ctaacgaaaatattag, splice branch and acceptor" FT misc_feature complement(1158698..1158703) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1158800..1158814) FT /colour=6 FT /note="ttaacattgatgcag, splice branch and acceptor" FT misc_feature complement(1158849..1158854) FT /colour=6 FT /note="gtattt, splice donor sequence" FT CDS join(1159884..1160030,1160083..1160178,1160229..1160663, FT 1160724..1160739,1160797..1160933) FT /colour=7 FT /gene="SPBC651.02" FT /label=SPBC651.02 FT /note="SPBC651.02, len:277, SIMILARITY:Mus musculus, FT G3228668, nitrilase 1., (323 aa), fasta scores: opt: 769, FT E():0, (45.4% identity in 282 aa)" FT /product="putative nitrilase homolog" FT /fasta_file="fasta/c651.tab.seq.03771.out" FT misc_feature 1160031..1160036 FT /colour=6 FT /note="gtacga, splice donor sequence" FT misc_feature 1160063..1160082 FT /colour=6 FT /note="ctaatatctctgacatacag, splice branch and acceptor" FT misc_feature 1160179..1160184 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 1160208..1160228 FT /colour=6 FT /note="gtaacaaacttgtctttatag, splice branch and acceptor" FT misc_feature 1160664..1160669 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1160707..1160723 FT /colour=6 FT /note="ctaattaaaatttttag, splice branch and acceptor" FT misc_feature 1160740..1160745 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1160784..1160796 FT /colour=6 FT /note="ctaatgcatctag, splice branch and acceptor" FT CDS complement(1161523..1162644) FT /colour=7 FT /gene="SPBC651.03c" FT /label=SPBC651.03c FT /note="SPBC651.03c, len:374, SIMILARITY:Caenorhabditis FT elegans., E1350681, y54e2a.12 protein., (430 aa), fasta FT scores: opt: 347, E():6.9e-17, (30.0% identity in 210 aa)" FT /product="TBC domain protein; putative GTPase activating FT protein of Rab-like GTPase" FT /fasta_file="fasta/c651.tab.seq.03772.out" FT misc_feature complement(1161919..1162551) FT /colour=9 FT /note="Pfam match to entry PF00566 TBC, TBC domain" FT CDS 1164546..1165259 FT /colour=8 FT /gene="SPBC651.04" FT /label=SPBC651.04 FT /note="SPBC651.04, len:238" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c651.tab.seq.03773.out" FT CDS complement(join(1165801..1165920,1165979..1166617)) FT /colour=7 FT /gene="SPBC651.05c" FT /label=SPBC651.05c FT /note="SPBC651.05c, len:253, SIMILARITY:Caenorhabditis FT elegans., Q18258, nearly identical to c. elegans predicted FT protein f17c8.5., (365 aa), fasta scores: opt: 475, FT E():2.1e-24, (32.5% identity in 237 aa)" FT /product="putative ELL complex subunit; by similar to FT human EAP30; similar to S. cerevisiae SNF8; putative FT involved in glucose derepression" FT /fasta_file="fasta/c651.tab.seq.03774.out" FT misc_feature complement(1165921..1165937) FT /colour=6 FT /note="ctaaccaaataatttag, splice branch and acceptor" FT misc_feature complement(1165973..1165978) FT /colour=6 FT /note="gtacgc, splice donor sequence" FT CDS 1167183..1167887 FT /colour=8 FT /gene="SPBC651.06" FT /label=SPBC651.06 FT /note="SPBC651.06, len:235" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c651.tab.seq.03775.out" FT misc_feature 1167207..1167230 FT /colour=8 FT /note="PS00030 Eukaryotic putative RNA-binding region RNP- FT 1 signature" FT CDS join(1168295..1168305,1168391..1168620,1168690..1168772, FT 1168834..1169316) FT /colour=8 FT /gene="SPBC651.07" FT /label=SPBC651.07 FT /note="SPBC651.07, len:268" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c651.tab.seq.03776.out" FT misc_feature 1168306..1168311 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 1168375..1168390 FT /colour=6 FT /note="ctaactaaaattgaag, splice branch and acceptor" FT misc_feature 1168621..1168626 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 1168670..1168689 FT /colour=6 FT /note="ctaatccgtaaaccaaatag, splice branch and acceptor" FT misc_feature 1168773..1168778 FT /colour=6 FT /note="gtacgg, splice donor sequence" FT misc_feature 1168818..1168833 FT /colour=6 FT /note="ttaacgcttatactag, splice branch and acceptor" FT misc_feature 1169350..1169353 FT /note="true clone end of c31A8 S. pombe chromosome 2" FT CDS complement(join(1169782..1173975,1174026..1174049)) FT /EC_number="2.7.7.6" FT /colour=2 FT /gene="rpc1" FT /gene="SPBC651.08c" FT /label=rpc1 SPBC651.08c FT /note="SPBC651.08c, len:1406" FT /product="DNA-directed RNA polymerase III largest subunit" FT /fasta_file="fasta/c651.tab.seq.03777.out" FT misc_feature complement(1171350..1173320) FT /colour=9 FT /note="Pfam match to entry PF00623 RNA_pol_A, RNA FT polymerase alpha subunit" FT misc_feature complement(1173976..1173990) FT /colour=6 FT /note="ctaatattgtggtag, splice branch and acceptor" FT misc_feature complement(1174020..1174025) FT /colour=6 FT /note="gtatga, splice donor sequence" FT CDS complement(join(1175306..1176725,1176773..1176946, FT 1176997..1177085)) FT /colour=7 FT /gene="SPBC651.09c" FT /label=SPBC651.09c FT /note="SPBC651.09c, len:561, SIMILARITY:Homo sapiens, FT Q92541, myeloblast kiaa0252, (664 aa), fasta scores: opt: FT 639, E():7.8e-28, (27.7% identity in 548 aa), SIMILARITY: FT yeast, RTF1_YEAST RTF1 PROTEIN,(558 aa), fasta scores, FT opt:320, E(): 1.7e-10, (30.3% identity in 485 aa overlap)" FT /product="possibly important for TATA site selection; FT similar to S. cerevisiae RTF1" FT /fasta_file="fasta/c651.tab.seq.03778.out" FT misc_feature complement(1176726..1176739) FT /colour=6 FT /note="ctaaccaaataaag, splice branch and acceptor" FT misc_feature complement(1176767..1176772) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(1176947..1176965) FT /colour=6 FT /note="ctaacaaaacatattttag, splice branch and acceptor" FT misc_feature complement(1176991..1176996) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT CDS 1177602..1178768 FT /colour=8 FT /gene="SPBC651.10" FT /label=SPBC651.10 FT /note="SPBC651.10" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c651.tab.seq.03779.out" FT CDS complement(join(1178970..1179786,1179835..1180254, FT 1180299..1180339)) FT /colour=2 FT /gene="apm2" FT /gene="SPBC651.11c" FT /label=apm2 FT /note="SPBC651.11c, len:426, SIMILARITY:Rattus norvegicus, FT A471_RAT, clathrin coat assembly protein ap47 homolog 1, FT (418 aa), fasta scores: opt: 550, E():2.6e-29, (26.8% FT identity in 437 aa)" FT /product="clathrin-associated protein (AP) complex subunit" FT /fasta_file="fasta/c651.tab.seq.03780.out" FT misc_feature complement(1179068..1180321) FT /colour=9 FT /note="Pfam match to entry PF00928 Adap_comp_sub, Adaptor FT complexes medium subunit family" FT misc_feature complement(1179787..1179803) FT /colour=6 FT /note="ctaaccgcatgatttag, splice branch and acceptor" FT misc_feature complement(1179829..1179834) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1180255..1180271) FT /colour=6 FT /note="ttaatcaagttgactag, splice branch and acceptor" FT misc_feature complement(1180293..1180298) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 1181350..1182839 FT /note="nominal overlap with cosmid SPBC31A8, EM:AL035584 FT S. pombe chromosome 2" FT misc_feature complement(1182377..1182839) FT /note="see c31A8 for the complete CDS" FT CDS complement(1180718..1181539) FT /colour=8 FT /gene="SPBC651.12c" FT /label=SPBC651.12c FT /note="SPBC651.12c, len:274" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c651.tab.seq.03781.out" FT CDS complement(1182377..1183303) FT /colour=2 FT /gene="cwl1" FT /gene="SPBC31A8.01c" FT /gene="SPBC651.13c" FT /label=cwl1 FT /note="SPBC31A8.01c, len:309" FT /product="cell lysis protein; no apparent orthologs" FT /fasta_file="fasta/c31A8.tab.seq.00006.out" FT misc_feature complement(1181350..1181539) FT /note="SPBC651.12c hypothetical proteincompletely FT contained within c651." FT misc_feature 1181350..1182839 FT /note="nominal overlap with cosmid SPBC651, EM:AL035570 S. FT pombe chromosome 2" FT misc_feature 1183304..1187992 FT /note="putative gene free region; low complexity" FT misc_feature 1187793..1187992 FT /note="nominal overlap with cosmid SPBC3D6, EM:Z95620 FT S.pombe chromosome 2" FT misc_feature 1187795..1187992 FT /note="previously annotated as SPBC31A8.02, SPBC3D6.01 FT partial, but has no met" FT misc_feature 1187793..1187992 FT /note="nominal overlap with cosmid SPBC31A8, EM:AL035584 FT S. pombe chromosome 2" FT misc_feature 1187793..1188151 FT /note="previously annotated as SPBC3D6.01 SPBC31A8.02 very FT hypothetical proteinbut has no met" FT misc_feature 1187793..1189432 FT /note="putative gene free region" FT CDS 1189447..1190619 FT /colour=12 FT /gene="SPBC3D6.02" FT /label=SPBC3D6.02 FT /note="SPBC3D6.02, len:390, SIMILARITY:Schizosaccharomyces FT pombe, O42663, hypothetical 39.7 kD protein., (383 aa), FT fas ta scores: opt: 301, E():9.8e-13, (22.7% identity in FT 396 aa )" FT /product="hypothetical protein; possibly S. pombe FT specific; Pfam-B_10631; predicted N-terminal signal FT sequence" FT /fasta_file="fasta/c3D6.tab.seq.02995.out" FT CDS complement(1191677..1193713) FT /colour=10 FT /gene="SPBC3D6.03c" FT /label=SPBC3D6.03c FT /note="SPBC3D6.03c, len:678, FT SIMILARITY:Schizosaccharomyces pombe, YATA_SCHPO, FT hypothetical protein, (809 aa), fasta scores: opt: 280, FT E():1.8e- 10, (32.0% identity in 494 aa)" FT /product="Metallo-beta-lactamase family protein; conserved FT in eukaryotes" FT /fasta_file="fasta/c3D6.tab.seq.02996.out" FT misc_feature complement(1192031..1192060) FT /colour=8 FT /note="PS00152 ATP synthase alpha and beta subunits FT signatu re" FT misc_feature complement(1193420..1193443) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS join(1193949..1193951,1194002..1194242,1194347..1194369) FT /colour=2 FT /gene="rps25-1" FT /gene="SPBC3D6.15" FT /label=rps25 FT /note="SPBC3D6.15, len:92" FT /product="40S ribosomal protein S25" FT /fasta_file="fasta/c3D6.tab.seq.02997.out" FT misc_feature 1193952..1193957 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1193984..1194001 FT /colour=6 FT /note="ctaattccatattattag, splice branch and acceptor FT seque nce" FT intron 1194243..1194346 FT /note="confirmed" FT CDS complement(join(1194678..1196596,1196647..1196797)) FT /colour=7 FT /gene="SPBC3D6.04c" FT /label=SPBC3D6.04c FT /note="SPBC3D6.04c, len:689, SIMILARITY:Saccharomyces FT cerev isiae, MAD1_YEAST, spindle assembly checkpoint FT component mad1, (749 aa), fasta scores: opt: 454, E():1.1e- FT 16, (23.4% i dentity in 710 aa)" FT /product="predicted coiled-coil protein; possibly involved FT in spindle-assembly checkpoint; similar to S. cerevisiae FT MAD1" FT /fasta_file="fasta/c3D6.tab.seq.02998.out" FT misc_feature complement(1196597..1196610) FT /colour=6 FT /note="ctgacaccctgtag, splice branch and acceptor sequence" FT misc_feature complement(1196641..1196646) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS join(1198057..1198132,1198170..1198408,1198731..1199072) FT /colour=10 FT /gene="SPBC3D6.05" FT /label=SPBC3D6.05 FT /note="SPBC3D6.05, len:218, SIMILARITY:Saccharomyces FT cerevisiae, Q12382, chromosome xv reading frame orf FT yor311c., (29 0 aa), fasta scores: opt: 509, E():8.8e-29, FT (41.2% identity in 216 aa)" FT /product="conserved protein; similar to S. cerevisiae FT YOR311C; contains DUF56" FT /fasta_file="fasta/c3D6.tab.seq.02999.out" FT misc_feature 1198133..1198138 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1198156..1198169 FT /colour=6 FT /note="ttaaccgggtctag, splice branch and acceptor sequence" FT misc_feature 1198409..1198414 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1198717..1198730 FT /colour=6 FT /note="ctaactaagttcag, splice branch and acceptor sequence" FT CDS complement(join(1199601..1200519,1200942..1201048)) FT /EC_number="2.7.6.1" FT /colour=7 FT /gene="SPBC3D6.06c" FT /label=SPBC3D6.06c FT /note="SPBC3D6.06c, len:341, SIMILARITY:Homo sapiens, FT KPR3_ HUMAN, ribose-phosphate pyrophosphokinase iii, (317 FT aa), fa sta scores: opt: 730, E():0, (49.6% identity in FT 337 aa)" FT /product="putative ribose-phosphate pyrophosphokinase" FT /fasta_file="fasta/c3D6.tab.seq.03000.out" FT misc_feature complement(1199874..1199912) FT /colour=8 FT /note="PS00103 Purine/pyrimidine phosphoribosyl FT transferase s signature" FT misc_feature complement(1200047..1200646) FT /colour=9 FT /note="Pfam match to entry PF00492 PRPP_synt, FT Phosphoribosy l pyrophosphate synthetase" FT misc_feature complement(1200520..1200539) FT /colour=6 FT /note="ttaacgtgtatttattgcag, splice branch and acceptor FT seq uence" FT misc_feature complement(1200758..1201039) FT /colour=9 FT /note="Pfam match to entry PF00492 PRPP_synt, FT Phosphoribosy l pyrophosphate synthetase" FT misc_feature complement(1200936..1200941) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT CDS join(1202453..1202549,1202610..1202689,1202745..1203022, FT 1203066..1203181,1203225..1204024) FT /colour=7 FT /gene="SPBC3D6.07" FT /label=SPBC3D6.07 FT /note="SPBC3D6.07, len:456, SIMILARITY:Mus musculus, FT Q64323 , phosphatidylinositol glycan, class a, (485 aa), FT fasta sco res: opt: 1497, E():0, (52.7% identity in 421 FT aa)" FT /product="n-acetylglucosaminyl-phosphatidylinositol" FT /fasta_file="fasta/c3D6.tab.seq.03001.out" FT misc_feature 1202550..1202555 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 1202591..1202609 FT /colour=6 FT /note="ctaacatgcattatattag, splice branch and acceptor FT sequ ence" FT misc_feature 1202690..1202695 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1202732..1202744 FT /colour=6 FT /note="ctaaacaatgcag, splice branch and acceptor sequence" FT misc_feature 1202972..1203496 FT /colour=9 FT /note="Pfam match to entry PF00534 Glycos_transf_1, FT Glycosy l transferases group 1" FT misc_feature 1203023..1203028 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1203054..1203065 FT /colour=6 FT /note="ttaactaagaag, , splice branch and acceptor sequence" FT misc_feature 1203182..1203187 FT /colour=6 FT /note="gtgagt, splice donor sequence" FT misc_feature 1203212..1203224 FT /colour=6 FT /note="ctaacatttttag, splice branch and acceptor sequence" FT CDS complement(join(1204188..1204361,1204439..1204554, FT 1204603..1204671,1204720..1204783)) FT /colour=7 FT /gene="SPBC3D6.08c" FT /label=SPBC3D6.08c FT /note="SPBC3D6.08c, len:140, SIMILARITY:Saccharomyces FT cerev isiae, YJM4_YEAST, hypothetical 20.3 kD protein in FT gcd14-po s18 intergenic region., (172 aa), fasta scores: FT opt: 393, E ():2.6e-19, (45.5% identity in 134 aa)" FT /product="small nucear ribonucleoprotein (Sm protein); RNA- FT binding; possibly involved in control of mRNA decay; FT similar to S. cerevisiae LSM1" FT /fasta_file="fasta/c3D6.tab.seq.03002.out" FT misc_feature complement(1204362..1204378) FT /colour=6 FT /note="ctaaatatttcgaaaag, splice branch and acceptor FT sequen ce" FT misc_feature complement(1204433..1204438) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1204555..1204566) FT /colour=6 FT /note="ctaactgtgtag, splice branch and acceptor sequence" FT misc_feature complement(1204597..1204602) FT /colour=6 FT /note="gtatgg, splice donor sequence" FT misc_feature complement(1204672..1204688) FT /colour=6 FT /note="ctaactttaccttttag, splice branch and acceptor FT sequen ce" FT misc_feature complement(1204714..1204719) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS join(1205842..1206014,1206147..1206265,1206304..1206644) FT /colour=2 FT /gene="dbp4" FT /gene="SPBC3D6.09" FT /label=dbp4 FT /note="SPBC3D6.09, len:210, SIMILARITY:Saccharomyces FT cerevisiae, Q04603, hypothetical protein., (196 aa), fast FT a scores: opt: 210, E():1.8e-05, (29.8% identity in 181 FT aa)" FT /product="DNA polymerase epsilon fourth subunit; similar FT to S. cerevisiae DPB4" FT /fasta_file="fasta/c3D6.tab.seq.03003.out" FT misc_feature 1206015..1206020 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1206133..1206146 FT /colour=6 FT /note="ctaacgttacttag, splice branch and acceptor sequence" FT misc_feature 1206266..1206271 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1206291..1206303 FT /colour=6 FT /note="ctaactattaaag, splice branch and acceptor sequence" FT misc_feature 1207105..1208013 FT /colour=9 FT /note="Pfam match to entry PF01260 AP_endonulease1, AP FT endo nucleases family 1" FT CDS join(1207105..1207897,1207935..1208713) FT /EC_number="4.2.99.18" FT /colour=7 FT /gene="SPBC3D6.10" FT /label=SPBC3D6.10 FT /note="SPBC3D6.10, len:523, SIMILARITY:Mus musculus, FT APE1_MOUSE, DNA-(apurinic or apyrimidinic site) lyase, FT (316 aa), fasta scores: opt: 310, E():3.4e-12, (29.7% FT identity in 306 aa)" FT /product="DNA-(apurinic or apyrimidinic site) lyase" FT /fasta_file="fasta/c3D6.tab.seq.03004.out" FT misc_feature 1207207..1207236 FT /colour=8 FT /note="PS00726 AP endonucleases family 1 signature 1" FT misc_feature 1207898..1207903 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1207913..1207934 FT /colour=6 FT /note="ttattttttttacaatggatag, splice branch and acceptor FT s equence" FT CDS complement(1208850..1209659) FT /colour=10 FT /gene="SPBC3D6.11c" FT /label=SPBC3D6.11c FT /note="SPBC3D6.11c, len:269, SIMILARITY: low to FT Caenorhabditis elegans., YQ57_CAEEL, hypothetical 24.9 kD FT protein c16c10.7 in chromosome iii., (235 aa), fasta FT scores: opt: 186, E():0.00023, (35.6% identity in 73 aa)" FT /product="zinc finger protein; zf-C3HC4 type (RING FT finger); similar to S. cerevisiae YER116C" FT /fasta_file="fasta/c3D6.tab.seq.03005.out" FT misc_feature complement(1208922..1209044) FT /colour=9 FT /note="Pfam match to entry PF00097 zf-C3HC4, zinc finger, FT C 3HC4 type (RING finger)" FT misc_feature complement(1208970..1208999) FT /colour=8 FT /note="PS00518 zinc finger, C3HC4 type, signature" FT CDS 1210263..1213031 FT /colour=7 FT /gene="SPBC3D6.12" FT /label=SPBC3D6.12 FT /note="SPBC3D6.12, len:922, SIMILARITY:Saccharomyces FT cerevisiae, DIP2_YEAST, dom34 interacting protein 2.dom34 FT interacting protein 2., (943 aa), fasta scores: opt: 1617, FT E():0, (41.2% identity in 985 aa)" FT /product="WD repeat protein; similar to S. cerevisiae DIP2- FT dom54 interacting protein (possibly involved in FT translation)" FT /fasta_file="fasta/c3D6.tab.seq.03006.out" FT misc_feature 1210542..1210658 FT /colour=9 FT /note="Pfam match to entry PF00400 G-beta, WD domain, G- FT bet a repeat" FT misc_feature 1210617..1210661 FT /colour=8 FT /note="PS00678 Beta-transducin family Trp-Asp repeats FT signa ture" FT misc_feature 1210824..1210868 FT /colour=8 FT /note="PS00678 Beta-transducin family Trp-Asp repeats FT signa ture" FT misc_feature 1210875..1210991 FT /colour=9 FT /note="Pfam match to entry PF00400 G-beta, WD domain, G- FT bet a repeat" FT misc_feature 1211418..1211531 FT /colour=9 FT /note="Pfam match to entry PF00400 G-beta, WD domain, G- FT bet a repeat" FT misc_feature 1211661..1211777 FT /colour=9 FT /note="Pfam match to entry PF00400 G-beta, WD domain, G- FT bet a repeat" FT misc_feature 1211958..1212074 FT /colour=9 FT /note="Pfam match to entry PF00400 G-beta, WD domain, G- FT bet a repeat" FT misc_feature 1212084..1212200 FT /colour=9 FT /note="Pfam match to entry PF00400 G-beta, WD domain, G- FT bet a repeat" FT misc_feature 1212210..1212320 FT /colour=9 FT /note="Pfam match to entry PF00400 G-beta, WD domain, G- FT bet a repeat" FT CDS complement(1213401..1215581) FT /colour=7 FT /gene="SPBC3D6.13c" FT /label=SPBC3D6.13c FT /note="SPBC3D6.13c, len:726, FT SIMILARITY:Schizosaccharomyces pombe, O74481, hypothetical FT 64.7 kD protein., (561 aa), fa sta scores: opt: 317, FT E():6.7e-11, (22.9% identity in 498 a a)" FT /product="putative thioredoxin" FT /fasta_file="fasta/c3D6.tab.seq.03007.out" FT misc_feature complement(1214427..1214612) FT /colour=9 FT /note="Pfam match to entry PF00085 thiored, Thioredoxin" FT misc_feature complement(1215177..1215497) FT /colour=9 FT /note="Pfam match to entry PF00085 thiored, Thioredoxin, FT sc ore 32.40, E-value 1.9e-08" FT misc_feature 1219191..1220121 FT /note="nominal overlap with cosmid SPBC30B4, EM:AL031262 FT S. pombe chromosome 2" FT misc_feature 1219191..1220121 FT /note="nominal overlap with S. pombe chromosome 2 cosmid FT SP BC3D6" FT misc_feature complement(1219413..1219448) FT /colour=8 FT /note="PS01186 EGF-like domain signature 2" FT CDS complement(1221640..1223727) FT /colour=10 FT /gene="SPBC30B4.02c" FT /label=SPBC30B4.02c FT /note="SPBC30B4.02c, len:695, SIMILARITY:Saccharomyces FT cerevisiae, YNW4_YEAST, hypothetical 86.9 kD protein, (767 FT aa), fasta scores: opt: 292, E():2.2e-08, (22.3% identity FT in 663 aa)" FT /product=" R3H and G-patch domain; similar to S. FT cerevisiae YNL224C" FT /fasta_file="fasta/c30B4.tab.seq.02587.out" FT misc_feature complement(1221643..1221774) FT /note="Match to G-patch , Score 42.94" FT misc_feature complement(1221982..1222137) FT /note="Match to R3H , Score 73.55" FT CDS complement(1224520..1225695) FT /colour=10 FT /gene="SPBC30B4.03c" FT /label=SPBC30B4.03c FT /note="SPBC30B4.03c, len:391, SIMILARITY:Arabidopsis FT thaliana, O65609, hypothetical 83.3 kD protein., (748 aa), FT fasta scores: opt: 218, E():8.5e-06, (22.5% identity in FT 404 aa)" FT /product="hypothetical protein; Pfam-B_10162 domain; no FT apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c30B4.tab.seq.02588.out" FT misc_feature 1228318 FT /note="dicrepancy: with published U14 small nuclear RNA FT gen e and with cosmid c1268 sequence - additional T FT residue ins ertion at base 9128" FT snRNA 1228333..1228444 FT CDS complement(1228826..1231423) FT /colour=7 FT /gene="SPBC30B4.04c" FT /label=SPBC30B4.04c FT /note="SPBC30B4.04c, len:865, SIMILARITY:Saccharomyces FT cerevisiae, ADR6_YEAST, transcription regulatory protein FT adr6, (1314 aa), fasta scores: opt: 305, E():8e-08, (22.9% FT identity in 687 aa)" FT /product="putative transcriptional regulatory protein; FT contains ARID DNA-binding domain" FT /fasta_file="fasta/c30B4.tab.seq.02589.out" FT misc_feature complement(1230572..1230850) FT /note="Match to ARID , Score 60.66" FT CDS join(1232930..1232987,1233037..1235882) FT /colour=7 FT /gene="SPBC30B4.05" FT /label=SPBC30B4.05 FT /note="SPBC30B4.05, len:967, SIMILARITY:Saccharomyces FT cerevisiae, CSE1_YEAST, chromosome segregation protein FT cse1., (960 aa), fasta scores: opt: 2308, E():0, (41.3% FT identity in 971 aa)" FT /product="putative Karyopherin-beta involved in the FT nuclear export of karyopherin-alpha, putative kinetochore FT interacts with centromeric element CDEII; putative FT chromosomal segregation/apoptosis susceptibility protein- FT by similar to S. cerevisiae CSE1; subcellular localization FT of GFP fusion- Nuclear rim and nucleus" FT /fasta_file="fasta/c30B4.tab.seq.02590.out" FT misc_feature 1232988..1232993 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 1233024..1233036 FT /colour=6 FT /note="ctaactgatatag, splice branch and acceptor" FT CDS complement(1236075..1238075) FT /colour=7 FT /gene="SPBC30B4.06c" FT /label=SPBC30B4.06c FT /note="SPBC30B4.06c, len:666, SIMILARITY:Saccharomyces FT cerevisiae, YGY6_YEAST, hypothetical 75.4 kD protein in FT hap2-ade5,6 intergenic region., (679 aa), fasta scores: FT opt: 1934, E():0, (48.0% identity in 635 aa)" FT /product="Strong similar to Glucose inhibited division FT protein a" FT /fasta_file="fasta/c30B4.tab.seq.02591.out" FT misc_feature complement(1236174..1238021) FT /note="Match to GIDA , Score 926.05" FT misc_feature complement(1236849..1236920) FT /colour=8 FT /note="PS01281 Glucose inhibited division protein A family FT signature 2" FT misc_feature complement(1237164..1237208) FT /colour=8 FT /note="PS01280 Glucose inhibited division protein A family FT signature 1" FT CDS complement(join(1239237..1239319,1239382..1240192)) FT /colour=7 FT /gene="SPBC30B4.07c" FT /label=SPBC30B4.07c FT /note="SPBC30B4.07c, len:297, SIMILARITY:Homo sapiens, FT Q13889, basic transcription factor 2, 35 kD subunit., (303 FT aa), fasta scores: opt: 551, E():1.7e-28, (37.4% identity FT in 286 aa)" FT /product="putative transcription initiation factor TFIIH FT subunit" FT /fasta_file="fasta/c30B4.tab.seq.02592.out" FT misc_feature complement(1239320..1239332) FT /colour=6 FT /note="ctaacctctttag, splice branch and acceptor" FT misc_feature complement(1239376..1239381) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS join(1240391..1240518,1240765..1241170,1241233..1241532) FT /colour=7 FT /gene="SPBC30B4.08" FT /label=SPBC30B4.08 FT /note="SPBC30B4.08, len:277, SIMILARITY:Caenorhabditis FT elegans., O44406, t07a9.5 protein., (448 aa), fasta FT scores: opt: 271, E():6.1e-11, (33.3% identity in 216 aa)" FT /product="KapD family exonuclease" FT /fasta_file="fasta/c30B4.tab.seq.02593.out" FT misc_feature 1240519..1240524 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1240741..1240764 FT /colour=6 FT /note="ctaacagtaactgaatacttgtag, splice branch and FT acceptor" FT misc_feature 1241171..1241176 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1241213..1241232 FT /colour=6 FT /note="ctaacaaatcgtattatcag, splice branch and acceptor" FT misc_feature complement(1241742..1241758) FT /colour=6 FT /note="ctaactaattcccacag, splice branch and acceptor" FT misc_feature complement(1241780..1241785) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1241914..1244472 FT /note="nominal overlap with SPBC27B12 EM:AL021766 S. pombe FT chromosome 2" FT misc_feature complement(1241995..1242010) FT /colour=6 FT /note="ctaacatttgtcctag, splice branch and acceptor" FT misc_feature complement(1242128..1242133) FT /colour=6 FT /note="gtatat, splice donor sequence" FT conflict 1242966..1242977 FT /citation=[1] FT /note="12 Ts in SPBC27B12 and SPAB4539, but only 11 in FT SPAC30B4, we have altered c30B4 to agree with the FT consensus to allow contiguation" FT misc_feature 1243439..1243768 FT /note="CDS SPBC27B12.02 completely contained in c27B12" FT misc_feature complement(1244174..1244472) FT /note="see SPBC27B12.03C for complete CDS" FT CDS complement(1244174..1245163) FT /colour=7 FT /gene="SPBC27B12.03c" FT /label=SPBC27B12.03c FT /note="SPBC27B12.03c, putative c-5 sterol desaturase, FT len:329aa, similar eg. to YLR056W, ERG3_YEAST, P32353, c-5 FT sterol desaturase, (365aa), fasta scores, opt:886, E():0, FT (41.0% identity in 366 aa overlap)" FT /product="putative C-5 sterol desaturase; putatively FT involved in ergosterol biosynthesis; similar to S. FT cerevisiae ERG3" FT /fasta_file="fasta/c27B12.tab.seq.02666.out" FT misc_feature 1241914..1244472 FT /note="nominal overlap with cosmid SPBC30B4, EM:AL031262 FT S.pombe chromosome 2" FT misc_feature complement(1241995..1242010) FT /colour=6 FT /note="ctaacatttgtcctag, splice branch and acceptor" FT misc_feature complement(1242053..1242058) FT /colour=6 FT /note="gtattc, splice donor sequence" FT conflict 1242966..1242977 FT /citation=[1] FT /note="12 Ts in SPBC27B12 and SPAB4539, but only 11 in FT SPAC30B4, we have altered c30B4 to agree with the FT consensus to allow contiguation" FT CDS complement(1245838..1248291) FT /colour=10 FT /gene="SPBC27B12.04c" FT /label=SPBC27B12.04c FT /note="SPBC27B12.04c, len:817aa, identical to TR:D 1022302, FT (817aa), low similarity eg. to YNL127W, TR:E328838 , orf FT fragment, (928aa), fasta scores, opt:291, E():2.5e-16 , FT (20.7% identity in 764 aa overlap)" FT /product="hypothetical protein; similar to S. cerevisiae FT YNL127W" FT /fasta_file="fasta/c27B12.tab.seq.02667.out" FT CDS join(1248903..1249114,1249157..1249254,1249296..1249419, FT 1249464..1249683,1249738..1250166,1250214..1250306) FT /colour=10 FT /gene="SPBC27B12.05" FT /label=SPBC27B12.05 FT /note="SPBC27B12.05, len:391aa, identical to (except we FT predict additional C terminal exon), D1022301, (373aa ), FT Pfam match to entry G-beta PF00400, WD domain, G-beta FT repeats" FT /product="WD repeat protein" FT /fasta_file="fasta/c27B12.tab.seq.02668.out" FT misc_feature 1249115..1249120 FT /colour=6 FT /note="gtacgc, splice donor sequence" FT misc_feature 1249142..1249156 FT /colour=6 FT /note="ctaattgtaattcag, splice branch and acceptor" FT misc_feature 1249191..1249289 FT /colour=9 FT /note="Pfam match to entry G-beta PF00400, WD domain, G- FT bet a repeats" FT misc_feature 1249255..1249260 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 1249283..1249295 FT /colour=6 FT /note="ctaatgattttag, splice branch and acceptor" FT misc_feature 1249331..1249375 FT /colour=8 FT /note="PS00678 Beta-transducin family Trp-Asp repeats FT signa ture" FT misc_feature 1249420..1249425 FT /colour=6 FT /note="gtaata, splice donor sequence" FT misc_feature 1249452..1249463 FT /colour=6 FT /note="ctaattactaactttctag, splice branch and acceptor" FT misc_feature 1249684..1249689 FT /colour=6 FT /note="gtaagg, splice donor sequence" FT misc_feature 1249725..1249737 FT /colour=6 FT /note="ttaacatacttag, splice branch and acceptor" FT misc_feature 1250167..1250172 FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature 1250195..1250213 FT /colour=6 FT /note="ctaactggtgatttcacag, splice branch and acceptor" FT CDS 1250765..1253521 FT /colour=7 FT /gene="SPBC27B12.06" FT /label=SPBC27B12.06 FT /note="SPBC27B12.06, len:918aa, identical to TR:D1 022300, FT (918aa), similar eg. to S. cerevisiae, YLL031C, Q07 830, FT orf, (1017aa), fasta scores, opt:891, E():0, (33.6% id FT entity in 1003 aa overlap)" FT /product="possibly involved in FT glycosylphosphatidylinositol biosynthesis;probably FT responsible for adding phosphoethanolamine to the third FT mannose; similar to S. cerevisiae GPI13" FT /fasta_file="fasta/c27B12.tab.seq.02669.out" FT CDS join(1253811..1254194,1254306..1254630,1254698..1254861) FT /colour=10 FT /gene="SPBC27B12.07" FT /label=SPBC27B12.07 FT /note="SPBC27B12.07, len:290aa, identical to (except we FT predict additional C terminal exon) TR:D1022299, (244 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YLR283W (low)" FT /fasta_file="fasta/c27B12.tab.seq.02670.out" FT misc_feature 1254195..1254200 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 1254293..1254305 FT /colour=6 FT /note="ctaacttgtatag, splice branch and acceptor" FT misc_feature 1254631..1254636 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1254676..1254697 FT /colour=6 FT /note="ttaatttccttttctttttcag, splice branch and acceptor" FT CDS join(1255423..1255669,1255714..1255792,1255831..1255879, FT 1255929..1259381,1259422..1260637,1260682..1260841, FT 1260886..1261036,1261076..1261277,1261318..1261520) FT /colour=10 FT /gene="SPBC27B12.08" FT /label=SPBC27B12.08 FT /note="SPBC27B12.08, unknown, len:1919aa, identical to FT (except we predict 3 additional N-terminal exons which FT extend the homology with TR:O01485) D1022298, (1807aa), FT similar eg. to C. elegans TR:O01485, unknown, (2076aa), FT fasta scores, opt:275, E():8.8e-32, (19.1% identity in FT 1862 aa overlap), also similar eg. to YJL207C, YJU7_YEAST, FT P39526, hypothetic al 229.9 kD protein, (2014aa), fasta FT scores,opt:347, E():1. 2e-22, (21.2% identity in 1597 aa FT overlap)" FT /product="hypothetical protein; similar to S. cerevisiae FT YJL207C" FT /fasta_file="fasta/c27B12.tab.seq.02671.out" FT misc_feature 1255670..1255675 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1255700..1255713 FT /colour=6 FT /note="ttaacaagtattag, splice branch and acceptor" FT misc_feature 1255793..1255798 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1255820..1255830 FT /colour=6 FT /note="ctaaccggtag, splice branch and acceptor" FT misc_feature 1255880..1255885 FT /colour=6 FT /note="gtatta, splice donor sequence" FT misc_feature 1255916..1255928 FT /colour=6 FT /note="ttaaccttaatag, splice branch and acceptor" FT misc_feature 1259382..1259387 FT /colour=6 FT /note="gtaagg, splice donor sequence" FT misc_feature 1259407..1259421 FT /colour=6 FT /note="ctaacaattttttag, splice branch and acceptor" FT misc_feature 1260638..1260643 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1260670..1260681 FT /colour=6 FT /note="ctaactgtctag, splice branch and acceptor" FT misc_feature 1260842..1260847 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1260871..1260885 FT /colour=6 FT /note="ctaaccttaaaaaag, splice branch and acceptor" FT misc_feature 1261037..1261042 FT /colour=6 FT /note="gtttgt, splice donor sequence" FT misc_feature 1261065..1261075 FT /colour=6 FT /note="ttaacatatag, splice branch and acceptor" FT misc_feature 1261278..1261283 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1261307..1261317 FT /colour=6 FT /note="ctaacttttag, splice branch and acceptor" FT CDS complement(1261742..1262575) FT /colour=7 FT /gene="SPBC27B12.09c" FT /label=SPBC27B12.09c FT /note="SPBC27B12.09c, len:277aa, similar eg. to YIL134W, FT FLX1_YEAST, P40464, mitochondrial FAD carrier protein flx1, FT (311aa), fasta scores, opt:224, E():4.2e-31 , (33.8% FT identity in 296 aa overlap), Pfam match to entry mito_carr FT PF00153, Mitochondrial carrier proteins" FT /product="MC FAD transporter; putative flavin adenine FT dinucleotide transporter; similar to S. cerevisiae FLX1" FT /fasta_file="fasta/c27B12.tab.seq.02672.out" FT misc_feature complement(1261781..1262569) FT /note="Match to PF00153 mito_carr, Mitochondrial carrier FT proteins Score 208.12" FT CDS complement(join(1263731..1263856,1263913..1263936)) FT /colour=7 FT /gene="SPBC27B12.10c" FT /label=SPBC27B12.10c FT /note="SPBC27B12.10c, putative mitochondrial import FT receptor subunit, len:49aa, similar eg. to YNL070W, FT OM07_YEAST, P5 3507, mitochondrial import receptor subunit, FT (59aa), fasta scores, opt:140, E():1.1e-08, (52.9% FT identity in 34 aa over lap)" FT /product="putative mitochondrial import receptor subunit; FT similar to S. cerevisiae TOM7" FT /fasta_file="fasta/c27B12.tab.seq.02673.out" FT misc_feature complement(1263857..1263870) FT /colour=6 FT /note="ctaatttcttttag, splice branch and acceptor" FT misc_feature complement(1263907..1263912) FT /colour=6 FT /note="gtattg, splice donor sequence" FT CDS complement(1264948..1267164) FT /colour=10 FT /gene="SPBC27B12.11c" FT /label=SPBC27B12.11c FT /note="SPBC27B12.11c, len:738aa, identical to TR:D 1022295, FT (738aa), contains PFAM fungal Zn(2)-Cys(6) binuclear FT cluster domain" FT /product="putative transcriptional regulator; zinc finger FT protein; fungal Zn(2)-Cys(6) binuclear cluster domain" FT /fasta_file="fasta/c27B12.tab.seq.02674.out" FT misc_feature complement(1266187..1266297) FT /note="Match to PF00172 Zn_clus, fungal Zn(2)-Cys(6) FT binuclear cluster domain Score 39.21" FT misc_feature complement(1267860..1276943) FT /note="nominal overlap with cosmid SPAB4538, EM:AB004538 FT S. pombe chromosome 2" FT CDS join(1268079..1268115,1268203..1268321,1268500..1268562) FT /colour=7 FT /gene="SPBC27B12.14" FT /label=SPBC27B12.14 FT /note="SPBC27B12.14, len:72" FT /product="putative ubiquinol cytochrome c reductase FT assembly factor; similar to S. cerevisiae CBP4" FT /fasta_file="fasta/c27B12.tab.seq.02675.out" FT misc_feature 1268116..1268121 FT /colour=6 FT /note="gtatgg, splice donor sequence" FT misc_feature 1268183..1268202 FT /colour=6 FT /note="cttaccagtatataaaatag, splice branch and acceptor" FT misc_feature 1268322..1268327 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1268486..1268499 FT /colour=6 FT /note="ctgactttgagtag, splice branch and acceptor" FT CDS complement(1271030..1273441) FT /colour=7 FT /gene="SPBC27B12.12c" FT /label=SPBC27B12.12c FT /note="SPBC27B12.12c, len:803aa, identical to TR:D1022293, FT (803aa), similar eg. to YOL130W, ALR1_YEAST, Q08269, FT aluminium resistance protein 1, (859aa ), fasta scores, FT opt:1007, E():0, (37.2% identity in 817 aa overlap)" FT /product="MIT family metal ion transporter; putative FT inorganic cation transporter; similar to S. cerevisiae FT ALR1" FT /fasta_file="fasta/c27B12.tab.seq.02676.out" FT misc_feature 1276871..1276943 FT /note="nominal overlap with cosmid SPBC27B12 S. pombe FT chromosome 2" FT misc_feature 1277008..1277101 FT /note="nominal overlap with comsid SPBC8D2 S. pombe FT chromosome 2" FT misc_feature 1277008..1277101 FT /note="nominal overlap with c568" FT LTR complement(1277679..1277827) FT /note="degraded TF2-type LTR" FT CDS join(1278391..1278397,1278443..1278624,1279182..1280138) FT /colour=7 FT /gene="SPBC8D2.01" FT /gene="pI064" FT /label=SPBC8D2.01 FT /note="SPBC8D2.01, len:381, SIMILARITY:Schizosaccharomyces FT pombe, O94456, protein kinase skp1p., (387 aa), fasta FT scores: opt: 1522, E():0, (56.3% identity in 378 aa)" FT /product="putative serine/threonine protein kinase" FT /fasta_file="fasta/c8D2.tab.seq.00027.out" FT misc_feature 1278398..1278403 FT /colour=6 FT /note="gtaaat, splice donor sequence" FT intron 1278398..1278442 FT /note="intron confirmed by EST" FT misc_feature 1278429..1278442 FT /colour=6 FT /note="ctaacgatgaatag, splice branch and acceptor" FT misc_feature 1278520..1278624 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 21.98" FT misc_feature 1278526..1278597 FT /colour=8 FT /note="PS00107 protein kinases ATP-binding region FT signature" FT misc_feature 1278625..1278630 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT intron 1278625..1279181 FT /note="intron confirmed by EST" FT misc_feature 1279167..1279181 FT /colour=6 FT /note="ctaacctagttatag, splice branch and acceptor" FT misc_feature 1279182..1279919 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 262.06" FT misc_feature 1279428..1279466 FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT CDS complement(join(1280915..1281209,1281363..1281487, FT 1281543..1281635)) FT /colour=10 FT /gene="SPBC8D2.02c" FT /label=SPBC8D2.02c FT /note="SPBC8D2.02c, len:170, SIMILARITY:Saccharomyces FT cerevisiae, Q12016, chromosome xv reading frame orf FT yol129w., (184 aa), fasta scores: opt: 276, E():1.3e-12, FT (45.5% identity in 178 aa)" FT /product="conserved protein; contains 3 predicted FT transmembrane helices; predicted N-terminal signal FT sequence; similar to S. cerevisiae YOL129W" FT /fasta_file="fasta/c8D2.tab.seq.00028.out" FT misc_feature complement(1281210..1281224) FT /colour=6 FT /note="ctaacctgattttag, splice branch and acceptor" FT misc_feature complement(1281357..1281362) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1281488..1281500) FT /colour=6 FT /note="ctgacatttatag, splice branch and acceptor" FT misc_feature complement(1281537..1281542) FT /colour=6 FT /note="gtaaat, splice donor sequence" FT CDS complement(1284211..1284522) FT /colour=2 FT /gene="h4.2" FT /gene="hhf2" FT /gene="SPBC8D2.03c" FT /label=h4.2 FT /note="SPBC8D2.03c, len:103" FT /product="histone h4" FT /fasta_file="fasta/c8D2.tab.seq.00029.out" FT misc_feature complement(1284235..1284519) FT /colour=9 FT /note="Pfam match to entry histone PF00125, Core histones FT H 2A, H2B, H3 and H4" FT misc_feature complement(1284466..1284480) FT /colour=8 FT /note="PS00047 Histone H4 signature" FT CDS 1284857..1285267 FT /colour=2 FT /gene="h3.2" FT /gene="hht2" FT /gene="SPBC8D2.04" FT /label=h3.2 FT /note="SPBC8D2.04, len:136" FT /product="histone h3" FT /fasta_file="fasta/c8D2.tab.seq.00030.out" FT misc_feature 1284899..1284919 FT /colour=8 FT /note="PS00322 Histone H3 signature 1, KAPRKQL" FT misc_feature 1284905..1285261 FT /colour=9 FT /note="Pfam match to entry histone PF00125, Core histones FT H 2A, H2B, H3 and H4" FT misc_feature 1285055..1285081 FT /colour=8 FT /note="PS00959 Histone H3 signature 2" FT CDS complement(join(1285915..1288367,1288423..1288492)) FT /colour=8 FT /gene="SPBC8D2.05c" FT /label=SPBC8D2.05c FT /note="SPBC8D2.05c, len:838, SIMILARITY:Marchantia FT polymorpha, YCF0_MARPO, hypothetical 127 kD protein, (1068 FT aa), fasta scores: opt: 128, E():0.88, (20.1% identity in FT 566 aa)" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c8D2.tab.seq.00031.out" FT misc_feature complement(1288368..1288386) FT /colour=6 FT /note="ctaacttactggcatttag, splice branch and acceptor" FT misc_feature complement(1288417..1288422) FT /colour=6 FT /note="gtatga, splice donor sequence" FT CDS 1288857..1292051 FT /EC_number="6.1.1.5" FT /colour=7 FT /gene="SPBC8D2.06" FT /label=SPBC8D2.06 FT /note="SPBC8D2.06, len:1064, SIMILARITY:Saccharomyces FT cerevisiae, SYIC_YEAST, isoleucyl-tRNA synthetase, FT cytoplasmic, (1072 aa), fasta scores: opt: 4526, E():0, FT (60.4% identity in 1067 aa)" FT /product="putative isoleucyl-tRNA synthetase, cytoplasmic" FT /fasta_file="fasta/c8D2.tab.seq.00032.out" FT misc_feature 1288887..1290968 FT /colour=9 FT /note="Pfam match to entry tRNA-synt_1 PF00133, tRNA FT synthetases class I; similar to S. cerevisiae ILS1" FT CDS complement(join(1292309..1294037,1294237..1294324, FT 1294383..1294479,1294527..1294634)) FT /colour=7 FT /gene="sfc9" FT /gene="SPBC8D2.07c" FT /label=SPBC8D2.07c FT /note="SPBC8D2.07c, len:673, formed by merging entries FT SPBC8D2.07c and SPBC8D2.08c" FT /product="putative RNA polymerase III transcription factor FT TFIIIC subunit; by similar to human hTFIIIC90 subunit; no FT apparent S. cerevisiae ortholog; predicted C-terminal zinc FT finger (by eye)" FT /fasta_file="fasta/c8D2.tab.seq.00033.out" FT misc_feature complement(1294038..1294049) FT /colour=6 FT /note="ctaatcagctag, splice branch and acceptor" FT misc_feature complement(1294231..1294236) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1294325..1294340) FT /colour=6 FT /note="ctaacgtgttttacag, splice branch and acceptor" FT misc_feature complement(1294377..1294382) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1294480..1294493) FT /colour=6 FT /note="ctaattcccttcag, splice branch and acceptor" FT misc_feature complement(1294521..1294526) FT /colour=6 FT /note="gtacat, splice donor sequence" FT CDS complement(join(1295012..1295119,1295193..1295420)) FT /colour=7 FT /gene="SPBC8D2.09c" FT /label=SPBC8D2.09c FT /note="SPBC8D2.09c, len:111, SIMILARITY to N-term FT of:Solanum tuberosum, Q41499, spliceosomal protein., (231 FT aa), fasta scores: opt: 322, E():1.2e-16, (51.5% identity FT in 97 aa)" FT /product="U2 b'-like spliceosomal protein; similar to S. FT cerevisiae MSL1; U2 snRNA-associated protein; putative FT role in pre-mRNA splicing" FT /fasta_file="fasta/c8D2.tab.seq.00034.out" FT misc_feature complement(1295120..1295136) FT /colour=6 FT /note="ctaacatctttaataag, splice branch and acceptor" FT misc_feature complement(1295187..1295192) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature complement(1295187..1295405) FT /colour=9 FT /note="Pfam match to entry rrm PF00076, RNA recognition FT mot if. (aka RRM, RBD, or RNP domain)" FT CDS complement(join(1296040..1297433,1297513..1297608, FT 1297923..1298064)) FT /colour=7 FT /gene="SPBC8D2.10c" FT /label=SPBC8D2.10c FT /note="SPBC8D2.10c, len:543, SIMILARITY:Homo sapiens, FT O60678, protein arginine n-methyltransferase 3, (512 aa), FT fasta scores: opt: 888, E():0, (37.7% identity in 528 aa)" FT /product="putative arginine n-methyltransferase" FT /fasta_file="fasta/c8D2.tab.seq.00035.out" FT misc_feature complement(1297434..1297454) FT /colour=6 FT /note="ctaactttggttctattgtag, splice branch and acceptor" FT intron complement(1297434..1297512) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1297507..1297512) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(1297609..1297622) FT /colour=6 FT /note="ctaactcttaatag, splice branch and acceptor" FT intron complement(1297609..1297922) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1297917..1297922) FT /colour=6 FT /note="gtatga, splice donor sequence" FT CDS 1299291..1299659 FT /colour=8 FT /gene="SPBC8D2.11" FT /gene="pI054" FT /label=SPBC8D2.11 FT /note="SPBC8D2.11, len:122aa" FT /note="SPBC8D2.11, len:122, SIMILARITY:Staphylococcus FT epidermidis., P95734, fema., (422 aa), fasta scores: opt: FT 114, E():0.43, (22.6% identity in 93 aa)" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c8D2.tab.seq.00036.out" FT CDS complement(join(1299997..1300714,1300779..1300842, FT 1301199..1301298)) FT /colour=7 FT /gene="SPBC8D2.12c" FT /gene="pI053" FT /label=SPBC8D2.12c FT /note="SPBC8D2.12c, len:265, SIMILARITY:Aquifex aeolicus., FT YF75_AQUAE, hypothetical proteinaq_1575., (249 aa), fasta FT scores: opt: 449, E():7.8e-22, (36.8% identity in 250 aa)" FT /product="conserved protein; possibly mitochondrial FT protein synthesis; DUF28 domain" FT /fasta_file="fasta/c8D2.tab.seq.00047.out" FT misc_feature complement(1300450..1301202) FT /colour=9 FT /note="Pfam match to entry PF01709 DUF28, Domain of FT unknown function, score 477.00, E-value 1.6e-139" FT misc_feature complement(1300715..1300735) FT /colour=6 FT /note="ctaatattactgtgtatccag, splice branch and acceptor" FT misc_feature complement(1300773..1300778) FT /colour=6 FT /note="gtaagg, splice donor sequence" FT misc_feature complement(1300843..1300855) FT /colour=6 FT /note="ttaacctttatag, splice branch and acceptor" FT misc_feature complement(1301193..1301198) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS join(1301823..1301897,1301940..1302007,1302097..1302424, FT 1302470..1303206,1303258..1303405) FT /colour=10 FT /gene="SPBC8D2.13" FT /gene="pI052" FT /label=SPBC8D2.13 FT /note="SPBC8D2.13, len:451aa, SIMILARITY: YIL104C, FT YIK4_YEA ST, P40486, hypothetical 59.2 kD protein, (507aa), FT fasta sc ores, opt:269, E():7.1e-30, (31.1% identity in FT 472 aa overlap)" FT /product="hypothetical protein; similar to S. cerevisiae FT YIL104C (null lethal)" FT /fasta_file="fasta/c8D2.tab.seq.00038.out" FT misc_feature 1301898..1301903 FT /colour=6 FT /note="gtatgg, splice donor sequence" FT misc_feature 1301927..1301939 FT /colour=6 FT /note="ctcaccaaggcag, splice branch and acceptor" FT misc_feature 1302008..1302013 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1302080..1302096 FT /colour=6 FT /note="ctaactttttcccaaag, splice branch and acceptor" FT misc_feature 1302425..1302430 FT /colour=6 FT /note="gtttgt, splice donor sequence" FT misc_feature 1302454..1302469 FT /colour=6 FT /note="ctaactttatcattag, splice branch and acceptor" FT misc_feature 1303207..1303212 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1303234..1303257 FT /colour=6 FT /note="ctaaagactcaccaataattttag, splice branch and FT acceptor" FT CDS complement(join(1303707..1304437,1304529..1304727)) FT /colour=7 FT /gene="sed5" FT /gene="SPBC8D2.14c" FT /label=sed5 FT /note="SPBC8D2.14c, len:309, SIMILARITY:Drosophila FT melanogaster, Q24509, integral membrane protein sed5, (310 FT aa), fasta scores: opt: 711, E():0, (41.5% identity in 316 FT aa)" FT /product="putative golgi syntaxin (T-SNARE); similar to S. FT cerevisiae SED5" FT /fasta_file="fasta/c8D2.tab.seq.00039.out" FT misc_feature complement(join(1303719..1304437,1304529..1304679)) FT /note="Match to PF00804 Syntaxin, Syntaxin Score 62.17" FT misc_feature complement(1304438..1304452) FT /colour=6 FT /note="ctaacatttctttag, splice branch and acceptor" FT misc_feature complement(1304523..1304528) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1305025 FT /colour=4 FT /note="Real end of Cosmid c17A3" FT CDS join(1305997..1306044,1306086..1307150) FT /colour=7 FT /gene="SPBC8D2.15" FT /label=SPBC8D2.15 FT /note="SPBC8D2.15, len:370, predicted transit peptide 1- FT 22aa, SIMILARITY:Saccharomyces cerevisiae, LIP5_YEAST, FT lipoic acid synthetase, mitochondrial , (414 aa), fasta FT scores: opt: 1485, E():0, (66.1% identity in 336 aa)" FT /product="putative lipoic acid synthetase, mitochondrial; FT similar to S. cerevisiae LIP5" FT /fasta_file="fasta/c8D2.tab.seq.00040.out" FT misc_feature 1306045..1306050 FT /colour=6 FT /note="gtgagt, splice donor sequence" FT misc_feature 1306072..1306085 FT /colour=6 FT /note="ttaatatagcatag, splice branch and acceptor" FT CDS complement(join(1307446..1308267,1308311..1308436)) FT /colour=10 FT /gene="SPBC8D2.16c" FT /label=SPBC8D2.16c FT /note="SPBC8D2.16c, len:315, SIMILARITY:Homo sapiens, FT CAB53671, hypothetical 43.8 kD protein, (389 aa), fasta FT scores: opt: 394, E():1.1e-19, (30.8% identity in 263 aa)" FT /product="conserved protein; similar to S. cerevisiae FT YMR310C" FT /fasta_file="fasta/c8D2.tab.seq.00041.out" FT misc_feature complement(1308268..1308283) FT /colour=6 FT /note="ttaactcaaaatatag, splice branch and acceptor" FT misc_feature complement(1308305..1308310) FT /colour=6 FT /note="gtttga, splice donor sequence" FT conflict 1308839..1308859 FT /citation=[1] FT /colour=4 FT /note="this is a run of 21 Ts in this cosmid, but 22 T's FT in c213 and c17A3" FT CDS 1309882..1310937 FT /colour=7 FT /gene="SPBC8D2.17" FT /label=SPBC8D2.17 FT /note="SPBC8D2.17, len:351, SIMILARITY:Schizosaccharomyces FT pombe, O94622, putative galactosyltransferase., (375 aa), FT fasta scores: opt: 480, E():1.3e-24, (32.4% identity in FT 253 aa)" FT /product="putative alpha-1,2-galactosyltransferase" FT /fasta_file="fasta/c8D2.tab.seq.00042.out" FT CDS complement(1311366..1312667) FT /EC_number="3.3.1.1" FT /colour=7 FT /gene="SPBC8D2.18c" FT /label=SPBC8D2.18c FT /note="SPBC8D2.18c, len:433, SIMILARITY:Rattus norvegicus, FT SAHH_RAT, adenosylhomocysteinase, (431 aa), fasta scores: FT opt: 2236, E():0, (78.0% identity in 428 aa): NOTE The FT gene is described in Abe and Shimoda (2000), Genetics 154 FT 1497-1508. They describe it as ORF SPBC8D2.18c, and as a FT kinase homologous to S. cerevisiae IME2 and S. pombe FT pit1.mde3 gene described in this paper actually FT corresponds to SPC8D2.19" FT /product="putative adenosylhomocysteinase" FT /fasta_file="fasta/c8D2.tab.seq.00043.out" FT misc_feature complement(1311543..1312649) FT /note="Match to PF00670 AdoHcyase, S-adenosyl-L- FT homocysteine hydrolase Score 995.46" FT misc_feature complement(1311978..1312028) FT /colour=8 FT /note="PS00739 S-adenosyl-L-homocysteine hydrolase FT signature 2" FT misc_feature complement(1312392..1312436) FT /colour=8 FT /note="PS00738 S-adenosyl-L-homocysteine hydrolase FT signatur e 1" FT CDS join(1313153..1313299,1313346..1313420,1313554..1315011) FT /colour=2 FT /gene="mde3" FT /gene="SPBC8D2.19" FT /label=mde3 FT /note="SPBC8D2.19, len:559aa, SIMILARITY: YJL106W, FT SME1_YEAST, P32581, meiosis induction protein kinase sme1, FT (645aa), fasta scores, opt:338, E():7.7e-28, (28.4% FT identity in 617 aa overlap), FT SIMILARITY:Schizosaccharomyces pombe, O14132, putative FT serine/threonine-protein kinase c3c7.06c, (650 aa), fasta FT scores: opt: 871, E():0, (34.6% identity in 488 aa)" FT /product="serine/threonine protein kinase; putative FT positive regulator of meiotic genes; similar to S. FT cerevisiae IME2; meiosis specific transcription" FT /fasta_file="fasta/c8D2.tab.seq.00044.out" FT misc_feature 1313213..1313287 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 21.53" FT misc_feature 1313231..1313308 FT /colour=8 FT /note="PS00107 protein kinases ATP-binding region FT signature" FT misc_feature 1313300..1313305 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 1313331..1313345 FT /colour=6 FT /note="ctaacaattgtgaag, splice branch and acceptor" FT misc_feature 1313421..1313426 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1313543..1313553 FT /colour=6 FT /note="ctaacaaaaag, splice branch and acceptor" FT misc_feature 1313557..1314300 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 179.02" FT misc_feature 1313767..1313805 FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT CDS complement(1315533..1319207) FT /colour=2 FT /gene="sec31" FT /gene="SPBC8D2.20c" FT /label=sec31 FT /note="SPBC8D2.20c, len:1224, SIMILARITY:Saccharomyces FT cerevisiae, WEB1_YEAST, web1 protein, (1273 aa), fasta FT scores: opt: 1064, E():0, (27.5% identity in 1349 aa)" FT /product="putative COPII coat component; WD repeat FT protein; required for protein secretion (PMID: 11839792); FT required for cell-cycle progression, possibly as a result FT of nuclear envelope defects (PMID: 11839792); similar to FT S. cerevisiae SEC31" FT /fasta_file="fasta/c8D2.tab.seq.00048.out" FT misc_feature complement(1318212..1318331) FT /colour=9 FT /note="Pfam match to entry PF00400 WD40, WD domain, G-beta FT repeat, score 2.10, E-value 29" FT misc_feature complement(1318338..1318382) FT /colour=8 FT /note="PS00678 Beta-transducin family Trp-Asp repeats FT signa ture" FT misc_feature complement(1318341..1318442) FT /colour=9 FT /note="Pfam match to entry G-beta PF00400, WD domain, G- FT bet a repeats" FT misc_feature complement(1318473..1318601) FT /colour=9 FT /note="Pfam match to entry PF00400 WD40, WD domain, G-beta FT repeat, score 2.30, E-value 28" FT misc_feature 1320024..1320764 FT /note="nominal overlap with cosmid SPBC17A3, EM:AL109652 FT S. pombe chromosome 2" FT misc_feature 1320024..1320764 FT /note="nominal overlap with cosmid SPBC8D2, EM:AL022072 FT S.pombe chromosome 2" FT tRNA complement(1322143..1322240) FT /note="tRNA Leu anticodon TAA, Cove score 42.88" FT tRNA complement(1322187..1322202) FT /note="intron tRNA Leu anticodon TAA" FT CDS join(1322946..1323012,1323054..1323068,1323117..1323210, FT 1323270..1323289,1323511..1323674) FT /colour=10 FT /gene="SPBC17A3.02" FT /label=SPBC17A3.02 FT /note="SPBC17A3.02, len:119, SIMILARITY:Saccharomyces FT cerevisiae, YII7_YEAST, hypothetical 16.9 kD protein, (157 FT aa), fasta scores: opt: 162, E():0.00023, (33.0% identity FT in 94 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YIL087C" FT /fasta_file="fasta/c17A3.tab.seq.03910.out" FT misc_feature 1323013..1323018 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1323083..1323098 FT /colour=6 FT /note="ttaattcagtatttag, splice branch and acceptor" FT misc_feature 1323211..1323216 FT /colour=6 FT /note="gtattt, splice donor sequence" FT misc_feature 1323254..1323269 FT /colour=6 FT /note="ctaattactttttcag, splice branch and acceptor" FT misc_feature 1323290..1323295 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1323498..1323510 FT /colour=6 FT /note="cttacgaatatag, splice branch and acceptor" FT CDS complement(join(1324059..1324266,1324318..1324394, FT 1324456..1324541,1324673..1325093)) FT /colour=7 FT /gene="SPBC17A3.03c" FT /gene="pi043" FT /label=SPBC17A3.03c FT /note="SPBC17A3.03c, len:263, SIMILARITY:Saccharomyces FT cerevisiae, YNJ9_YEAST, hypothetical protein (238 aa), FT fasta scores: opt:272, E(): 3.1e-11, (34.0% identity in FT 159 aa overlap)" FT /product=" similar to protein tyrosine phosphatases FT (PTPs); similar to S. cerevisiae YNL099C" FT /fasta_file="fasta/c17A3.tab.seq.03911.out" FT misc_feature complement(1324267..1324279) FT /colour=6 FT /note="ttaacctataaag, splice branch and acceptor" FT misc_feature complement(1324312..1324317) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1324395..1324410) FT /colour=6 FT /note="ctaacgattcattaag, splice branch and acceptor" FT misc_feature complement(1324450..1324455) FT /colour=6 FT /note="gtaggt, splice donor sequence" FT misc_feature complement(1324542..1324557) FT /colour=6 FT /note="ctaacccgcttgctag, splice branch and acceptor" FT misc_feature complement(1324667..1324672) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT rRNA 1326084..1326523 FT /note="5s rRNA gene and flanks" FT CDS complement(join(1327107..1329258,1329320..1329398, FT 1329465..1329582)) FT /colour=7 FT /gene="SPBC17A3.04c" FT /gene="pi042" FT /label=SPBC17A3.04c FT /note="SPBC17A3.04c, len:782, SIMILARITY: SYMC_YEAST, FT METHIONYL-TRNA SYNTHETASE, (750 aa), fasta scores, opt: FT 2629, E():0, (54.0% identity in 767 aa overlap)" FT /product="putative methionyl-tRNA synthetase, FT mitochondrial; similar to S. cerevisiae MES1" FT /fasta_file="fasta/c17A3.tab.seq.03912.out" FT misc_feature complement(1327485..1328189) FT /note="Match to PF00133 tRNA-synt_1, tRNA synthetases FT class I (I, L, M and V) Score 48.85" FT misc_feature complement(1328451..1328816) FT /note="Match to PF00133 tRNA-synt_1, tRNA synthetases FT class I (I, L, M and V) Score 81.11" FT misc_feature complement(1329259..1329269) FT /colour=6 FT /note="ttgatatacag, splice branch and acceptor" FT misc_feature complement(1329314..1329319) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1329399..1329412) FT /colour=6 FT /note="ctaacgcttcacag, splice branch and acceptor" FT misc_feature complement(1329459..1329464) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS complement(join(1331061..1331806,1331871..1332307, FT 1332362..1332390)) FT /colour=7 FT /gene="SPBC17A3.05c" FT /gene="pi041" FT /label=SPBC17A3.05c FT /note="SPBC17A3.05c, len:403, SIMILARITY:Saccharomyces FT cerevisiae, HLJ1_YEAST, HLJ1 PROTEIN, (224 aa), fasta FT scores, opt:370, E(): 1.2e-15, (39.4% identity in 213 aa FT overlap)" FT /product="DNAJ domain protein; no apparent S. cerevisiae FT ortholog" FT /fasta_file="fasta/c17A3.tab.seq.03913.out" FT misc_feature complement(join(1331748..1331806,1331871..1332000)) FT /note="Match to PF00226 DnaJ, DnaJ domain Score 95.80" FT misc_feature complement(1331807..1331821) FT /colour=6 FT /note="ctaacttttttatag, splice branch and acceptor" FT misc_feature complement(1331865..1331870) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(1332308..1332327) FT /colour=6 FT /note="ctaacacatgttacgtgtag, splice branch and acceptor" FT intron complement(1332308..1332361) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1332356..1332361) FT /colour=6 FT /note="gtacga, splice donor sequence" FT CDS 1332754..1333746 FT /colour=7 FT /gene="SPBC17A3.06" FT /gene="pi040" FT /label=SPBC17A3.06 FT /note="SPBC17A3.06, len:330, SIMILARITY: Saccharomyces FT cerevisiae, PVH1_YEAST, PROTEIN-TYROSINE PHOSPHATASE YVH1, FT (364 aa), fasta scores, opt:303, E(): 1.1e-12, (31.3% FT identity in 278 aa overlap)" FT /product="protein tyrosine phosphatase; possibly involved FT in meiosis and sporulation; similar to S. cerevisiae YVH1" FT /fasta_file="fasta/c17A3.tab.seq.03914.out" FT misc_feature 1332889..1333305 FT /note="Match to PF00782 DSPc, Dual specificity phosphatase, FT catalytic domain Score 206.24" FT CDS join(1334195..1334246,1334302..1335644) FT /colour=2 FT /gene="pgr1" FT /gene="SPBC17A3.07" FT /gene="pi039" FT /label=pgr1 FT /note="SPBC17A3.07, len:464, SIMILARITY:Saccharomyces FT cerevisiae, GSHR_YEAST GLUTATHIONE REDUCTASE, (483 aa), FT fasta scores, opt: 1709, E():0, (57.4% identity in 472 aa FT overlap)" FT /product="glutathione reductase; maintains high lelvels of FT glutathione in the cytosol; similar to S. cerevisiae GLR1" FT /fasta_file="fasta/c17A3.tab.seq.03915.out" FT misc_feature join(1334222..1334246,1334302..1335638) FT /note="Match to PF00070 pyr_redox, Pyridine nucleotide- FT disulphide oxidoreductase class-I Score 503.74" FT misc_feature 1334247..1334252 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1334282..1334301 FT /colour=6 FT /note="ttaacatttatgaatattag, splice branch and acceptor" FT CDS join(1335964..1335995,1336050..1336243,1336419..1336617, FT 1336683..1336960,1337024..1337259) FT /colour=7 FT /gene="SPBC17A3.08" FT /gene="pi038" FT /label=SPBC17A3.08 FT /note="SPBC17A3.08, len:312, SIMILARITY: Arabidopsis FT Thaliana, CAB43446, hypothetical protein (299 aa), FT fasta scores, opt:702 E():0, (41.9% identity in 284 aa FT overlap)" FT /product="hypothetical protein; TatD_DNase family" FT /fasta_file="fasta/c17A3.tab.seq.03916.out" FT misc_feature 1335996..1336001 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1336031..1336049 FT /colour=6 FT /note="cttacgatatgagctgcag, splice branch and acceptor" FT misc_feature join(1336105..1336243,1336419..1336617,1336683..1336960, FT 1337024..1337253) FT /note="Match to PF01026 UPF0006, Uncharacterized protein FT family Score 368.22" FT misc_feature 1336244..1336249 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1336405..1336418 FT /colour=6 FT /note="ctaataaattacag, splice branch and acceptor" FT misc_feature 1336618..1336623 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1336663..1336682 FT /colour=6 FT /note="ctaacaaaaaattgaattag, splice branch and acceptor" FT misc_feature 1336961..1336966 FT /colour=6 FT /note="gtataa, splice donor sequence" FT misc_feature 1337007..1337023 FT /colour=6 FT /note="ttaacaaatatttgtag, splice branch and acceptor" FT CDS complement(1337252..1338343) FT /colour=7 FT /gene="SPBC17A3.09c" FT /gene="pi037" FT /label=SPBC17A3.09c FT /note="SPBC17A3.09c, len:363, SIMILARITY: Escherichia coli, FT LPLA_ECOLI, LIPOATE-PROTEIN LIGASE A, (337 aa), opt: 497, FT E():1.6e-26, (33.4% identity in 296 aa overlap)" FT /product="Lipoate-protein ligase A" FT /fasta_file="fasta/c17A3.tab.seq.03917.out" FT CDS join(1338571..1338607,1338666..1339549) FT /colour=7 FT /gene="SPBC17A3.10" FT /gene="pi036" FT /label=SPBC17A3.10 FT /note="SPBC17A3.10, len:306 SIMILARITY: Saccharomyces FT cerevisiae, PEXA_YEAST, PEROXISOME ASSEMBLY PROTEIN PEX10, FT (337 aa), fasta scores, opt: 304 E(): 4.2e-13 (28.3% FT identity in 336 aa overlap)" FT /product="putative peroxisome assembly protein; zinc FT finger protein; zf-C3HC4 type (RING finger); similar to S. FT cerevisiae PEX10" FT /fasta_file="fasta/c17A3.tab.seq.03918.out" FT misc_feature 1338608..1338613 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1338653..1338665 FT /colour=6 FT /note="ttaacgaagcaag, splice branch and acceptor" FT misc_feature 1339394..1339507 FT /note="Match to PF00097 zf-C3HC4, zinc finger, C3HC4 type FT (RING finger) Score 42.60" FT misc_feature join(1340241..1340370,1340451..1340501,1340554..1340649, FT 1340711..1340867,1340929..1341090,1341140..1341366) FT /note="see c691 for complete CDS" FT misc_feature 1340371..1340376 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 1340432..1340450 FT /colour=6 FT /note="ctaattatattctatacag, splice branch and acceptor" FT misc_feature 1340502..1340507 FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature 1340541..1340553 FT /colour=6 FT /note="ctaacctttaaag, splice branch and acceptor" FT misc_feature 1340650..1340655 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 1340691..1340710 FT /colour=6 FT /note="ctaacatcagtttattctag, splice branch and acceptor" FT misc_feature 1340868..1340873 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 1340915..1340928 FT /colour=6 FT /note="ctaattttgatcag, splice branch and acceptor" FT misc_feature 1341091..1341096 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1341119..1341139 FT /colour=6 FT /note="ctaacaatattatatcaatag, splice branch and acceptor" FT CDS join(1340241..1340370,1340451..1340501,1340554..1340649, FT 1340711..1340867,1340929..1341090,1341140..1341482) FT /colour=10 FT /gene="SPBC691.01" FT /gene="pi035" FT /label=SPBC691.01 FT /note=", len:312, SIMILARITY:Saccharomyces cerevisiae, FT YN66_YEAST, hypothetical 39.2 kD protein in egt2-kre1 FT intergenic region., (336 aa), fasta scores: opt: 271, FT E():2.6e-10, (31.1% identity in 183 aa)" FT /product="conserved protein; human reduced expression in FT cancer protein homolog; zf-DHHC; contains 3 predicted FT transmembrane domains; predicted N-terminal signal FT sequence; similar to S. cerevisiae YDR459C" FT /fasta_file="fasta/c691.tab.seq.04259.out" FT misc_feature 1339859..1341366 FT /note="Nominal pverlap with SPBC17A3 AL109652 S.pombe FT chromosome II cosmid c17A3." FT misc_feature 1340371..1340376 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 1340432..1340450 FT /colour=6 FT /note="ctaattatattctatacag, splice branch and acceptor" FT misc_feature 1340502..1340507 FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature 1340541..1340553 FT /colour=6 FT /note="ctaacctttaaag, splice branch and acceptor" FT misc_feature 1340650..1340655 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 1340691..1340710 FT /colour=6 FT /note="ctaacatcagtttattctag, splice branch and acceptor" FT misc_feature join(1340749..1340867,1340929..1340986) FT /note="Match to PF01529 zf-DHHC, DHHC zinc finger domain FT Score 58.55" FT misc_feature 1340868..1340873 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 1340915..1340928 FT /colour=6 FT /note="ctaattttgatcag, splice branch and acceptor" FT misc_feature 1341091..1341096 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1341119..1341139 FT /colour=6 FT /note="ctaacaatattatatcaatag, splice branch and acceptor" FT CDS complement(1341572..1343608) FT /colour=7 FT /gene="SPBC691.02c" FT /gene="pi034" FT /label=SPBC691.02c FT /note="SPACTOKYO_453.01, len:678, SIMILARITY:Lampetra FT reissneri., BAA84733, ephc, (350 aa), fasta scores: opt: FT 114, E():5, (19.5% identity in 287 aa)" FT /product="putative endoplasmic reticulum to golgi FT transport protein; similar to S. cerevisiae TIP20" FT /fasta_file="fasta/c691.tab.seq.04260.out" FT CDS complement(1344369..1347005) FT /colour=2 FT /gene="apl3" FT /gene="SPBC691.03c" FT /gene="pi033" FT /label=apl3 FT /note="SPACTOKYO_453.02c, len:878, SIMILARITY:Mus musculus, FT ADAC_MOUSE, alpha-adaptin c, (938 aa), fasta scores: FT opt: 1522, E():0, (35.9% identity in 934 aa)" FT /product="putative Alpha-adaptin; large subunit of FT clathrin associated protein (AP) complex" FT /fasta_file="fasta/c691.tab.seq.04261.out" FT misc_feature complement(1345278..1346936) FT /note="Match to PF01602 Adaptin_N, Adaptin N-terminal FT region Score 471.29" FT CDS 1348488..1350095 FT /colour=7 FT /gene="SPBC691.04" FT /gene="pi031" FT /label=SPBC691.04 FT /note="SPACTOKYO_453.03c, len:535, SIMILARITY:Arabidopsis FT thaliana, Q9ZS00, RNA helicase., (563 aa), fasta scores: FT opt: 782, E():0, (32.5% identity in 462 aa)" FT /product="putative ATP-dependent RNA helicase" FT /fasta_file="fasta/c691.tab.seq.04262.out" FT misc_feature 1348638..1349285 FT /note="Match to PF00270 DEAD, DEAD/DEAH box helicase Score FT 186.94" FT misc_feature 1349403..1349651 FT /note="Match to PF00271 helicase_C, Helicases conserved C- FT terminal domain Score 86.71" FT BLASTN_HIT 1349712..1350114 FT /note="2015 (+1) 1 403 dbj|AU008302.1|AU008302 AU008302 FT Schizosaccharomyces pombe late log phase cDNA FT Schizosaccharomyces pombe cDNA clone spc03175" FT misc_feature complement(<1350453..1351622) FT /note="Nominal overlap p22H7" FT misc_feature <1350453..1351622 FT /note="SPBC691 overlap" FT misc_feature complement(1351930..1351946) FT /colour=6 FT /note="cttactgtgatatttag, splice branch and acceptor" FT misc_feature complement(1352053..1352058) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS complement(1353111..1355612) FT /colour=7 FT /gene="SPBP22H7.02c" FT /gene="pi029" FT /label=SPBP22H7.02c FT /note="SPACTOKYO_453.05c, len:833" FT /product="RNA-binding protein; 5 rrm RNA recognition FT motifs" FT /fasta_file="fasta/p22H7.tab.seq.04383.out" FT misc_feature complement(1353246..1353446) FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 60.19" FT misc_feature complement(1353522..1353752) FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 61.79" FT misc_feature complement(1353897..1354091) FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 24.37" FT misc_feature complement(1354425..1354640) FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 87.73" FT misc_feature complement(1355379..1355603) FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 42.60" FT CDS 1355977..1356522 FT /colour=8 FT /gene="SPBP22H7.03" FT /gene="pi028" FT /label=SPBP22H7.03 FT /note="SPACTOKYO_453.06c, len:181" FT /note="SPACTOKYO_453.07, len:182" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/p22H7.tab.seq.04384.out" FT CDS 1357766..1358533 FT /colour=8 FT /gene="SPBP22H7.04" FT /gene="pi027" FT /label=SPBP22H7.04 FT /note="SPACTOKYO_453.08, len:255" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/p22H7.tab.seq.04385.out" FT CDS complement(1358666..1362271) FT /colour=7 FT /gene="SPBP22H7.05c" FT /gene="pi026" FT /label=SPBP22H7.05c FT /note="SPACTOKYO_453.08, len:1201, FT SIMILARITY:Schizosaccharomyces pombe, O14114, hypothetical FT 135.3 kD protein c31g5.19 in chromosome i., (1190 aa), FT fasta scores: opt: 2169, E():0, (38.1% identity in 993 aa)" FT /product="AAA family ATPase; possibly in endoplasmic FT reticulum" FT /fasta_file="fasta/p22H7.tab.seq.04386.out" FT misc_feature complement(1360478..1361050) FT /note="Match to PF00004 AAA, ATPases associated with FT various cellular activities (AAA) Score 291.76" FT CDS join(1364264..1364295,1364350..1364374,1364477..1364545, FT 1364720..1365086,1365173..1365372) FT /colour=7 FT /gene="SPBP22H7.06" FT /gene="pi025" FT /label=SPBP22H7.06 FT /note="SPACTOKYO_453.09c, len:230, FT SIMILARITY:Saccharomyces cerevisiae, YNM9_YEAST, FT hypothetical 27.7 kD protein in cpt1-spc98 intergenic FT region., (240 aa), fasta scores: opt: 513, E():3.8e-27, FT (40.4% identity in 208 aa)" FT /product="putative uridine kinase; similar to S. FT cerevisiae YNL129W" FT /fasta_file="fasta/p22H7.tab.seq.04387.out" FT misc_feature 1364296..1364301 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1364332..1364349 FT /colour=6 FT /note="ttaacaagaaaaaattag, splice branch and acceptor" FT misc_feature 1364375..1364380 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 1364447..1364476 FT /colour=6 FT /note="ctaaccaatttctctttcttgttttgacag, splice branch and FT acceptor" FT misc_feature 1364546..1364551 FT /colour=6 FT /note="gttcgt, splice donor sequence" FT misc_feature 1364700..1364719 FT /colour=6 FT /note="ctaactcgtttgttttgtag, splice branch and acceptor" FT misc_feature 1365087..1365092 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 1365153..1365172 FT /colour=6 FT /note="ctaactccaaattgttccag, splice branch and acceptor" FT CDS 1365811..1367232 FT /colour=2 FT /gene="prp5" FT /gene="cwf1" FT /gene="pi024" FT /gene="SPBP22H7.07" FT /label=prp5 FT /note="SPACTOKYO_453.10, len:473, FT SIMILARITY:Caenorhabditis elegans., Q18295, d1054.15 FT protein., (494 aa), fasta scores: opt: 1640, E():0, (52.1% FT identity in 474 aa)" FT /note="SPACTOKYO_453.11, len:474" FT /product="WD repeat protein; prl1/prl2 phosphatses FT pleiotrophic regulator-like; putative pre-mRNA splicing FT factor; similar to S. cerevisiae PRP46" FT /fasta_file="fasta/p22H7.tab.seq.04388.out" FT misc_feature 1366270..1366383 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 42.41" FT misc_feature 1366393..1366509 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 37.13" FT misc_feature 1366537..1366635 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 31.86" FT misc_feature 1366645..1366761 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 44.27" FT misc_feature 1366771..1366872 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 23.73" FT misc_feature 1366894..1367007 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 26.74" FT CDS join(1367707..1367782,1367831..1368198) FT /colour=2 FT /gene="rps10-2" FT /gene="pi023" FT /gene="SPBP22H7.08" FT /obsolete_gene_name="SPBP22H7.07" FT /label=rps10-2 FT /note="SPACTOKYO_453.11, len:147" FT /product="40S ribosomal protein S10" FT /fasta_file="fasta/p22H7.tab.seq.04389.out" FT misc_feature 1367783..1367788 FT /colour=6 FT /note="gtaatg, splice donor sequence" FT intron 1367783..1367830 FT /colour=2 FT /note="confirmed intron" FT misc_feature 1367818..1367830 FT /colour=6 FT /note="ctaacaagcgtag, splice branch and acceptor" FT CDS complement(join(1368514..1369081,1369129..1369489, FT 1369548..1369854)) FT /colour=7 FT /gene="SPBP22H7.09c" FT /gene="pi022" FT /label=SPBP22H7.09c FT /note="SPACTOKYO_453.12, len:411, SIMILARITY:Saccharomyces FT cerevisiae, CHL4_YEAST, putative cell segregation FT machinery component chl4., (458 aa), fasta scores: opt: FT 112, E():2.9, (19.8% identity in 450 aa)" FT /product="putative chromosome segregation protein by FT similar to S. cerevisiae CHL4" FT /fasta_file="fasta/p22H7.tab.seq.04390.out" FT misc_feature complement(1369123..1369128) FT /colour=6 FT /note="gtgtgt, splice donor sequence" FT misc_feature complement(1369490..1369506) FT /colour=6 FT /note="ctaatatcaattcacag, splice branch and acceptor" FT misc_feature complement(1369542..1369547) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1370019..>1371058 FT /note="nominal overlap with c32H8" FT misc_feature complement(1370494..1370515) FT /colour=6 FT /note="ttaaccaacaaaataaaaatag, splice branch and acceptor" FT misc_feature complement(1370580..1370585) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1370636..1370659) FT /colour=6 FT /note="ctaatacactattatcgtttctag, splice branch and FT acceptor" FT misc_feature complement(1370708..1370713) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature <1370019..1371058 FT /note="p22H7 overlap" FT misc_feature complement(1370494..1370515) FT /colour=6 FT /note="ttaaccaacaaaataaaaatag, splice branch and acceptor" FT misc_feature complement(1370580..1370585) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1370636..1370659) FT /colour=6 FT /note="ctaatacactattatcgtttctag, splice branch and FT acceptor" FT misc_feature complement(1370708..1370713) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT CDS complement(1371886..1373133) FT /colour=8 FT /gene="SPBC32H8.02c" FT /gene="pi021" FT /label=SPBC32H8.02c FT /note="SPACTOKYO_453.14c, len:415" FT /product="hypothetical protein; located in cell periphery FT and cytoplasm; sequence orphan" FT /fasta_file="fasta/c32H8.tab.seq.04296.out" FT misc_feature 1373134..1377362 FT /note="low complexity gene free region" FT misc_feature complement(1374121..1374189) FT /note="AC006507 Mus musculus chromosome 10 clone rp21- FT 580p20 strain 129S6/SvEvTac" FT CDS 1377363..1378262 FT /colour=2 FT /gene="bem46" FT /gene="SPBC32H8.03" FT /label=bem46 FT /note="SPACTOKYO_453.15c, len:299" FT /product="supressor of bem1/bud5" FT /fasta_file="fasta/c32H8.tab.seq.04297.out" FT CDS complement(join(1379051..1379492,1379547..1379683)) FT /colour=10 FT /gene="SPBC32H8.04c" FT /gene="pi019" FT /label=SPBC32H8.04c FT /note="SPACTOKYO_453.16, len:192, SIMILARITY:Homo sapiens, FT Q9Y324, cgi-35 protein., (198 aa), fasta scores: opt: 897, FT E():0, (63.9% identity in 191 aa)" FT /product="conserved protein; similar to S. cerevisiae FT YDR339C" FT /fasta_file="fasta/c32H8.tab.seq.04298.out" FT misc_feature complement(1379066..1379407) FT /note="Match to PF01942 DUF94, Domain of unknown function FT Score 249.31" FT misc_feature complement(1379493..1379505) FT /colour=6 FT /note="ctaacccctcaag, splice branch and acceptor" FT misc_feature complement(1379541..1379546) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS join(1380274..1380321,1380461..1380766) FT /colour=10 FT /gene="SPBC32H8.05" FT /label=SPBC32H8.05 FT /note="SPBC32H8.05, len:117, SIMILARITY:Saccharomyces FT cerevisiae, YBC8_YEAST, hypothetical 12.4 kD protein in FT aac2-rpl19b intergenic region., (106 aa), fasta scores: FT opt: 178, E():4.4e-05, (35.1% identity in 114 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YBL028C" FT /fasta_file="fasta/c32H8.tab.seq.04299.out" FT misc_feature 1380322..1380327 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1380446..1380460 FT /colour=6 FT /note="ctaacaaagtaatag, splice branch and acceptor" FT CDS join(1381418..1381474,1381534..1381643,1381798..1382782) FT /colour=8 FT /gene="SPBC32H8.06" FT /gene="pi018" FT /label=SPBC32H8.06 FT /note="SPACTOKYO_453.18, len:383, FT SIMILARITY:Schizosaccharomyces pombe, O43049, FT serine/threonine protein phosphatase., (473 aa), fasta FT scores: opt: 159, E():0.0017, (20.2% identity in 386 aa)" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c32H8.tab.seq.00015.out" FT misc_feature 1381475..1381480 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 1381516..1381533 FT /colour=6 FT /note="ctaaccctcaataaacag, splice branch and acceptor" FT misc_feature 1381644..1381649 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1381778..1381797 FT /colour=6 FT /note="ctaacttattttgcatgcag, splice branch and acceptor" FT CDS 1384025..1384942 FT /colour=2 FT /gene="git5" FT /gene="SPBC32H8.07" FT /label=git5 FT /product="g-protein beta subunit git5p." FT /fasta_file="fasta/c32H8.tab.seq.04301.out" FT misc_feature 1384325..1384423 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 38.96" FT misc_feature 1384448..1384552 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 40.92" FT misc_feature 1384574..1384678 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 26.81" FT misc_feature 1384817..1384930 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 40.68" FT CDS complement(join(1385510..1385734,1385837..1386756, FT 1387010..1387155,1387213..1387238)) FT /colour=7 FT /gene="SPBC32H8.08c" FT /gene="pi016" FT /label=SPBC32H8.08c FT /note="SPACTOKYO_453.20, len:438, FT SIMILARITY:Schizosaccharomyces pombe, O94565, putative FT mannosyltransferase., (391 aa), fasta scores: opt: 1403, FT E():0, (51.3% identity in 388 aa)" FT /note="SPACTOKYO_453.21c, len:439" FT /product="putative alpha-1,2 mannosyltransferase" FT /fasta_file="fasta/c32H8.tab.seq.04302.out" FT misc_feature complement(join(1385636..1385734,1385837..1386756, FT 1387010..1387154)) FT /note="Match to PF01793 Glyco_transf_15, Glycolipid 2- FT alpha-mannosyltransferase Score 767.56" FT misc_feature complement(1385735..1385748) FT /colour=6 FT /note="ctaacttattttag, splice branch and acceptor" FT misc_feature complement(1385831..1385836) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1387004..1387009) FT /colour=6 FT /note="gtattt, splice donor sequence" FT misc_feature complement(1387156..1387169) FT /colour=6 FT /note="ctgattagagaaag, splice branch and acceptor" FT misc_feature complement(1387207..1387212) FT /colour=6 FT /note="gtaatt, splice donor sequence" FT BLASTCDS complement(1387759..1387800) FT /note="71 (-1) 1 14 TR:O14452 O14452 HYPOTHETICAL 61.4kD FT PROTEIN IN SGA1-THS1 INTERGENIC REGION. [0]" FT CDS join(1388224..1388586,1388659..1388734,1388774..1389786) FT /colour=10 FT /gene="SPBC32H8.09" FT /gene="pi015" FT /label=SPBC32H8.09 FT /note="SPACTOKYO_453.21c, len:483, SIMILARITY:Homo sapiens, FT BAA92312, mRNA, complete cds, wd-repeat like sequence., FT (460 aa), fasta scores: opt: 245, E():4.5e-09, (22.6% FT identity in 452 aa)" FT /product="putative WD repeat protein; by similarity" FT /fasta_file="fasta/c32H8.tab.seq.04303.out" FT misc_feature 1388587..1388592 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 1388640..1388658 FT /colour=6 FT /note="ctaatagcaaattttttag, splice branch and acceptor" FT misc_feature 1388735..1388740 FT /colour=6 FT /note="gtattt, splice donor sequence" FT misc_feature 1388762..1388773 FT /colour=6 FT /note="ctgactgtttag, splice branch and acceptor" FT CDS join(1390379..1390521,1390573..1390654,1390775..1392325) FT /colour=7 FT /gene="SPBC32H8.10" FT /gene="pi014" FT /label=SPBC32H8.10 FT /note="SPACTOKYO_453.22, len:591, SIMILARITY:Candida FT albicans, Q9Y7W4, cdc2-related protein kinase crk1., (746 FT aa), fasta scores: opt: 1068, E():0, (37.3% identity in FT 528 aa)" FT /product="putative serine/threonine protein kinase; FT similar to S. cerevisiae SGV1" FT /fasta_file="fasta/c32H8.tab.seq.04304.out" FT misc_feature 1390522..1390527 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1390556..1390572 FT /colour=6 FT /note="ctaacttggttcaccag, splice branch and acceptor" FT misc_feature join(1390571..1390664,1390788..1391566) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 257.99" FT misc_feature 1390655..1390660 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1390756..1390774 FT /colour=6 FT /note="ctaaagcattacattttag, splice branch and acceptor" FT CDS 1392893..1394446 FT /colour=2 FT /gene="mei4" FT /gene="SPBC32H8.11" FT /gene="pi013" FT /label=mei4 FT /note="SPACTOKYO_453.23, len:517" FT /product="fork head transcription factor homolog; meiosis FT specific transcription factor" FT /fasta_file="fasta/c32H8.tab.seq.04305.out" FT misc_feature 1393133..1393390 FT /note="Match to PF00250 Fork_head, Fork head domain Score FT 159.19" FT CDS complement(1395848..1396975) FT /colour=2 FT /gene="act1" FT /gene="cps8" FT /gene="SPBC32H8.12c" FT /gene="pi012" FT /label=act1 FT /note="SPBC32H8.12c, len:375" FT /product="actin" FT /fasta_file="fasta/c32H8.tab.seq.04306.out" FT misc_feature complement(1395851..1396975) FT /note="Match to PF00022 actin, Actin Score 918.17" FT CDS complement(1397803..1404861) FT /EC_number="2.4.1.183" FT /colour=2 FT /gene="mok12" FT /gene="SPBC32H8.13c" FT /label=mok12 FT /note="SPACTOKYO_453.25c, len:2352" FT /product="alpha glucan synthase" FT /fasta_file="fasta/c32H8.tab.seq.04307.out" FT misc_feature 1405848..>1406317 FT /note="c11B10" FT misc_feature 1405936..1405941 FT /colour=6 FT /note="gtgaga, splice donor sequence" FT misc_feature 1405970..1405982 FT /colour=6 FT /note="ctaattactttag, splice branch and acceptor" FT misc_feature 1406100..1406105 FT /colour=6 FT /note="gtaggt, splice donor sequence" FT misc_feature 1406151..1406170 FT /colour=6 FT /note="ctaactttatgaaataatag, splice branch and acceptor" FT misc_feature <1405848..1406317 FT /note="c32H8" FT misc_feature 1405936..1405941 FT /colour=6 FT /note="gtgaga, splice donor sequence" FT misc_feature 1405970..1405982 FT /colour=6 FT /note="ctaattactttag, splice branch and acceptor" FT misc_feature 1406100..1406105 FT /colour=6 FT /note="gtaggt, splice donor sequence" FT misc_feature 1406151..1406170 FT /colour=6 FT /note="ctaactttatgaaataatag, splice branch and acceptor" FT misc_feature 1406625..1406630 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1406747..1406757 FT /colour=6 FT /note="ttgattataag, splice branch and acceptor" FT misc_feature 1406762..1407232 FT /note="Match to PF00534 Glycos_transf_1, Glycosyl FT transferases group 1 Score 101.19" FT CDS complement(join(1407910..1408372,1408432..1409043, FT 1409229..1409240,1409296..1409363)) FT /EC_number="2.6.1.9" FT /colour=2 FT /gene="his3" FT /gene="SPBC11B10.02c" FT /gene="pi009" FT /label=his3 FT /note="SPACTOKYO_453.27, len:384" FT /product="histidinol-phosphate aminotransferase; eigth FT step in the histidine biosynthesis pathway; similar to S. FT cerevisiae HIS5" FT /fasta_file="fasta/c11B10.tab.seq.04393.out" FT misc_feature complement(join(1407994..1408372,1408432..1408895)) FT /note="Match to PF00222 aminotran_2, Aminotransferases FT class-II Score 393.35" FT misc_feature complement(1408373..1408389) FT /colour=6 FT /note="ctaactatgatgtttag, splice branch and acceptor" FT misc_feature complement(1408426..1408431) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1409044..1409056) FT /colour=6 FT /note="ctaatcttaatag, splice branch and acceptor" FT misc_feature complement(1409223..1409228) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1409241..1409256) FT /colour=6 FT /note="ttaacatagaatatag, splice branch and acceptor" FT misc_feature complement(1409290..1409295) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS join(1410075..1410122,1410292..1411446) FT /colour=10 FT /gene="SPBC11B10.03" FT /gene="pi008" FT /label=SPBC11B10.03 FT /note="SPACTOKYO_453.28c, len:400, FT SIMILARITY:Caenorhabditis elegans., O44502, r02d3.2 FT protein., (743 aa), fasta scores: opt: 165, E():0.0083, FT (21.4% identity in 383 aa)" FT /note="SPACTOKYO_453.29, len:401" FT /product="hypothetical protein; similar to S. cerevisiae FT YML071C; potential leucine zipper" FT /fasta_file="fasta/c11B10.tab.seq.04394.out" FT misc_feature 1410123..1410128 FT /colour=6 FT /note="gtgctt, splice donor sequence" FT misc_feature 1410280..1410291 FT /colour=6 FT /note="ctgacttgaaag, splice branch and acceptor" FT CDS complement(1411654..1412520) FT /colour=7 FT /gene="SPBC11B10.04c" FT /gene="pi007" FT /label=SPBC11B10.04c FT /note="SPACTOKYO_453.29, len:288, SIMILARITY:Saccharomyces FT cerevisiae, RT28_YEAST, 40S ribosomal protein S28, FT mitochondrial .40S ribosomal protein S28, mitochondrial ., FT (286 aa), fasta scores: opt: 294, E():1.1e-11, (30.1% FT identity in 276 aa)" FT /product="mitochondrial ribosomal protein S15" FT /fasta_file="fasta/c11B10.tab.seq.04395.out" FT misc_feature complement(1411690..1411884) FT /note="Match to PF00312 Ribosomal_S15, Ribosomal protein FT S15 Score 68.85" FT CDS complement(1412768..1414252) FT /colour=7 FT /gene="SPBC11B10.05c" FT /gene="pi006" FT /label=SPBC11B10.05c FT /note="SPACTOKYO_453.30c, len:494, FT SIMILARITY:Schizosaccharomyces pombe, O94566, hypothetical FT DNAJ protein., (603 aa), fasta scores: opt: 279, E():7.8e- FT 08, (23.7% identity in 596 aa)" FT /product="DNAJ domain protein" FT /fasta_file="fasta/c11B10.tab.seq.04396.out" FT misc_feature complement(1414025..1414219) FT /note="Match to PF00226 DnaJ, DnaJ domain Score 72.65" FT CDS 1414851..1415480 FT /colour=8 FT /gene="pi005" FT /gene="SPBC11B10.06" FT /label=SPBC11B10.06 FT /note="SPACTOKYO_453.32, len:209" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c11B10.tab.seq.04397.out" FT CDS complement(join(1415795..1416718,1416941..1417079, FT 1417138..1417190)) FT /colour=10 FT /gene="SPBC11B10.07c" FT /gene="pi004" FT /label=SPBC11B10.07c FT /note="SPACTOKYO_453.32, len:371, SIMILARITY:Saccharomyces FT cerevisiae, YCY4_YEAST, hypothetical 45.0 kD protein in FT not1/cdc39-hmr intergenic region., (391 aa), fasta scores: FT opt: 1085, E():0, (42.2% identity in 358 aa)" FT /note="SPACTOKYO_453.33c, len:372" FT /product="hypothetical protein; similar to S. cerevisiae FT YCR094W - cell cycle protein" FT /fasta_file="fasta/c11B10.tab.seq.04398.out" FT misc_feature complement(1416719..1416737) FT /colour=6 FT /note="ctaatcaacattttattag, splice branch and acceptor" FT misc_feature complement(1416935..1416940) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1417080..1417094) FT /colour=6 FT /note="ctgatccgtatgtag, splice branch and acceptor" FT misc_feature complement(1417132..1417137) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS 1418500..1419114 FT /colour=10 FT /gene="SPBC11B10.08" FT /gene="pi003" FT /label=SPBC11B10.08 FT /note="SPACTOKYO_453.33c, len:204, FT SIMILARITY:Schizosaccharomyces pombe, O94426, glycine-rich FT protein, putative cell wall protein., (273 aa), fasta FT scores: opt: 365, E():6.2e-09, (34.8% identity in 204 aa)" FT /note="SPACTOKYO_453.34, len:205" FT /product="hypothetical protein; similar to S. cerevisiae FT WWM1; possible WW domain" FT /fasta_file="fasta/c11B10.tab.seq.04399.out" FT intron complement(1419968..1420009) FT /colour=7 FT /note="Intron predicted by HMM_intron, Score=20.16" FT CDS join(1420039..1420075,1420144..1420312,1420385..1420685, FT 1420787..1421092,1421147..1421227) FT /colour=2 FT /gene="cdc2" FT /gene="swo2" FT /gene="SPBC11B10.09" FT /gene="pi002" FT /label=cdc2 FT /note="SPACTOKYO_453.34, len:297" FT /product="serine/threonine protein kinase; cyclin- FT dependent protein kinase; essential; regulates cell cycle FT transitions G1/S and G2/M; similar to S. cerevisiae CDC28" FT /fasta_file="fasta/c11B10.tab.seq.04400.out" FT misc_feature 1420076..1420081 FT /colour=6 FT /note="gtaggt, splice donor sequence" FT misc_feature 1420134..1420143 FT /colour=6 FT /note="ctaatgctag, splice branch and acceptor" FT misc_feature 1420143..1420283 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 44.63" FT misc_feature 1420313..1420318 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1420369..1420384 FT /colour=6 FT /note="ctaacccttttttaag, splice branch and acceptor" FT misc_feature 1420380..1420688 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 114.45" FT misc_feature 1420686..1420691 FT /colour=6 FT /note="gtatat, splice donor sequence" FT misc_feature 1420775..1420786 FT /colour=6 FT /note="ctaaccgtttag, splice branch and acceptor" FT misc_feature 1420793..1421020 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 75.12" FT misc_feature 1421093..1421098 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 1421130..1421146 FT /colour=6 FT /note="ctaaccattttgtcaag, splice branch and acceptor" FT CDS complement(1422341..1422856) FT /colour=2 FT /gene="pht1" FT /gene="SPBC11B10.10c" FT /gene="pi001" FT /label=pht1 FT /product="histone h2a variant" FT /fasta_file="fasta/c11B10.tab.seq.04401.out" FT misc_feature complement(1422386..1422745) FT /note="Match to PF00125 histone, Core histone FT H2A/H2B/H3/H4 Score 148.99" FT misc_feature 1423617..1423698 FT /note="nominal overlap with SPBC1215 S. pombe chromosome 2" FT tRNA 1423652..1423723 FT /note="tRNA Thr anticodon TGT, Cove score 78.51" FT misc_feature complement(1423617..1423698) FT /note="nominal overlap with cosmid SPAB4534 (c1750), FT EM:AB004534 S. pombe chromosome 2" FT rRNA 1424031..1424197 FT /note="SPRG5SD K00771 Yeast (s.pombe) 5s rRNA gene and FT flanks" FT CDS join(1425117..1425376,1425460..1426072) FT /colour=7 FT /gene="SPBC1215.01" FT /label=SPBC1215.01 FT /note="SPBC1215.01, len:290, SIMILARITY:Saccharomyces FT cerevisiae, YG2X_YEAST, hypothetical 45.1 kD protein in FT clb6-spt6 intergenic region, (389 aa), fasta scores: opt: FT 385, E():2.8e-19, (29.0% identity in 314 aa)" FT /product="putative SURF-family protein" FT /fasta_file="fasta/c1215.tab.seq.03949.out" FT misc_feature 1425377..1425382 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 1425443..1425459 FT /colour=6 FT /note="ctaacataatcacttag, splice branch and acceptor" FT CDS complement(join(1426111..1426218,1426279..1426497, FT 1426569..1427687,1427727..1427988,1428029..1428465, FT 1428505..1428623,1428867..1429005,1429050..1429082)) FT /colour=7 FT /gene="SPBC1215.02c" FT /label=SPBC1215.02c FT /note="SPBC1215.02c, len:811, SIMILARITY:Saccharomyces FT cerevisiae, DEC1_YEAST, dec1 protein, (796 aa), fasta FT scores: opt: 184, E():0.00014, (23.4% identity in 577 aa)" FT /product="similar to S. cerevisiae DEC1 mitochondrial FT inheritance and actin cytoskeleton organisation protein" FT /fasta_file="fasta/c1215.tab.seq.03950.out" FT misc_feature complement(1426219..1426228) FT /colour=6 FT /note="ctaataatag, splice branch and acceptor" FT misc_feature complement(1426273..1426278) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(1426498..1426512) FT /colour=6 FT /note="ctaaccgaattatag, splice branch and acceptor" FT misc_feature complement(1426563..1426568) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1427688..1427701) FT /colour=6 FT /note="ttaactcgtcgtag, splice branch and acceptor" FT misc_feature complement(1427721..1427726) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1427989..1428003) FT /colour=6 FT /note="ctaacttctccatag, splice branch and acceptor" FT misc_feature complement(1428023..1428028) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1428466..1428477) FT /colour=6 FT /note="ctaactcctcag, splice branch and acceptor" FT misc_feature complement(1428499..1428504) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature complement(1428624..1428637) FT /colour=6 FT /note="ttaactatttgaag, splice branch and acceptor" FT misc_feature complement(1428861..1428866) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1429006..1429021) FT /colour=6 FT /note="ttaacatcctttttag, splice branch and acceptor" FT misc_feature complement(1429044..1429049) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1430003..1430106 FT /note="nominal overlap with cosmid SPBC83, EM:AL096846 S. FT pombe chromosome 2" FT misc_feature 1430003..1430106 FT /note="nominal overlap with cosmid SPBC1215, EM:AL096846 FT S. pombe chromosome 2" FT CDS join(1430280..1430429,1430580..1430703,1430749..1433129) FT /colour=7 FT /gene="SPBC83.01" FT /label=SPBC83.01 FT /note="SPBC83.01, len:884, SIMILARITY:Schizosaccharomyces FT pombe, YAV1_SCHPO, hypothetical 193.3 kD protein c27f1.01c FT i n chromosome i., (1794 aa), fasta scores: opt: 272, FT E():4.9 e-05, (22.9% identity in 589 aa), SIMILARITY: FT yeast, YBE7_Y EAST, HYPOTHETICAL 150.8 kD PROTEIN, (1381 FT aa), opt:260, E( ):0.00014, (22.1% identity in 766 aa FT overlap) NOTE overlaps at C terminal with opposite strand FT orf SPBC83.02c" FT /product="predicted coiled-coil; UBA domain;EF hand FT motifs; some similarity to S. cerevisiae YDR190C and other FT cytoskeletal proteins" FT /fasta_file="fasta/c83.tab.seq.03725.out" FT misc_feature 1430430..1430435 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1430561..1430579 FT /colour=6 FT /note="ctaactgccaatttattag, splice branch and acceptor" FT misc_feature 1430704..1430709 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 1430735..1430748 FT /colour=6 FT /note="ctaacattaatcag, splice branch and acceptor" FT misc_feature 1431288..1431374 FT /colour=9 FT /note="Pfam match to entry PF00036 efhand, EF hand, score FT 18.60, E-value 0.096" FT misc_feature 1432644..1432754 FT /colour=9 FT /note="Pfam match to entry PF00627 UBA, UBA domain, score FT 24.60, E-value 0.0023" FT CDS complement(join(1433092..1433219,1433282..1433438)) FT /colour=2 FT /gene="rpl37a-2" FT /gene="rpl43-2" FT /gene="SPBC83.02c" FT /label=rpl37a-2 FT /note="SPBC83.02c, len:94, SIMILARITY:Saccharomyces FT cerevis iae, RL43_YEAST, 60S ribosomal protein L43, (91 FT aa), fasta scores: opt: 460, E():5.8e-26, (74.7% identity FT in 91 aa), NOTE overlaps at C terminal with opposite FT strand orf SPBC83.01" FT /product="60S ribosomal protein L37a/L43" FT /fasta_file="fasta/c83.tab.seq.03726.out" FT misc_feature complement(join(1433098..1433219,1433282..1433432)) FT /note="Match to PF01780 Ribosomal_L37ae, Ribosomal L37ae FT protein family Score 180.75" FT misc_feature complement(1433220..1433236) FT /colour=6 FT /note="ctaacgtttatgtatag, splice branch and acceptor" FT intron complement(1433220..1433281) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1433276..1433281) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS complement(1434178..1435827) FT /colour=8 FT /gene="SPBC83.03c" FT /label=SPBC83.03c FT /note="SPBC83.03c, len:549" FT /product="hypothetical serine-rich protein; sequence FT orphan" FT /fasta_file="fasta/c83.tab.seq.03727.out" FT CDS join(1436426..1436533,1436601..1436903) FT /colour=8 FT /gene="SPBC83.04" FT /label=SPBC83.04 FT /note="SPBC83.04, len:136" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c83.tab.seq.03728.out" FT misc_feature 1436534..1436539 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1436581..1436600 FT /colour=6 FT /note="ctaacttgaacgaatcttag, splice branch and acceptor" FT CDS 1437367..1439688 FT /colour=7 FT /gene="SPBC83.05" FT /label=SPBC83.05 FT /note="SPBC83.05, len:773, SIMILARITY:Saccharomyces FT cerevis iae, RN12_YEAST, RNA12 protein., (850 aa), fasta FT scores: op t: 717, E():0, (29.1% identity in 805 aa)" FT /product="possibly involved in early maturation of pre- FT rRNA and mitochondrial maintenance" FT /fasta_file="fasta/c83.tab.seq.03729.out" FT misc_feature 1437880..1438050 FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 22.73" FT CDS complement(1439911..1440090) FT /colour=7 FT /gene="SPBC83.06c" FT /label=SPBC83.06c FT /note="SPBC83.06c, len:59, SIMILARITY:Saccharomyces FT cerevis iae, YP83_YEAST, putative 60s mitochondrial FT ribosomal prote in ypl183bw ., (93 aa), fasta scores: opt: FT 221, E( ):1.2e-10, (64.4% identity in 45 aa)" FT /product="mitochondrial ribosomal protein L36" FT /fasta_file="fasta/c83.tab.seq.03730.out" FT misc_feature complement(1439914..1440027) FT /colour=9 FT /note="Pfam match to entry PF00444 Ribosomal_L36, FT Ribosomal protein L36" FT CDS join(1440970..1441086,1441143..1443284) FT /colour=10 FT /gene="SPBC83.07" FT /label=SPBC83.07 FT /note="SPBC83.07, len:752, SIMILARITY:Saccharomyces FT cerevis iae, YEZ9_YEAST, putative 90.2 kD zinc finger FT protein in cc a1-adk2 intergenic region., (796 aa), fasta FT scores: opt: 26 9, E():1.5e-09, (21.0% identity in 775 aa)" FT /product="transcription factor; zinc finger protein; jmjC FT domain; putative DNA damage response by similarity" FT /fasta_file="fasta/c83.tab.seq.03731.out" FT misc_feature 1441087..1441092 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1441125..1441142 FT /colour=6 FT /note="ttaacaaaatttgtttag, splice branch and acceptor" FT CDS join(1443706..1443754,1443856..1445204) FT /colour=7 FT /gene="SPBC83.08" FT /label=SPBC83.08 FT /note="SPBC83.08, len:465, SIMILARITY:Saccharomyces FT cerevisiae, Q12464, strong similar to TATA-binding protein- FT interacting protein 49 from rat, (471 aa), fasta scores : FT opt: 2123, E():0, (69.8% identity in 450 aa)" FT /product="putative 3' to 5' DNA/RNA helicase; possibly FT involved in ribosomal RNA processing; possibly protein for FT snoRNA accumulation; possibly required for the production FT of snoRNAs; similar to S. cerevisiae RVB1" FT /fasta_file="fasta/c83.tab.seq.03732.out" FT misc_feature 1443755..1443760 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1443836..1443855 FT /colour=6 FT /note="ctaatctttactgtttttag, splice branch and acceptor" FT misc_feature 1444020..1444043 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS complement(join(1445392..1446500,1446547..1446664)) FT /colour=10 FT /gene="SPBC83.09c" FT /label=SPBC83.09c FT /note="SPBC83.09c, len:408, SIMILARITY:Homo sapiens, FT G39834 27, cd2 cytoplasmic domain binding protein., (341 FT aa), fast a scores: opt: 167, E():0.0074, (29.4% identity FT in 296 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YHR156C" FT /fasta_file="fasta/c83.tab.seq.03733.out" FT misc_feature complement(1446501..1446518) FT /colour=6 FT /note="ctaacattcaattcacag, splice branch and acceptor" FT misc_feature complement(1446541..1446546) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT CDS 1447605..1448174 FT /colour=8 FT /gene="SPBC83.10" FT /label=SPBC83.10 FT /note="SPBC83.10, len:189" FT /product="hypothetical protein; sequence orphan; contains FT predicted N-terminal signal sequence" FT /fasta_file="fasta/c83.tab.seq.03734.out" FT CDS join(1448990..1449039,1449076..1450330) FT /colour=7 FT /gene="SPBC83.11" FT /label=SPBC83.11 FT /note="SPBC83.11, len:434, SIMILARITY:Zea mays, P93642, FT pho sphate/phosphoenolpyruvate translocator ., (390 aa ), FT fasta scores: opt: 390, E():1.8e-17, (30.3% identity in FT 294 aa)" FT /product="phosphate-phosphoenolpyruvate translocator" FT /fasta_file="fasta/c83.tab.seq.03735.out" FT misc_feature 1449040..1449045 FT /colour=6 FT /note="gtgaaa, splice donor sequence" FT misc_feature 1449063..1449075 FT /colour=6 FT /note="ctaactattgtag, splice branch and acceptor" FT misc_feature 1450970..1451158 FT /note="region associated with LTR and previous FT transposition event" FT CDS 1451717..1452202 FT /colour=8 FT /gene="SPBC83.12" FT /label=SPBC83.12 FT /note="SPBC83.12, len:161" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c83.tab.seq.03736.out" FT misc_feature 1451912..1451962 FT /colour=8 FT /note="PS00237 G-protein coupled receptors signature" FT LTR complement(1452318..1452650) FT /note="Tf2-type LTR" FT CDS 1453002..1453883 FT /colour=7 FT /gene="SPBC83.13" FT /label=SPBC83.13 FT /note="SPBC83.13, len:293, SIMILARITY:Saccharomyces FT cerevis iae, YM78_YEAST, hypothetical 34.2 kD protein in FT cus1-rpl20 a intergenic region., (314 aa), fasta scores: FT opt: 1050, E( ):0, (56.5% identity in 294 aa)" FT /product="MC transporter of unknown specificity" FT /fasta_file="fasta/c83.tab.seq.03737.out" FT misc_feature 1453032..1453208 FT /colour=9 FT /note="Pfam match to entry PF00153 mito_carr, FT Mitochondrial carrier proteins" FT misc_feature 1453386..1453874 FT /colour=9 FT /note="Pfam match to entry PF00153 mito_carr, FT Mitochondrial carrier protein" FT CDS complement(join(1454475..1455163,1455306..1455498, FT 1455560..1455754)) FT /colour=2 FT /gene="rfc5" FT /gene="SPBC83.14c" FT /label=rfc5 FT /note="SPBC83.14c, len:358, SIMILARITY:Homo sapiens, FT AC13_H UMAN, activator 1 38 kD subunit, (356 aa), fasta FT scores: op t: 1160, E():0, (49.7% identity in 354 aa)" FT /product="replication factor C (activator 1) subunit; FT activator of DNA polymerases" FT /fasta_file="fasta/c83.tab.seq.03738.out" FT misc_feature complement(1455164..1455179) FT /colour=6 FT /note="ctaacatgctccttag, splice branch and acceptor" FT misc_feature complement(1455300..1455305) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1455499..1455514) FT /colour=6 FT /note="ctcacaatgaatgtag, splice branch and acceptor" FT misc_feature complement(1455554..1455559) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS join(1456598..1456637,1456687..1456805,1456966..1457505, FT 1457567..1457664,1457787..1458153) FT /colour=10 FT /gene="SPBC83.15" FT /label=SPBC83.15 FT /note="SPBC83.15, len:387, SIMILARITY:Saccharomyces FT cerevis iae, YGL1_YEAST, hypothetical 51.9 kD protein in FT taf60-g4p1 intergenic region., (463 aa), fasta scores: FT opt: 184, E(): 0.00011, (25.5% identity in 329 aa)" FT /product="conserved protein; similar to S. cerevisiae FT YGL111W" FT /fasta_file="fasta/c83.tab.seq.03739.out" FT misc_feature 1456638..1456643 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 1456668..1456686 FT /colour=6 FT /note="ctaataaaggtgattatag, splice branch and acceptor" FT misc_feature 1456806..1456811 FT /colour=6 FT /note="gtacgg, splice donor sequence" FT misc_feature 1456948..1456965 FT /colour=6 FT /note="ttaacttgttaattttag, splice branch and acceptor" FT misc_feature 1457506..1457511 FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature 1457553..1457566 FT /colour=6 FT /note="ttaacaacaaatag, splice branch and acceptor" FT misc_feature 1457665..1457670 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1457773..1457786 FT /colour=6 FT /note="ttgaccaaatttag, splice branch and acceptor" FT CDS complement(1458500..1460191) FT /colour=10 FT /gene="SPBC83.16c" FT /label=SPBC83.16c FT /note="SPBC83.16c, len:563, SIMILARITY:Schizosaccharomyces FT pombe, O13693, hypothetical 67.1 kD protein c11e3.14 in FT chr omosome i., (588 aa), fasta scores: opt: 472, E():1.2e- FT 24, (24.0% identity in 579 aa)" FT /product="conserved protein; similar to S. cerevisiae IML2 FT and YKR018C; contains 3 predicted transmembrane helices" FT /fasta_file="fasta/c83.tab.seq.03740.out" FT CDS complement(1461151..1461510) FT /colour=9 FT /gene="SPBC83.19c" FT /label=SPBC83.19c FT /note="SPBC83.19c, len:161" FT /product="very hypothetical protein" FT /fasta_file="fasta/c83.tab.seq.03741.out" FT CDS 1462298..1462744 FT /colour=7 FT /gene="SPBC83.17" FT /label=SPBC83.17 FT /note="SPBC83.17, len:148, SIMILARITY:Saccharomyces FT cerevis iae, D1034183, mbf1 protein., (151 aa), fasta FT scores: opt: 585, E():2.5e-30, (59.6% identity in 151 aa)" FT /product="transcription factor; similar to S. cerevisiae FT MBF1" FT /fasta_file="fasta/c83.tab.seq.03742.out" FT misc_feature 1462541..1462705 FT /colour=9 FT /note="Pfam match to entry PF01381 HTH_3, Helix-turn-helix" FT CDS complement(join(1463594..1464364,1464418..1464465)) FT /colour=10 FT /gene="SPBC83.18c" FT /label=SPBC83.18c FT /note="SPBC83.18c, len:272, SIMILARITY:Saccharomyces FT cerevi siae, YNP2_YEAST, hypothetical 46.2 kD protein in FT yck2-rpc8 intergenic region., (409 aa), fasta scores: opt: FT 222, E(): 1.2e-05, (25.5% identity in 243 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YNL152W null lethal and interacts with a protein involved FT in cytokinesis in a 2-hybrid screen; C2 domain family FT protein" FT /fasta_file="fasta/c83.tab.seq.03743.out" FT misc_feature complement(1464193..1464441) FT /colour=9 FT /note="Pfam match to entry PF00168 C2, C2 domain" FT misc_feature complement(1464365..1464382) FT /colour=6 FT /note="ctaacgtgtcttctttag, splice branch and acceptor" FT misc_feature complement(1464412..1464417) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1466143..1467237) FT /note="nominal overlap with cosmid SPD972HA D83992 Fission FT yeast DNA for ISP4, peptidyl-prolyl cis-trans isomerase, FT atf1, chromosome II cosmid 1228 sequence." FT misc_feature 1467137..1467237 FT /note="nominal overlap with SPBC83 S. pombe chromosome 2" FT CDS 1467360..1469060 FT /colour=2 FT /gene="atf1" FT /gene="mts1" FT /gene="sss1" FT /gene="gad7" FT /gene="SPBC29B5.01" FT /label=atf1 FT /note="SPBC29B5.01, len:567" FT /product="transcription factor; heterodimeric FT transcriptional activator; binds M26 recombination FT hotspot; stimulated by the stress-activated Sty1p MAP FT kinase cascade; bZIP (Basic-leucine zipper) transcription FT factor family; multicopy supressor of calcium sensitivty; FT multicopy supressor of calcium sensitivity of Atf1 (PMID: FT 10102365)" FT /fasta_file="fasta/c29B5.tab.seq.04309.out" FT misc_feature 1468794..1468961 FT /note="Match to PF00170 bZIP, bZIP transcription factor FT Score 48.62" FT CDS complement(1470133..1472490) FT /colour=2 FT /gene="isp4" FT /gene="SPBC29B5.02c" FT /label=isp4 FT /note="SPBC29B5.02c, len:786" FT /product="sexual differentiation process protein" FT /fasta_file="fasta/c29B5.tab.seq.04310.out" FT misc_feature 1472614..1477863 FT /note="low complexity gene free region" FT misc_feature 1473553..1473841 FT /note="region of unusual composition" FT misc_feature 1475515..1475722 FT /note="region of unusual composition" FT CDS complement(1477939..1478319) FT /colour=2 FT /gene="rpl26" FT /gene="SPBC29B5.03c" FT /label=rpl26 FT /note="SPBC29B5.03c, len:127" FT /product="60S ribosomal protein L26" FT /fasta_file="fasta/c29B5.tab.seq.04311.out" FT misc_feature complement(1478002..1478175) FT /note="Match to PF00467 Ribosomal_L24, KOW motif Score FT 83.61" FT CDS complement(1479004..1480821) FT /colour=10 FT /gene="SPBC29B5.04c" FT /note="SPBC29B5.04c, len:606" FT /product="hypothetical protein; similar to S. cerevisiae FT YNL094W" FT /fasta_file="fasta/c29B5.tab.seq.04312.out" FT misc_feature 1481131..1481283 FT /note="nominal overlap with SPBC27 S. pombe chromosome 2" FT misc_feature 1481131..1481283 FT /note="nominal overlap with c29B5 S. pombe chromosome 2" FT CDS complement(1481336..1481734) FT /colour=7 FT /gene="SPBC27.01c" FT /label=SPBC27.01c FT /note="SPBC27.01c, len:132, SIMILARITY:Merxmuellera davyi., FT O47309, RNA polymerase beta-subunit, (153 aa), fasta FT scores: opt: 129, E():0.13, (27.1% identity in 107 aa)" FT /product="putative RNA polymerase beta-subunit" FT /fasta_file="fasta/c27.tab.seq.04202.out" FT CDS complement(join(1482207..1482965,1483044..1483191, FT 1483247..1483263)) FT /colour=7 FT /gene="SPBC27.02c" FT /label=SPBC27.02c FT /note="SPBC27.02c, len:307, SIMILARITY:Saccharomyces FT cerevisiae, YKF2_YEAST, hypothetical 32.1 kD protein in FT nup120-cse4 intergenic region., (292 aa), fasta scores: FT opt: 201, E():1.8e-05, (27.1% identity in 284 aa)" FT /product="possibly associated with spindle kinetochores; FT putative Duo1p-Dam1p-Dad1p complex; similar to S. FT cerevisiae ASK1" FT /fasta_file="fasta/c27.tab.seq.04203.out" FT misc_feature complement(1482966..1482979) FT /colour=6 FT /note="ctaacagaaaacag, splice branch and acceptor" FT misc_feature complement(1483038..1483043) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1483192..1483207) FT /colour=6 FT /note="ctaacaaaagaattag, splice branch and acceptor" FT misc_feature complement(1483241..1483246) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT CDS 1483601..1485469 FT /colour=2 FT /gene="meu25" FT /gene="SPBC27.03" FT /label=meu25 FT /note="SPBC27.03, len:622, SIMILARITY:Saccharomyces FT cerevisiae, YJC0_YEAST, hypothetical 86.1 kD protein in FT pet130-cct3 intergenic region., (771 aa), fasta scores: FT opt: 133, E():0.61, (23.7% identity in 333 aa)" FT /product="meiotic expression upregulated; no apparent FT orthologs" FT /fasta_file="fasta/c27.tab.seq.00022.out" FT CDS 1486102..1489260 FT /colour=7 FT /gene="SPBC27.04" FT /label=SPBC27.04 FT /note="SPBC27.04, len:1052, SIMILARITY:Schizosaccharomyces FT pombe, P78941, fission yeast DNA for isp4, peptidyl-prolyl FT cis-trans isomerase, atf1,chromosome ii cosmid 1228 FT sequence., (188 aa), fasta scores: opt: 1047, E():0, FT (89.1% identity in 184 aa)" FT /product="predicted coiled-coil protein; similar to S. FT cerevisiae RAD50; possibly involved in recombinational DNA FT repair" FT /fasta_file="fasta/c27.tab.seq.04205.out" FT CDS 1489445..1489771 FT /colour=8 FT /gene="SPBC27.05" FT /label=SPBC27.05 FT /note="SPBC27.05, len:107" FT /product="hypothetical protein; sequence orphan; has FT transcript profile on microarray but this could be FT generated by SPBC27.04 proximal and has the same FT expression pattern" FT /fasta_file="fasta/c27.tab.seq.04206.out" FT CDS complement(join(1490146..1490474,1490518..1490551)) FT /colour=10 FT /gene="SPBC27.06c" FT /label=SPBC27.06c FT /note="SPBC27.06c, len:120, SIMILARITY:Saccharomyces FT cerevisiae, Q02889, lpg10p., (113 aa), fasta scores: opt: FT 282, E():1.8e-12, (58.0% identity in 69 aa)" FT /product="conserved protein; similar to S. cerevisiae FT LPG10" FT /fasta_file="fasta/c27.tab.seq.04207.out" FT misc_feature complement(1490475..1490488) FT /colour=6 FT /note="ttaacactgaacag, splice branch and acceptor" FT intron complement(1490475..1490517) FT /note="Intron confirmed by mRNA" FT misc_feature complement(1490512..1490517) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1491490..1492071) FT /note="Match to PF01747 ATP-sulfurylase, ATP-sulfurylase FT Score 226.78" FT misc_feature 1491960..1492073 FT /note="Nominal overlap with SPBC28F2 AL121795 S.pombe FT chromosome II cosmid c28F2" FT misc_feature 1493299..1493304 FT /colour=11 FT /note="XbaI" FT CDS 1494226..1495104 FT /colour=10 FT /gene="SPBC28F2.02" FT /label=SPBC28F2.02 FT /note="SPBC28F2.02, len:292, SIMILARITY:Saccharomyces FT cerevisiae, Q12000, chromosome xv reading frame orf FT yor091w., (401 aa), fasta scores: opt: 360, E():3.2e-14, FT (33.9% identity in 339 aa)" FT /product="conserved protein; putative nuclear pore complex FT associated; similar to S. cerevisiae YOR091W" FT /fasta_file="fasta/c28F2.tab.seq.03456.out" FT misc_feature 1495700..1495705 FT /colour=11 FT /note="XbaI" FT CDS 1496028..1496516 FT /EC_number="5.2.1.8" FT /colour=2 FT /gene="ppi1" FT /gene="cyp2" FT /gene="SPBC28F2.03" FT /label=ppi1 FT /note="SPBC28F2.03, len:162" FT /product="cyclophilin-2; peptidyl-prolyl cis-trans FT isomerase; Snw1p interacting" FT /fasta_file="fasta/c28F2.tab.seq.03457.out" FT misc_feature 1496034..1496507 FT /note="Match to PF00160 pro_isomerase, Peptidyl-prolyl cis- FT trans isomerase Score 402.40" FT CDS complement(join(1497106..1497635,1497675..1497708)) FT /colour=2 FT /gene="spf27" FT /gene="cwf7" FT /gene="SPBC28F2.04c" FT /label=spf27 FT /note="SPBC28F2.04c, len:187, LOW FT SIMILARITY:Caenorhabditis elegans., Q22417, cosmid t12a2., FT (254 aa), fasta scores: opt: 155, E():0.0015, (26.7% FT identity in 172 aa)" FT /product="putative spliceosome associated protein; 40S FT snRNP-containing complex component; possibly involved in FT pre-mRNA splicing; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c28F2.tab.seq.03458.out" FT misc_feature complement(1497636..1497652) FT /colour=6 FT /note="ctaatcaaattatttag, splice branch and acceptor" FT misc_feature complement(1497669..1497674) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS complement(1497874..1498704) FT /colour=7 FT /gene="SPBC28F2.05c" FT /label=SPBC28F2.05c FT /note="SPBC28F2.05c, len:276, FT SIMILARITY:Schizosaccharomyces pombe, O14088, putative FT oxidoreductase c2f3.05c, (275 aa), fasta scores: opt: 586, FT E():1.7e-32, (36.6% identity in 265 aa)" FT /product="putative oxidoreductase" FT /fasta_file="fasta/c28F2.tab.seq.03459.out" FT misc_feature complement(1497931..1498662) FT /note="Match to PF00248 aldo_ket_red, Aldo/keto reductase FT family Score 168.73" FT CDS complement(1498826..1499647) FT /colour=2 FT /gene="mdm12" FT /gene="SPBC28F2.06c" FT /label=mdm12 FT /note="SPBC28F2.06c, len:273" FT /product="mitochondrial inheritance component; similar to FT S. cerevisiae MDM12" FT /fasta_file="fasta/c28F2.tab.seq.03460.out" FT CDS 1500387..1501286 FT /colour=8 FT /gene="SPBC28F2.07" FT /label=SPBC28F2.07 FT /note="SPBC28F2.07, len:299" FT /product="hypothetical protein; sequence orphan; predicted FT coiled-coil" FT /fasta_file="fasta/c28F2.tab.seq.00038.out" FT misc_feature 1501364..1501369 FT /colour=12 FT /note="NheI" FT CDS complement(1501802..1503943) FT /colour=10 FT /gene="SPBC28F2.08c" FT /label=SPBC28F2.08c FT /note="SPBC28F2.08c, len:713" FT /product="SEL 1 repeat protein; low similar to S. FT cerevisiae hrd3; predicted N-terminal signal sequence; FT contains 1 predicted transmembrane helix; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c28F2.tab.seq.03462.out" FT misc_feature 1502897..1502902 FT /colour=12 FT /note="NheI" FT CDS join(1504921..1504938,1504984..1505085,1505127..1506116) FT /colour=7 FT /gene="SPBC28F2.09" FT /label=SPBC28F2.09 FT /note="SPBC28F2.09, len:369, LOW SIMILARITY:Arabidopsis FT thaliana, O49349, transcription factor iia large subunit., FT (375 aa), fasta scores: opt: 340, E():3.2e-12, (26.4% FT identity in 397 aa)" FT /product="putative transcription initiation factor TFIIA FT large subunit; similar to S. cerevisiae TOA1" FT /fasta_file="fasta/c28F2.tab.seq.03463.out" FT misc_feature 1504939..1504944 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1504967..1504983 FT /colour=6 FT /note="ctaatgtttttatcaag, splice branch and acceptor" FT misc_feature 1505086..1505091 FT /colour=6 FT /note="gtacgg, splice donor sequence" FT misc_feature 1505115..1505126 FT /colour=6 FT /note="ctaataaaacag, splice branch and acceptor" FT misc_feature 1505729..1505734 FT /colour=11 FT /note="XbaI" FT CDS complement(1506386..1508041) FT /colour=2 FT /gene="kap1" FT /gene="SPBC28F2.10c" FT /label=kap1 FT /note="SPBC28F2.10c, len:551, SIMILARITY:Saccharomyces FT cerevisiae, ADA3_YEAST, ada3 protein, (702 aa), fasta FT scores: opt: 350, E():1.6e-12, (27.9% identity in 549 aa)" FT /product="kinesin-associated protein; putative SAGA FT complex (Spt-Ada-Gcn5-Acetyltransferase); putative ADA FT complex; similar to S. cerevisiae NGG1" FT /fasta_file="fasta/c28F2.tab.seq.03464.out" FT misc_feature 1506648..1506653 FT /colour=11 FT /note="XbaI" FT CDS join(1509058..1509087,1509280..1510182) FT /colour=7 FT /gene="SPBC28F2.11" FT /label=SPBC28F2.11 FT /note="SPBC28F2.11, len:310, SIMILARITY:Spalax leucodon FT ehrenbergi, O88612, high mobility group protein., (215 aa), FT fasta scores: opt: 258, E():2.3e-06, (36.8% identity in FT 114 aa)" FT /product="putative transcription factor; HMG box" FT /fasta_file="fasta/c28F2.tab.seq.03465.out" FT misc_feature 1509088..1509093 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1509260..1509279 FT /colour=6 FT /note="ctaacaaattgccgtcttag, splice branch and acceptor" FT misc_feature 1509598..1509810 FT /note="Match to PF00505 HMG_box, HMG (high mobility group) FT box Score 60.37" FT misc_feature 1509949..1509954 FT /colour=11 FT /note="XbaI" FT CDS join(1510853..1510867,1510903..1510928,1510969..1511041, FT 1511081..1511156,1511202..1511261,1511354..1511460, FT 1511508..1516409) FT /EC_number="2.7.7.6" FT /colour=2 FT /gene="rpb1" FT /gene="SPBC28F2.12" FT /label=rpb1 FT /note="SPBC28F2.12, len:1752" FT /product="DNA-directed RNA polymerase II largest subunit; FT similar to S. cerevisiae RPO21" FT /fasta_file="fasta/c28F2.tab.seq.03466.out" FT misc_feature 1510868..1510873 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1510892..1510902 FT /colour=6 FT /note="ctaatacatag, splice branch and acceptor" FT misc_feature 1510929..1510934 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1510956..1510968 FT /colour=6 FT /note="ctaacagtattag, splice branch and acceptor" FT misc_feature 1511042..1511047 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1511157..1511162 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 1511185..1511201 FT /colour=6 FT /note="ctcacacattttgtaag, splice branch and acceptor" FT misc_feature 1511262..1511267 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1511340..1511353 FT /colour=6 FT /note="ctaacacctttcag, splice branch and acceptor" FT misc_feature 1511461..1511466 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1511494..1511507 FT /colour=6 FT /note="ctaacattataaag, splice branch and acceptor" FT misc_feature 1511862..1513784 FT /note="Match to PF00623 RNA_pol_A, RNA polymerase alpha FT subunit Score 1441.10" FT tRNA complement(1517695..1517768) FT /note="tRNA Asn anticodon GTT, Cove score 86.64" FT tRNA complement(1517774..1517854) FT /note="tRNA Met anticodon CAT, Cove score 55.15" FT intron complement(1517810..1517816) FT /note="intron tRNA Met anticodon CAT" FT tRNA 1518210..1518293 FT /note="tRNA Tyr anticodon GTA, Cove score 70.26" FT intron 1518248..1518257 FT /note="intron tRNA Tyr anticodon GTA" FT tRNA complement(1518444..1518544) FT /note="tRNA Leu anticodon CAA, Cove score 56.07" FT intron complement(1518488..1518506) FT /note="intron tRNA Leu anticodon CAA" FT tRNA complement(1519036..1519106) FT /note="tRNA Gly anticodon GCC, Cove score 72.94" FT tRNA 1519405..1519487 FT /note="tRNA Lys anticodon CTT, Cove score 74.83" FT intron 1519444..1519451 FT /note="intron tRNA Lys anticodon CTT" FT tRNA 1519785..1519858 FT /note="tRNA Ile anticodon AAT, Cove score 66.44" FT tRNA complement(1519932..1520005) FT /note="tRNA Ala anticodon AGC, Cove score 67.24" FT tRNA complement(1520666..1520748) FT /note="tRNA Val anticodon AAC, Cove score 64.30" FT intron complement(1520702..1520710) FT /note="intron tRNA Val anticodon AAC" FT tRNA complement(1521190..1521261) FT /note="tRNA Glu anticodon TTC, Cove score 62.18" FT tRNA 1521887..1521959 FT /note="tRNA Arg anticodon ACG, Cove score 75.46" FT tRNA complement(1522046..1522116) FT /note="tRNA Asp anticodon GTC, Cove score 70.49" FT misc_feature complement(1524485..1529348) FT /colour=3 FT /note="dgII repeat" FT misc_feature complement(1529349..1529739) FT /colour=12 FT /note="SPCEN253 Yeast centromere CEN2 repetitive DNA FT PSS253, between dhIIa and dgIIa" FT misc_feature complement(1529349..1529739) FT /colour=7 FT /note="cen253 Yeast centromere CEN2 repetitive DNA PSS253, FT between dhIIa and dgIIa" FT misc_feature complement(1529740..1531279) FT /colour=2 FT /note="dhII repeat partial" FT CDS join(1405851..1405935,1405983..1406099,1406171..1406624, FT 1406758..1407637) FT /colour=7 FT /gene="SPBC32H8.14" FT /gene="pi010" FT /label=SPBC32H8.14 FT /note="SPACTOKYO_453.26c, len:511, SIMILARITY:Rhizomucor FT pusillus., O94738, alg2., (455 aa), fasta scores: opt: FT 1219, E():0, (44.3% identity in 460 aa)" FT /note="SPACTOKYO_453.27, len:512" FT /product="putative glycosyl transferase" FT /fasta_file="fasta/c32H8.tab.seq.04308.out" FT /gene="SPBC11B10.01" FT /label=SPBC11B10.01 FT /product="glycosyl transferase" FT /fasta_file="fasta/c11B10.tab.seq.04392.out" FT CDS complement(join(1350454..1351929,1352059..1352589)) FT /colour=7 FT /gene="SPBC691.05c" FT /gene="SPBP22H7.01c" FT /gene="pi030" FT /label=SPBC691.05c FT /note="SPACTOKYO_453.04, len:668, SIMILARITY:Drosophila FT melanogaster, O97132, abnormal x segregation., (646 aa), FT fasta scores: opt: 308, E():2.5e-12, (24.0% identity in FT 608 aa)" FT /product="putative ion channel protein; similar to S. FT cerevisiae YBR086C" FT /fasta_file="fasta/c691.tab.seq.04263.out" FT /label=SPBP22H7.01c FT /fasta_file="fasta/p22H7.tab.seq.04382.out" FT CDS complement(1320117..1321475) FT /colour=7 FT /gene="SPBC8D2.21c" FT /gene="SPBC17A3.01c" FT /label=SPBC8D2.21c FT /note="SPBC8D2.21c, len:215, SIMILARITY:Saccharomyces FT cerevisiae, YPL063W, Q02776, similar to caenorhabditis FT elegans celf45e12_5 f45e12.1 gene product., (476 aa), FT fasta scores: opt: 424, E():3.1e-19, (38.9% identity in FT 208 aa)" FT /product="conserved protein; similar to S. cerevisiae FT PSR1; possible plasma membrane phosphatase involved in FT sodium stress response" FT /fasta_file="fasta/c8D2.tab.seq.00046.out" FT /gene="pi044" FT /label=SPBC17A3.01c FT /note="SPBC17A3.01c, len:452, SIMILARITY:Saccharomyces FT cerevisiae, Q02776, unknown, (476 aa), fasta scores, opt: FT 938, E():0, (39.5% identity in 418 aa overlap)" FT /fasta_file="fasta/c17A3.tab.seq.03909.out" FT CDS complement(1219190..1220224) FT /colour=10 FT /gene="SPBC3D6.14c" FT /gene="SPBC30B4.01c" FT /label=SPBC3D6.14c FT /note="SPBC3D6.14c, len:310, SIMILARITY:Saccharomyces FT cerev isiae, YN23_YEAST, hypothetical 52.3 kD protein, FT (503 aa), fasta scores: opt: 522, E():3.1e-16, (38.2% FT identity in 325 aa)" FT /product="hypothetical serine-rich protein (52 consecutive FT serines); contains WSC domain; possibly involved in FT carbohydrate binding; putative proteophosphoglycan; FT subcellular localization of GFP fusion-Membrane" FT /fasta_file="fasta/c3D6.tab.seq.03008.out" FT /label=SPBC30B4.01c FT /note="SPBC30B4.01c, len:344aa, similarity, YNL283C, FT YN23_YEAST, P53832, glucoamylase III, (503aa), fasta FT scores, opt:567, E():1.9e-16, (37.2% identity in 366 aa FT ove rlap)" FT /fasta_file="fasta/c30B4.tab.seq.02586.out" FT CDS complement(1097779..1100091) FT /colour=7 FT /gene="SPBC409.22c" FT /gene="SPBC1306.01c" FT /label=SPBC409.22c FT /note="SPBC409.22c, len:558, SIMILARITY:Saccharomyces FT cerevisiae, EFG1_YEAST, elongation factor g, mitochondrial FT 1 , (761 aa), fasta scores: opt: 2242, E():0, (59.1% FT identity in 558 aa)" FT /product="putative elongation factor g, mitochondrial; FT similar to S. cerevisiae MEF1)" FT /fasta_file="fasta/c409.tab.seq.03948.out" FT /label=SPBC1306.01c FT /note="SPBC1306.01c, len:251, SIMILARITY:Saccharomyces FT cerevisiae, EFG1_YEAST, elongation factor g 1, FT mitochondrial , (761 aa), fasta scores: opt: 598, E():1.9e- FT 30, (62.0% identity in 255 aa)" FT /product="putative elongation factor G, mitochondrial 1 FT (EF-G)" FT /fasta_file="fasta/c1306.tab.seq.04151.out" FT CDS join(1015057..1017056,1017104..1017884) FT /EC_number="2.4.1.16" FT /colour=2 FT /gene="chs2" FT /gene="SPBC1709.01" FT /gene="SPBC1734.17" FT /label=chs2 FT /note="SPBC1734.17, len:925" FT /product="chitin synthase 2" FT /fasta_file="fasta/c1734.tab.seq.03297.out" FT /note="SPBC1709.01, len:191" FT /product="chitin synthase 2; similar to S. cerevisiae CHS2" FT /fasta_file="fasta/c1709.tab.seq.03260.out" FT CDS complement(948815..951637) FT /colour=7 FT /gene="sec26" FT /gene="SPBC146.14c" FT /gene="SPBC337.01c" FT /label=sec26 FT /note="SPBC146.14c, len:940, SIMILARITY:Drosophila FT melanogaster, COPB_DROME, coatomer beta subunit, (962 aa), FT fasta scores: opt: 2375, E():0, (40.5% identity in 959 aa)" FT /product="putative coatomer beta subunit" FT /fasta_file="fasta/c146.tab.seq.03868.out" FT /note="SPBC337.01c, len:425, SIMILARITY:Saccharomyces FT cerevisiae, YDR238C, COPB_YEAST, coatomer beta subunit, FT (973 aa) , fasta scores: opt: 1170, E():0, (44.8% identity FT in 415 aa )" FT /product="putative coatomer beta subunit; similar to S. FT cerevisiae SEC26" FT /fasta_file="fasta/c337.tab.seq.03484.out" FT CDS complement(join(878368..879273,879313..879915, FT 879963..880088)) FT /colour=10 FT /gene="SPBC646.17c" FT /gene="SPBP35G2.01c" FT /label=SPBC646.17c FT /note="SPBC646.17c, SIMILARITY:Mus musculus, DYI2_MOUSE, FT dynein intermediate chain 2, cytosolic, (612 aa), fasta FT scores: opt: 282, E():3.1e-11, (32.5% identity in 286 aa)" FT /product="WD repeat protein; no apparent S. cerevisiae FT ortholog" FT /fasta_file="fasta/c646.tab.seq.03666.out" FT /gene="SPBC855.01c" FT /label=SPBC855.01c FT /fasta_file="fasta/c855.tab.seq.04282.out" FT /label=SPBP35G2.01c FT /note="SPBP35G2.01c" FT /fasta_file="fasta/p35G2.tab.seq.04159.out" FT CDS complement(834970..841983) FT /EC_number="2.7.1.137" FT /colour=2 FT /gene="tor2" FT /gene="SPBC216.07c" FT /gene="SPBC646.01c" FT /label=tor2 FT /note="SPBC216.07c, len:1973, FT SIMILARITY:Schizosaccharomyces pombe, O14356, putative FT phosphatidylinositol 3-kinase c30d10.10c, (2335 aa), fasta FT scores: opt: 6887, E():0, (53.5% identity in 1974 aa)" FT /product="phosphatidylinositol kinase related kinase" FT /fasta_file="fasta/c216.tab.seq.03809.out" FT /function="essential" FT /note="SPBC646.01c, SIMILARITY:Schizosaccharomyces pombe, FT O14356, putative phosphatidylinositol 3-kinase c30d10.10c, FT (2335 aa), fasta scores: opt: 1171, E():0, (44.8% identity FT in 397 aa)" FT /product="putative phosphatidylinositol kinase related FT kinase" FT /fasta_file="fasta/c646.tab.seq.03650.out" FT CDS complement(join(784455..784943,784987..785380, FT 785437..785693)) FT /colour=2 FT /gene="git7" FT /gene="SPBC36.12c" FT /gene="SPBC713.01c" FT /label=git7 FT /note="SPBC36.12c, len:444, SIMILARITY:Homo sapiens, FT Q9Y2Z0, suppressor of g2 allele of skp1 homolog., (333 aa), FT fasta scores: opt: 429, E():4.7e-20, (35.2% identity in FT 236 aa)" FT /product="glucose insensitive transcription" FT /fasta_file="fasta/c36.tab.seq.02481.out" FT /note="SPBC713.01c, len:433" FT /fasta_file="fasta/c713.tab.seq.03234.out" FT CDS complement(748790..750340) FT /colour=7 FT /gene="SPBC661.01" FT /gene="SPBC530.15c" FT /label=SPBC530.15c FT /note="SPBC530.15c, len:349, FT SIMILARITY:Schizosaccharomyces pombe, O59699, membrane FT transporter., (577 aa), fasta scores: opt: 1369, E():0, FT (54.4% identity in 344 aa)" FT /product="MFS transporter of unknown specificity" FT /fasta_file="fasta/c530.tab.seq.03128.out" FT /label=SPBC661.01 FT /note="SPBC661.01" FT /fasta_file="fasta/c661.tab.seq.03454.out" FT CDS join(670485..670604,670656..673514) FT /colour=7 FT /gene="SPBC119.17" FT /gene="SPBC577.01" FT /label=SPBC119.17 FT /note="SPBC119.17, SIMILARITY:Saccharomyces cerevisiae, FT YD30_YEAST, hypothetical 112.2 kD protein, (989 aa), fasta FT scores: opt: 2098, E():0, (40.1% identity in 873 aa)" FT /product="putative zinc metallopeptidase" FT /fasta_file="fasta/c119.tab.seq.02912.out" FT /label=SPBC577.01 FT /note="SPBC577.01, len:691, SIMILARITY:Saccharomyces FT cerevisiae, YD30_YEAST, hypothetical 112.2 kD protein in FT tif35-npl3 intergenic region, (989 aa), fasta scores: opt: FT 1328, E():0, (35.4% identity in 706 aa)" FT /fasta_file="fasta/c577.tab.seq.03996.out" FT CDS join(603842..604816,604898..605059) FT /colour=2 FT /gene="dps" FT /gene="SPBPJ694.01" FT /gene="SPBPJ4664.01" FT /label=dps FT /note="SPBPJ694.01, len:378" FT /product="decaprenyl diphosphate synthase" FT /fasta_file="fasta/pJ694.tab.seq.04194.out" FT /note="116 (+3) 356 378 TR:O43091 O43091 DECAPRENYL FT DIPHOSPHATE SYNTHASE. [0]" FT /fasta_file="fasta/pJ4664.tab.seq.04375.out" FT CDS 514171..516447 FT /colour=7 FT /gene="SPBC1706.03" FT /gene="SPBC839.01" FT /label=SPBC1706.03 FT /note="SPBC1706.03, len:757, SIMILARITY:Saccharomyces FT cerevisiae, YB29_YEAST, hypothetical 97.8 kD protein, (855 FT aa), fasta scores: opt: 553, E():3.9e-27, (32.0% identity FT in 819 aa)" FT /product="putative Transmembrane GTPase required for FT mitochondrial fusion and maintenance of mitochondrial DNA FT by similar to S. cerevisiae fzo1" FT /fasta_file="fasta/c1706.tab.seq.02968.out" FT /label=SPBC839.01 FT /note="SPBC839.01, len:706aa, similar eg. to YBR179C, YB29 FT _YEAST, P38297, hypothetical 97.8 kD protein, (855aa), FT fast a scores, opt:529, E():0, (33.2% identity in 729 aa FT overlap )" FT /fasta_file="fasta/c839.tab.seq.03837.out" FT CDS join(463120..463137,463183..463251,463367..463537, FT 463591..464424) FT /colour=2 FT /gene="gtp1" FT /gene="SPBC649.06" FT /gene="SPBC354.01" FT /label=gtp1 FT /note="SPBC649.06," FT /product="GTP-binding protein; GTP1/OBG family" FT /fasta_file="fasta/c649.tab.seq.03014.out" FT /note="SPBC354.01, len:>408" FT /fasta_file="fasta/c354.tab.seq.02832.out" FT CDS complement(join(358973..360886,360928..361036, FT 361091..361183,361240..361366,361417..361450, FT 361492..361531,361615..361640)) FT /colour=7 FT /gene="SPBC582.11c" FT /gene="SPBC428.01c" FT /label=SPBC582.11c FT /note="SPBC582.11c, len:780, SIMILARITY:Rattus norvegicus, FT N107_RAT, nuclear pore complex protein nup107, (926 aa), FT fasta scores: opt: 653, E():0, (26.2% identity in 725 aa); FT , putative exon at 25802-25841, except makes prediction FT out of frame" FT /product="putative nuclear pore protein; nucleoporin; FT similar to S. cerevisiae NUP84" FT /fasta_file="fasta/c582.tab.seq.03881.out" FT /label=SPBC428.01c FT /note="SPBC428.01c, len:280, LOW SIMILARITY:Rattus FT norvegic us, N107_RAT, nuclear pore complex protein nup107, FT (926 aa) , fasta scores: opt: 226, E():6.4e-07, (27.6% FT identity in 2 03 aa)" FT /fasta_file="fasta/c428.tab.seq.03581.out" FT CDS 293588..295624 FT /colour=2 FT /gene="mph1" FT /gene="SPBC1271.16c" FT /gene="SPBC106.01" FT /gene="SPBC243.01" FT /label=mph1 FT /note="SPBC1271.16c," FT /product="Mps1-like family member; serine/threonine FT protein kinase; dual specificity protein kinase; required FT for the spindle checkpoint in S. pombe; similar to S. FT cerevisiae MPS1; non-essential" FT /fasta_file="fasta/c1271.tab.seq.03559.out" FT /note="SPBC243.01, len:" FT /fasta_file="fasta/c243.tab.seq.03717.out" FT /note="SPBC106.01" FT /fasta_file="fasta/c106.tab.seq.03976.out" FT CDS complement(join(154202..154222,154293..159212)) FT /colour=7 FT /gene="SPBC660.18c" FT /gene="SPBC31E1.01c" FT /label=SPBC660.18c FT /note="SPBC660.18c, len:270, SIMILARITY:Homo sapiens, FT O43154, kiaa0404, (1956 aa), fasta scores: opt: 331, FT E():4e-14, (29.9% identity in 268 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT APG2 involved in autophagy sporulation and protein- FT vacuolar targetting; predicted N-terminal signal sequence" FT /fasta_file="fasta/c660.tab.seq.03110.out" FT /label=SPBC31E1.01c FT /note="SPBC31E1.01c, len:>1595, SIMILARITY:Saccharomyces FT cerevisiae, YNY2_YEAST, hypothetical 178.4 kD protein in FT sla2-zwf1 intergenic region., (1592 aa), fasta scores: FT opt: 640, E():5.2e-32, (22.0% identity in 1589 aa)" FT /fasta_file="fasta/c31E1.tab.seq.03797.out" FT CDS 24827..26572 FT /colour=7 FT /gene="SPBPB10D8.08" FT /gene="SPBC359.01" FT /label=SPBPB10D8.08 FT /product="putative amino acid permease" FT /fasta_file="fasta/pB10D8.tab.seq.04374.out" FT /label=SPBC359.01 FT /note="SPBC359.01, len:431, SIMILARITY:Schizosaccharomyces FT pombe, CAB63555, amino-acid permease, (423 aa), fasta FT scores: opt: 2407, E():0, (84.2% identity in 424 aa)" FT /fasta_file="fasta/c359.tab.seq.00013.out" FT CDS complement(117798..118841) FT /colour=2 FT /fasta_file="fasta/c1198.tab.seq.00033.out" FT /gene="fbp1" FT /gene="SPBC1198.14c" FT /gene="SPBC660.04c" FT /label=fbp1 FT /note="SPBC1198.14c, len:344" FT /product="fructose-1,6-bisphosphatase" FT /note="SPBC660.04c, len:347" FT /fasta_file="fasta/c660.tab.seq.03096.out" FT CDS complement(join(111635..111845,111897..112223, FT 112265..113241)) FT /colour=2 FT /fasta_file="fasta/c1198.tab.seq.00030.out" FT /gene="reb1" FT /gene="SPBC1198.11c" FT /gene="SPBC660.01c" FT /label=reb1 FT /note="SPBC1198.11c, len:504, SIMILARITY:Kluyveromyces FT lactis, REB1_KLULA, DNA-binding protein reb1, (595 aa), FT fasta scores: opt: 391, E():1.8e-17, (24.2% identity in FT 500 aa)" FT /product="DNA-binding termination factor for RNA FT polymerase I transcription; Myb family DNA-binding FT protein; similar to S. cerevisiae REB1" FT /note="SPBC660.01c, len:504" FT /fasta_file="fasta/c660.tab.seq.03093.out" FT CDS join(168786..168887,168935..172198) FT /colour=7 FT /gene="SPBC31E1.06" FT /label=SPBC31E1.06 FT /note="SPBC31E1.06, len:837, SIMILARITY:Homo sapiens, FT Q14692, kiaa0187 protein., (1282 aa), fasta scores: opt: FT 1520, E():0, (38.2% identity in 1007 aa)" FT /product="possibly involved in cell polarity; similar to FT S. cerevisiae BMS1" FT /fasta_file="fasta/c31E1.tab.seq.03802.out" FT /gene="SPBC800.01" FT /label=SPBC800.01 FT /note="SPBC800.01, len:342, SIMILARITY:Saccharomyces FT cerevisiae, Q08965, chromosome xvi reading frame orf FT ypl217c., (1183 aa), fasta scores: opt: 1298, E():0, FT (54.8% identity in 341 aa)" FT /fasta_file="fasta/c800.tab.seq.04268.out" FT CDS complement(241361..242383) FT /colour=7 FT /gene="SPBC1773.17c" FT /gene="SPBP26C9.01c" FT /label=SPBC1773.17c FT /note="SPBC1773.17c, SIMILARITY:Saccharomyces cerevisiae, FT YNL274C, YN14_YEAST,similar to glycerate- and fo rmate- FT dehydrogenases, (350 aa), fasta scores: opt: 497, E() FT :1.8e-26, (46.2% identity in 171 aa)" FT /product="putative glycerate- and formate-dehydrogenase" FT /fasta_file="fasta/c1773.tab.seq.03543.out" FT /note="SPBP26C9.01c, SIMILARITY:Schizosaccharomyces pombe, FT O94574, hypothetical proteinc1773.17c in chromosome ii, FT (195 aa), fasta scores: opt: 286, E():7.4e-13, (87.8% FT identity in 49 aa)" FT /fasta_file="fasta/p26C9.tab.seq.04331.out" FT CDS join(337018..337019,337070..337098,337159..337317, FT 337364..338918,338972..339008,339110..339175) FT /colour=2 FT /gene="exo70" FT /gene="SPBC106.20" FT /gene="SPBC582.02" FT /label=exo70 FT /note="SPBC106.20, len:237, SIMILARITY:Bacillus FT thuringiensis., Q45757, delta-endotoxin, (475 aa), fasta FT scores: opt: 144, E():0.045, (23.0% identity in 209 aa)" FT /product="putative exocyst complex component; similar to FT S. cerevisiae EXO70" FT /fasta_file="fasta/c106.tab.seq.03995.out" FT /note="SPBC582.02, len:615, SIMILARITY:Saccharomyces FT cerevisiae, EX70_YEAST, 70 kD exocyst complex protein., FT (623 aa), fasta scores: opt: 233, E():1.7e-07, (21.1% FT identity in 630 aa)" FT /fasta_file="fasta/c582.tab.seq.03872.out" FT CDS 334810..336357 FT /colour=8 FT /gene="SPBC582.01" FT /gene="SPBC106.19" FT /label=SPBC106.19 FT /note="SPBC106.19, len:416 MAY USE INTERNAL INITITATOR MET" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c106.tab.seq.03994.out" FT /label=SPBC582.01 FT /note="SPBC582.01, len:221" FT /fasta_file="fasta/c582.tab.seq.03871.out" FT CDS complement(join(400775..401251,401338..403136, FT 403177..403238,403278..403405)) FT /colour=2 FT /gene="alp6" FT /gene="SPBC428.20c" FT /gene="SPBC902.01c" FT /label=alp6 FT /note="SPBC428.20c, len:288, SIMILARITY:Xenopus laevis, FT O73 787, gamma-tubulin interacting protein., (906 aa), FT fasta sc ores: opt: 435, E():0, (33.4% identity in 314 aa)" FT /product="putative gamma-tubulin interacting spindle pole FT body component; similar to S. cerevisiae SPC98" FT /fasta_file="fasta/c428.tab.seq.03599.out" FT /note="SPBC902.01c, len:526, SIMILARITY:Homo sapiens, FT O60853, protein encoded by saccharomyces cerevisiae spc98 FT homolog., (824 aa), fasta scores: opt: 633, E():1.8e-31, FT (31.6% identity in 411 aa)" FT /product="putative gamma-tubulin interacting spindle pole FT body component yeast SPC98 homolog" FT /fasta_file="fasta/c902.tab.seq.04153.out" FT CDS complement(join(452396..454719,454760..454790)) FT /colour=2 FT /gene="klp6" FT /gene="SPBC1685.15c" FT /gene="SPBC649.01c" FT /label=klp6 FT /note="SPBC1685.15c" FT /product="kinesin-like motor protein; KIP3 subfamily" FT /fasta_file="fasta/c1685.tab.seq.03086.out" FT /label=SPBC649.01c FT /note="SPBC649.01c, len:784" FT /product="kinesin-like protein; KIP3 subfamily; regulates FT the establishment of metaphase" FT /fasta_file="fasta/c649.tab.seq.03009.out" FT CDS complement(554043..555149) FT /colour=7 FT /gene="SPBC839.18c" FT /gene="SPBC115.03" FT /label=SPBC839.18c FT /note="SPBC839.18c, len:192aa, similarity: to, S. pombe E3 FT 43563,SPAC26H5.09C, hypothetical, (369aa), fasta scores, FT op t:789, E():0, (61.3% identity in 191 aa overlap)" FT /product="putative oxidoreductase" FT /fasta_file="fasta/c839.tab.seq.03854.out" FT /label=SPBC115.03 FT /note="SPBC115.03, len:368, SIMILARITY:Schizosaccharomyces FT pombe, O13991, hypothetical 41.4 kD protein , (369 aa), FT fasta scores: opt: 1685, E():0, (67.4% identity in 368 aa)" FT /fasta_file="fasta/c115.tab.seq.02847.out" FT CDS join(632211..632229,632276..632371,632416..633794) FT /colour=2 FT /gene="rpn3" FT /gene="SPBC119.01" FT /gene="SPBPJ4664.07" FT /product="19S proteasome regulatory subunit" FT /fasta_file="fasta/pJ4664.tab.seq.04381.out" FT /label=rpn3 FT /note="SPBC119.01, SIMILARITY:Homo sapiens, PSD3_HUMAN, FT 26s proteasome regulatory subunit s3, (534 aa), fasta FT scores: opt: 1247, E():0, (46.1% identity in 440 aa)" FT /fasta_file="fasta/c119.tab.seq.02895.out" FT CDS complement(join(814264..816062,816121..816832)) FT /colour=10 FT /gene="SPBC713.13c" FT /gene="SPBC216.01c" FT /label=SPBC713.13c FT /note="SPBC713.13c, len:475" FT /product="hypothetical protein; similar to S. cerevisiae FT YNL201C" FT /fasta_file="fasta/c713.tab.seq.03246.out" FT /colour=7 FT /label=SPBC216.01c FT /note="SPBC216.01c, len:397, SIMILARITY:Saccharomyces FT cerevisiae, YNU1_YEAST, hypothetical 98.1 kD protein in FT spx19-gcr2 intergenic region, (858 aa), fasta scores: opt: FT 676, E():0, (35.3% identity in 382 aa)" FT /fasta_file="fasta/c216.tab.seq.03803.out" FT CDS join(916542..916718,916765..919779) FT /colour=7 FT /gene="SPBP35G2.15" FT /gene="SPBC146.01" FT /label=SPBP35G2.15 FT /note="SPBP35G2.15, SIMILARITY:Drosophila melanogaster, FT AAF51744, cg7177 protein., (2285 aa), fasta scores: opt: FT 480, E():2.5e-15, (29.1% identity in 522 aa)" FT /product="putative component of RNA polymerase II FT holoenzyme and Kornberg's mediator complex; putative gal11 FT homolog" FT /fasta_file="fasta/p35G2.tab.seq.04173.out" FT /label=SPBC146.01 FT /note="SPBC146.01, len:, Low SIMILARITY:Kluyveromyces FT lactis, GALY_KLULA, transcriptional regulatory protein FT GAL11, (1008 aa), fasta scores: opt: 244, E():1.6e-05, FT (27.7% identity in 249 aa overlap)" FT /product="putative component of RNA polymerase II FT holoenzyme and Kornberg's mediator complex; similar to S. FT cerevisiae GAL11" FT /fasta_file="fasta/c146.tab.seq.03855.out" FT CDS 986791..988083 FT /colour=7 FT /gene="SPBC1734.04" FT /gene="SPBC337.20" FT /label=SPBC337.20 FT /note="SPBC337.20, len:303, SIMILARITY:Saccharomyces FT cerevi siae, ANP1_YEAST, aminonitrophenyl propanediol FT resistance p rotein, (500 aa), fasta scores: opt: 1129, FT E():0, (59.9% id entity in 284 aa)" FT /product="possibly involved in protein glycosylation in FT the golgi; similar to S. cerevisiae ANP1" FT /fasta_file="fasta/c337.tab.seq.03503.out" FT /label=SPBC1734.04 FT /note="SPBC1734.04, len:430, SIMILARITY:Saccharomyces FT cerevisiae, YEL036C, ANP1_YEAST, aminonitrophenyl FT propanediol resistance protein, required for protein FT glycosylation in the golgi, (500 aa), fasta scores: opt: FT 1578, E():0, (59.5% id entity in 402 aa)" FT /fasta_file="fasta/c1734.tab.seq.03284.out" FT CDS complement(979221..981269) FT /colour=10 FT /gene="SPBC1734.01c" FT /gene="SPBC337.17c" FT /label=SPBC337.17c FT /note="SPBC337.17c, len:682, SIMILARITY:Saccharomyces FT cerevisiae, Q06344, hypothetical protein (628 aa), fasta FT scores : opt: 1071, E():0, (37.6% identity in 676 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YDR365C null lethal" FT /fasta_file="fasta/c337.tab.seq.03500.out" FT /label=SPBC1734.01c FT /note="SPBC1734.01c, SIMILARITY:Drosophila melanogaster, FT O46307, eg:8d8.4 protein., (771 aa), fasta scores: opt: FT 269, E():4.5e-08, (37.8% identity in 209 aa)" FT /product="hypothetical protein" FT /fasta_file="fasta/c1734.tab.seq.03281.out" FT CDS complement(1056506..1057288) FT /colour=10 FT /gene="SPBC1709.19c" FT /gene="SPBC409.02c" FT /label=SPBC1709.19c FT /note="SPBC1709.19c, SIMILARITY:Saccharomyces cerevisiae, FT YKE0_YEAST, hypothetical 29.2 kD protein, (256 aa), fasta FT scores: opt: 401, E():4.8e-21, (56.3% identity in 96 aa)" FT /product="conserved NifU-like protein; similar to S. FT cerevisiae YKL040C" FT /fasta_file="fasta/c1709.tab.seq.03279.out" FT /label=SPBC409.02c FT /note="SPBC409.02c, len:260, SIMILARITY:Caenorhabditis FT elegans., Q21915, r10h10.1 protein., (222 aa), fasta FT scores: opt: 669, E():0, (46.9% identity in 213 aa)" FT /fasta_file="fasta/c409.tab.seq.03928.out" FT CDS join(1054198..1054674,1054765..1054904,1054962..1055076) FT /colour=2 FT /gene="tif452" FT /gene="SPBC1709.18" FT /gene="SPBC409.01" FT /label=tif452 FT /note="SPBC1709.18, len:243" FT /product="translation initiation factor" FT /fasta_file="fasta/c1709.tab.seq.03278.out" FT /note="SPBC409.01, len:112" FT /product="eukaryotic translation initiation factor 4e" FT /fasta_file="fasta/c409.tab.seq.03927.out" FT CDS join(1100743..1101788,1101842..1102490,1102544..1103803) FT /colour=10 FT /gene="SPBC1306.02" FT /gene="SPBC4.08" FT /label=SPBC1306.02 FT /note="SPBC1306.02, len:984, LOW SIMILARITY:Saccharomyces FT cerevisiae, Q08924, chromosome xvi reading frame orf FT ypl183c., (1013 aa), fasta scores: opt: 423, E():7.2e-21, FT (25.8% identity in 1049 aa)" FT /product="WD repeat protein" FT /fasta_file="fasta/c1306.tab.seq.04152.out" FT /label=SPBC4.08 FT /note="SPBC4.08" FT /fasta_file="fasta/c4.tab.seq.03883.out" FT CDS complement(join(1156583..1158299,1158520..1158614, FT 1158704..1158799,1158855..1158875)) FT /colour=7 FT /gene="SPBC725.18c" FT /gene="SPBC651.01c" FT /label=SPBC725.18c FT /note="SPBC725.18c, len:343, SIMILARITY:Saccharomyces FT cerevisiae, Q02892, lpg15p., (647 aa), fasta scores: opt: FT 975, E():0, (45.2% identity in 354 aa)" FT /product="putative GTP-binding protein" FT /fasta_file="fasta/c725.tab.seq.03406.out" FT /label=SPBC651.01c FT /note="SPBC651.01c, len:340, SIMILARITY:Homo sapiens, FT G4191616, GTP-binding protein ngb., (633 aa), fasta FT scores: opt: 1523, E():0, (66.2% identity in 340 aa)" FT /product="GTP-binding protein" FT /fasta_file="fasta/c651.tab.seq.03770.out" FT CDS complement(join(1241651..1241741,1241786..1241994, FT 1242059..1242799)) FT /colour=7 FT /gene="SPBC30B4.09c" FT /gene="SPBC27B12.01c" FT /label=SPBC30B4.09c FT /note="alteRNAtive splicing may exist using inteRNAl FT donors at posns. 22869 and 22968" FT /note="SPBC30B4.09c, len:321, SIMILARITY:Saccharomyces FT cerevisiae, MMM1_YEAST, mitochondrial outer membrane FT protein mmm1., (426 aa), fasta scores: opt: 454, E():2.6e- FT 23, (35.7% identity in 336 aa)" FT /product="putative mitochondrial outer membrane protein; FT possibly involved in establishment and maintenance of FT mitochondrial shape and structure and coupling FT mitochondria to the actin cytoskeleton; similar to S. FT cerevisiae MMM1" FT /fasta_file="fasta/c30B4.tab.seq.02594.out" FT /label=SPBC27B12.01c FT /note="SPBC27B12.01c, putative mitochondrial outer FT membrane protein, len:<274aa, identical to (except first FT two exons are ommited due to absence of suitable branch FT site) TR:D10 22304, (378aa), similar eg. to YLL006W, FT MMM1_YEAST, P41800, mitochondrial outer membrane protein, FT (426aa), fasta score s, opt:358, E():5.8e-25, (32.7% FT identity in 266 aa overlap)" FT /fasta_file="fasta/c27B12.tab.seq.02664.out" FT CDS 1276016..1277050 FT /colour=7 FT /gene="SPBC27B12.13" FT /gene="SPBC8D2.22" FT /label=SPBC27B12.13 FT /note="SPBC27B12.13, len:>308aa, identical to D1022292, FT (196a a), similar eg. to YMR203W, OM40_YEAST, P23644, FT mitochondri al import receptor subunit, (387aa), fasta FT scores, opt:883, E():0, (44.4% identity in 302 aa overlap)" FT /product="putative mitochondrial import receptor subunit; FT similar to S. cerevisiae TOM40" FT /fasta_file="fasta/c27B12.tab.seq.00043.out" FT /label=SPBC568.01 FT /note="SPBC568.01, len:58" FT /fasta_file="fasta/c568.tab.seq.00004.out" FT /label=SPBC8D2.22 FT /note="SPBC568.01, len:13" FT /fasta_file="fasta/c8D2.tab.seq.00026.out" FT CDS complement(1491184..1492656) FT /EC_number="2.7.7.4" FT /colour=7 FT /gene="SPBC27.08c" FT /gene="SPBC28F2.01c" FT /label=SPBC27.08c FT /note="SPBC27.08c, SIMILARITY:Penicillium chrysogenum., FT MET3_PENCH, sulfate adenylyltransferase, (572 aa), fasta FT scores: opt: 1072, E():0, (61.2% identity in 286 aa)" FT /product="sulfate adenylyltransferase; methionine FT biosynthesis" FT /fasta_file="fasta/c27.tab.seq.04208.out" FT /label=SPBC28F2.01c FT /note="SPBC28F2.01c, len:232, SIMILARITY:Emericella FT nidulans, Q12555, sulfate adenylyltransferase, (574 aa), FT fasta scores: opt: 903, E():0, (60.4% identity in 230 aa)" FT /fasta_file="fasta/c28F2.tab.seq.03455.out" FT misc_feature 1531166..1533229 FT /colour=2 FT /note="dhII repeat" FT conflict 1532833..1532852 FT /note="In the consensus sequence pB36C4.con between FT positions 1668 and 1687 (inclusive) there are 10 copies of FT a TA repeat. This number of repeats was seen in 4 x pUC FT subclones, in 1 x pUC subclone there were 13 copies" FT misc_feature 1533229..1533849 FT /colour=1 FT /note="distal part of imr repeated in this clone" FT misc_feature 1533850..1536269 FT /colour=2 FT /note="repeat - ? orientation of dg/dh repeat" FT CDS join(2693483..2693645,2693701..2693765,2693916..2694692, FT 2694822..2695046) FT /colour=8 FT /gene="SPBC685.02" FT /label=SPBC685.02 FT /note="SPBC685.02, len:409, SIMILARITY:Archaeoglobus FT fulgidus., O28107, hypothetical 32.1 kD protein., (273 aa), FT fasta scores: opt: 121, E():0.38, (23.1% identity in 342 FT aa)" FT /partial FT /product="hypothetical serine-rich protein; sequence FT orphan; similar to alpha agglutinins and other cell FT surface proteins" FT /fasta_file="fasta/c685.tab.seq.03788.out" FT CDS join(1893966..1894132,1894204..1894530,1894589..1894664) FT /colour=2 FT /gene="apc10" FT /gene="SPBC1E8.06" FT /gene="SPBC1A4.01" FT /label=apc10 FT /note="SPBC1E8.06, len:189aa" FT /product="anaphase-promoting complex (APC); required for FT cyclin degradation; required for metaphase-anaphase FT transition; similar to S. cerevisiae APC10" FT /fasta_file="fasta/c1E8.tab.seq.02683.out" FT /note="SPBC1A4.01, len:189" FT /fasta_file="fasta/c1A4.tab.seq.03150.out" FT CDS complement(join(2240450..2240537,2240588..2240700, FT 2240772..2240789,2240838..2240855)) FT /colour=2 FT /gene="ubl1" FT /gene="ned8" FT /gene="SPBC12D12.08c" FT /gene="SPBC24C6.01c" FT /label=ubl1 FT /note="SPBC12D12.08c, len:78" FT /product="ubiquitin-like protein; required for the FT activation of SCf ubiquitin ligase" FT /fasta_file="fasta/c12D12.tab.seq.03415.out" FT /note="SPBC24C6.01c, len:78" FT /product="stress-induced ubiquitin-like protein; required FT for the activation of SCf ubiquitin ligase" FT /fasta_file="fasta/c24C6.tab.seq.02943.out" FT CDS complement(join(2014992..2016002,2016094..2016447)) FT /colour=10 FT /gene="SPBC18E5.11c" FT /gene="SPBC23G7.01c" FT /label=SPBC18E5.11c FT /note="SPBC18E5.11c, len:454, SIMILARITY:Saccharomyces FT cerevisiae, YEB5_YEAST, hypothetical 61.3 kD protein, (551 FT aa), fasta scores: opt: 159, E( ):6.8e-07, (24.6% identity FT in 382 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YEL015W possibly involved in splicing, and other FT functions by 2-hybrid analysis" FT /fasta_file="fasta/c18E5.tab.seq.03679.out" FT /label=SPBC23G7.01c FT /note="SPBC23G7.01c, len:454, SIMILARITY: low to FT Saccharomyces cerevisiae, YEB5_YEAST, hypothetical 61.3 kD FT protein, (551 aa), fasta scores: opt: 159, E( ):6.8e-07, FT (24.6% identity in 382 aa)" FT /product="hypothetical protein" FT /fasta_file="fasta/c23G7.tab.seq.03682.out" FT CDS complement(2017127..2018611) FT /EC_number="3.4.24.64" FT /colour=7 FT /gene="SPBC18E5.12c" FT /gene="SPBC23G7.02c" FT /label=SPBC18E5.12c FT /note="SPBC18E5.12c, len:494, SIMILARITY:Blastocladiella FT em ersonii, P97997, mitochondrial processing peptidase FT alpha s ubunit, (474 aa), fasta scores: opt: 1050, E():0, FT (40.5% id entity in 410 aa)" FT /product="putative mitochondrial processing peptidase FT alpha subunit" FT /fasta_file="fasta/c18E5.tab.seq.03680.out" FT /label=SPBC23G7.02c FT /note="SPBC23G7.02c, len:494, SIMILARITY:Blastocladiella FT emersonii., P97997, mitochondrial processing peptidase FT alpha subunit., (474 aa), fasta scores: opt: 1050, E():0, FT (40.5% identity in 410 aa)" FT /product="mitochondrial processing peptidase alpha subunit" FT /fasta_file="fasta/c23G7.tab.seq.03683.out" FT CDS join(2887954..2888135,2888194..2888806) FT /colour=2 FT /gene="orc6" FT /gene="SPBC2A9.12" FT /gene="SPBC2D10.02" FT /label=orc6 FT /note="SPBC2A9.12, len:264" FT /note="SPBC2D10.03c, full length CDS in c2D10" FT /product="Origin recognition complex subunit 6; no FT apparent orthologs" FT /fasta_file="fasta/c2A9.tab.seq.00040.out" FT /note="SPBC2D10.02, len:264" FT /fasta_file="fasta/c2D10.tab.seq.03369.out" FT CDS join(3247591..3247645,3247693..3248075,3248196..3249512) FT /colour=8 FT /gene="SPBC17D11.09" FT /label=SPBC17D11.09 FT /note="SPBC17D11.09, len:584aa" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c17D11.tab.seq.03193.out" FT /gene="SPBC17D1.01" FT /label=SPBC17D1.01 FT /note="SPBC17D1.01, len:584aa" FT /fasta_file="fasta/c17D1.tab.seq.02554.out" FT CDS complement(1755487..1755894) FT /colour=8 FT /gene="SPBC9B6.12c" FT /gene="SPBC28E12.01c" FT /note="SPBC9B6.12c, 135aa" FT /product="hypothetical protein; sequence orphan; has FT profile on microarray different from adjacent genes" FT /fasta_file="fasta/c9B6.tab.seq.03148.out" FT /label=SPBC28E12.01c FT /note="SPBC28E12.01c, len:135" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c28E12.tab.seq.03429.out" FT CDS 1756926..1758917 FT /colour=10 FT /gene="SPBC9B6.13" FT /gene="SPBC28E12.02" FT /label=SPBC9B6.13 FT /note="SPBC9B6.13, len:663, some similarity at C-term to FT tr:Q07834 S. cerevisiae ORF YLL032C" FT /note="SPBC9B6.13, len:663, SIMILARITY:Saccharomyces FT cerevisiae, Q07834, chromosome xii reading frame orf FT yll032c., (825 aa), fasta scores: opt: 205, E():8.2e-06, FT (31.3% identity in 131 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YLL032C (low)" FT /fasta_file="fasta/c9B6.tab.seq.03149.out" FT /gene="SPAC9B6.13" FT /label=SPBC28E12.02 FT /note="SPBC28E12.02, len:663, SIMILARITY: to a region of FT Sa ccharomyces cerevisiae, YLL032c, Q07834, hypothetical FT prote in, (825 aa), fasta scores: opt: 205, E():1.8e-07, FT (31.3% i dentity in 131 aa)" FT /fasta_file="fasta/c28E12.tab.seq.03430.out" FT CDS 2367297..2368205 FT /EC_number="4.4.1.5" FT /colour=7 FT /gene="SPBC21D10.03c" FT /gene="SPBC12C2.12c" FT /label=SPBC21D10.03c FT /note="SPBC21D10.03c, len:301, SIMILARITY:Saccharomyces FT cerevisiae, LGUL_YEAST, lactoylglutathione lyase, (326 aa), FT fasta scores: opt: 951, E():0, (49.8% identity in 305 FT aa)" FT /product="lactoylglutathione lyase" FT /fasta_file="fasta/c21D10.tab.seq.03257.out" FT /label=SPBC12C2.12c FT /note="SPBC12C2.12c, len:301, SIMILARITY:Saccharomyces FT cerevisiae, LGUL_YEAST, lactoylglutathione lyase, (326 aa), FT fasta scores: opt: 951, E():0, (49.8% identity in 305 FT aa)" FT /product="lactoylglutathione lyase; similar to S. FT cerevisiae GLO1" FT /fasta_file="fasta/c12C2.tab.seq.03221.out" FT CDS complement(join(2369090..2371104,2371310..2371380, FT 2371449..2371453)) FT /EC_number="2.6.1.16" FT /colour=7 FT /gene="SPBC21D10.02" FT /gene="SPBC12C2.11" FT /label=SPBC21D10.02 FT /note="SPBC21D10.02, len:696, SIMILARITY:Candida albicans, FT GFA1_CANAL, glucosamine--fructose-6-phosphate FT aminotransferase [isomerizing](ec 2.6.1.16), (712 aa), FT fasta scores: opt: 2501, E():0, (58.5% identity in 716 aa)" FT /product="glucosamine--fructose-6-phosphate FT aminotransferase" FT /fasta_file="fasta/c21D10.tab.seq.03258.out" FT /label=SPBC12C2.11 FT /note="SPBC12C2.11, len:695, SIMILARITY:Candida albicans, FT GFA1_CANAL, glucosamine--fructose-6-phosphate FT aminotransferase [isomerizing](ec 2.6.1.16), (712 aa), FT fasta scores: opt: 2501, E():0, (58.5% identity in 716 aa)" FT /fasta_file="fasta/c12C2.tab.seq.03222.out" FT CDS 4332975..4333949 FT /colour=7 FT /gene="SPBC1289.14" FT /gene="SPBC8E4.10c" FT /label=SPBC1289.14 FT /note="SPBC1289.14, len:324, SIMILARITY:Caenorhabditis FT elegans., Q20952, f57f5.4 protein., (611 aa), fasta FT scores: opt: 575, E():2.3e-31, (38.4% identity in 258 aa)" FT /note="SPBC1289.14, len:324, SIMILARITY:Caenorhabditis FT elegans., Q20952, f57f5.4 protein., (611 aa), fasta FT scores: opt: 575, E():5.3e-31, (38.4% identity in 258 aa)" FT /product="adducin N-terminal domain protein; no apparent FT S. cerevisiae ortholog" FT /fasta_file="fasta/c1289.tab.seq.03480.out" FT /label=SPBC8E4.10c FT /note="SPBC8E4.10c, len:325aa, SIMILARITY: to th N FT terminal of region of C. elegans, Q20952, F57F5.4., FT (611aa), fasta scores , opt:575, E():0, (38.4% identity in FT 258 aa overlap)" FT /product="Aldolase and Adducin N-terminal domain protein; FT no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c8E4.tab.seq.04055.out" FT CDS join(2606289..2606485,2606605..2606644) FT /colour=2 FT /gene="smf1" FT /gene="SPBC3E7.14" FT /gene="SPBC4F6.01" FT /note="SPBC3E7.14, len:78, SIMILARITY:Drosophila FT melanogaster, RUXF_DROME, small nuclear ribonucleoprotein FT f, (101 aa), fasta scores: opt: 364, E():8.7e-21, (71.4% FT identity in 70 aa)" FT /product="small nuclear ribonucleoprotein F; putative pre- FT mRNA splicing factor; similar to S. cerevisiae SMX3" FT /fasta_file="fasta/c3E7.tab.seq.03040.out" FT /label=smf1 FT /note="SPBC4F6.01, len:78, SIMILARITY:Drosophila FT melanogaster, RUXF_DROME, small nuclear ribonucleoprotein FT f, (101 aa), fasta scores: opt: 364, E():8.5e-21, (71.4% FT identity in 70 aa)" FT /fasta_file="fasta/c4F6.tab.seq.03435.out" FT CDS complement(join(2607229..2608335,2608517..2608564)) FT /colour=7 FT /gene="SPBC3E7.15c" FT /gene="SPBC4F6.02c" FT /note="SPBC3E7.15c, len:357, SIMILARITY:Saccharomyces FT cerevisiae, YKA8_YEAST, hypothetical 49.0 kD protein ufd4- FT cap1 intergenic region., (418 aa), fasta scores: opt: 1005, FT E():0, (45.5% identity in 330 aa)" FT /product="homology to longevity assurance protein." FT /fasta_file="fasta/c3E7.tab.seq.03041.out" FT /label=SPBC4F6.02c FT /note="SPBC4F6.02c, len:357, SIMILARITY:Saccharomyces FT cerevisiae, YKA8_YEAST, hypothetical 49.0 kD protein ufd4- FT cap1 intergenic region., (418 aa), fasta scores: opt: 1005, FT E():0, (45.5% identity in 330 aa)" FT /fasta_file="fasta/c4F6.tab.seq.03436.out" FT CDS 4335256..4339257 FT /colour=9 FT /gene="tf2-1" FT /gene="SPBC1289.17" FT /gene="SPBC8E4.11c" FT /label=tf2-1 FT /note="SPBC1289.17, len:1333" FT /product="retrotransposable element; tf2-type transposon" FT /fasta_file="fasta/c1289.tab.seq.03481.out" FT /label=transposon FT /note="SPBC8E4.11c" FT /fasta_file="fasta/c8E4.tab.seq.04056.out" FT CDS join(3203972..3204065,3204136..3204236,3204293..3204682) FT /colour=2 FT /function="small nucleolar rnp required for pre-mRNA FT processing" FT /gene="gar1" FT /gene="SPBC25H2.01c" FT /gene="SPBC20F10.01" FT /label=gar1 FT /note="SPBC25H2.01c, len:194" FT /product="pre-mRNA processing protein Gar1p" FT /fasta_file="fasta/c25H2.tab.seq.02446.out" FT /note="SPBC20F10.01, len:194" FT /product="gar1 protein; small nucleolar rnp required for FT pre-mRNA processing" FT /fasta_file="fasta/c20F10.tab.seq.02562.out" FT CDS 4342012..4345863 FT /colour=12 FT /gene="SPBC1289.15" FT /gene="SPBC8E4.07c" FT /label=SPBC1289.15 FT /note="SPBC1289.15, len:1283, CONTAINS: 26 copies of a 35 FT AA repeat" FT /product="low similar to seripauperin (PAU) family of FT putative cell wall mannoproteins; contains 26 copies of a FT 35 amino acid repeat; predicted N-terminal signal FT sequence; possibly S. pombe specific" FT /fasta_file="fasta/c1289.tab.seq.03482.out" FT /label=SPBC8E4.07c FT /note="SPBC8E4.07c len:1283" FT /product="similar to seripauperin (PAU) family of putative FT cell wall mannoproteins; contains 26 copies of a 35 amino FT acid repeat; predicted N-terminal signal sequence; FT possibly S. pombe specific" FT /fasta_file="fasta/c8E4.tab.seq.04057.out" FT CDS join(2456820..2457049,2457098..2457441,2457497..2458626) FT /colour=7 FT /gene="SPBC365.18" FT /gene="SPBC29A10.02" FT /label=SPBC365.18 FT /note="SPBC365.18, len:567, SIMILARITY:Homo sapiens, FT O75876, RNA-binding protein., (411 aa), fasta scores: opt: FT 442, E():9.1e-19, (35.8% identity in 316 aa)" FT /product="RNA-binding protein" FT /fasta_file="fasta/c365.tab.seq.03830.out" FT /label=SPBC29A10.02 FT /note="SPBC29A10.02, len:567, SIMILARITY:Homo sapiens, FT Q154 33, scr2., (403 aa), fasta scores: opt: 414, E():3.7e- FT 24, ( 35.6% identity in 317 aa)" FT /product="putative single-strand polynucleotide binding FT protein" FT /fasta_file="fasta/c29A10.tab.seq.03353.out" FT CDS complement(join(1997762..1997953,1998007..1998997, FT 1999054..1999154,1999213..1999458)) FT /EC_number="2.3.1.50" FT /colour=7 FT /gene="SPBC29A3.20c" FT /gene="SPBC18E5.02c" FT /label=SPBC29A3.20c FT /note="SPBC29A3.20c, len:508, SIMILARITY:Cricetulus FT griseus, O54695, serine palmitoyltransferase 1, (473 aa), FT fasta scores: opt: 1130, E():0, (38.4% identity in 469 aa)" FT /product="putative serine palmitoyltransferase" FT /fasta_file="fasta/c29A3.tab.seq.02831.out" FT /label=SPBC18E5.02c FT /note="SPBC18E5.02c, len:509, SIMILARITY:Saccharomyces FT cere visiae, LCB1_YEAST, serine palmitoyltransferase 1, FT (558 aa) , fasta scores: opt: 785, E():0, (33.9% identity FT in 522 aa)" FT /product="putative serine palmitoyltransferase subunit" FT /fasta_file="fasta/c18E5.tab.seq.03668.out" FT CDS complement(join(1731843..1732136,1732692..1732871)) FT /colour=9 FT /gene="SPBC18H10.21c" FT /gene="SPAC9B6.01c" FT /label=SPBC18H10.21c FT /note="SPBC18H10.21c, len:157" FT /product="very hypothetical protein" FT /fasta_file="fasta/c18H10.tab.seq.02942.out" FT /gene="SPBC9B6.01c" FT /label=SPBC9B6.01c FT /note="SPBC9B6.01c, len:157" FT /fasta_file="fasta/c9B6.tab.seq.03137.out" FT misc_feature 1537270..1541405 FT /colour=1 FT /note="imr2r" FT tRNA 1538892..1538965 FT /note="tRNA Ile anticodon AAT, Cove score 52.87" FT tRNA complement(1539039..1539112) FT /note="tRNA Ala anticodon AGC, Cove score 56.39" FT tRNA complement(1539773..1539855) FT /note="tRNA Pseudo VAL anticodon AAC, Cove score 40.82" FT misc_feature 1541406..1545336 FT /colour=4 FT /note="cnt2" FT misc_feature 1545114..1545336 FT /note="nominal overlap with SPBC633 S. pombe chromosome 2" FT misc_feature 1545114..1548208 FT /colour=4 FT /note="cnt2" FT misc_feature 1548209..1552531 FT /colour=1 FT /note="imr2L" FT tRNA 1549758..1549840 FT /note="tRNA Val anticodon AAC, Cove score 64.30" FT intron 1549796..1549804 FT /note="intron tRNA Val anticodon AAC" FT misc_feature complement(1549857..1550517) FT /note="single stranded" FT tRNA 1550501..1550574 FT /note="tRNA Ala anticodon AGC, Cove score 67.24" FT tRNA complement(1550648..1550721) FT /note="tRNA Ile anticodon AAT, Cove score 66.44" FT misc_feature 1552532..1554951 FT /colour=2 FT /note="dhII repeat partial" FT misc_feature 1554851..1554951 FT /note="nominal overlap with SPBC21B10 S. pombe chromosome FT 2" FT misc_feature 1554851..1558440 FT /colour=2 FT /note="dhII repeat partial" FT misc_feature 1558441..1558831 FT /colour=12 FT /note="cen253 Yeast centromere CEN2 repetitive DNA PSS253, FT between dhIIa and dgIIa" FT misc_feature 1558829..1565346 FT /colour=3 FT /note="dgII repeat" FT tRNA 1564448..1564531 FT /note="tRNA Tyr anticodon GTA, Cove score 70.26" FT intron 1564486..1564495 FT /note="intron tRNA Tyr anticodon GTA" FT tRNA complement(1564682..1564782) FT /note="tRNA Leu anticodon CAA, Cove score 56.07" FT intron complement(1564726..1564744) FT /note="intron tRNA Leu anticodon CAA" FT tRNA complement(1565274..1565344) FT /note="tRNA Gly anticodon GCC, Cove score 72.94" FT tRNA 1565643..1565725 FT /note="tRNA Lys anticodon CTT, Cove score 74.83" FT intron 1565682..1565689 FT /note="intron tRNA Lys anticodon CTT" FT tRNA 1566023..1566096 FT /note="tRNA Ile anticodon AAT, Cove score 66.44" FT tRNA complement(1566170..1566243) FT /note="tRNA Ala anticodon AGC, Cove score 67.24" FT tRNA complement(1566904..1566986) FT /note="tRNA Val anticodon AAC, Cove score 64.30" FT intron complement(1566940..1566948) FT /note="intron tRNA Val anticodon AAC" FT tRNA complement(1567428..1567499) FT /note="tRNA Glu anticodon TTC, Cove score 62.18" FT tRNA complement(1567882..1567954) FT /note="tRNA Arg anticodon ACG, Cove score 75.46" FT CDS 1568834..1569439 FT /colour=7 FT /gene="SPBC21B10.13c" FT /label=SPBC21B10.13c FT /note="SPBC21B10.13c, len:201, SIMILARITY:Helianthus FT annuus, Q39948, homeodomain protein 1., (682 aa), fasta FT scores: opt: 200, E():8.5e-06, (32.8% identity in 125 aa)" FT /product="homeodomain protein" FT /fasta_file="fasta/c21B10.tab.seq.03416.out" FT misc_feature 1568933..1569109 FT /colour=9 FT /note="Pfam match to entry PF00046 homeobox, Homeobox FT domain," FT CDS complement(join(1569637..1570071,1570157..1570270)) FT /colour=2 FT /gene="rec6" FT /gene="SPBC21B10.12" FT /label=rec6 FT /note="SPBC21B10.12, len:182" FT /product="meiotic recombination protein; no apparent FT orthologs" FT /fasta_file="fasta/c21B10.tab.seq.00027.out" FT misc_feature complement(1570072..1570086) FT /colour=6 FT /note="ctgactttcttttag, splice branch and acceptor" FT misc_feature complement(1570151..1570156) FT /colour=6 FT /note="gtatga, splice donor sequence" FT CDS complement(join(1570888..1571046,1571090..1571149)) FT /colour=7 FT /gene="SPBC21B10.11" FT /label=SPBC21B10.11 FT /note="SPBC21B10.11, len:72, SIMILARITY:Homo sapiens, FT O94777, dpm2., (84 aa), fasta scores: opt: 202, E():2.7e- FT 09, (37.9% identity in 66 aa)" FT /product="putative dolichol phosphate mannose regulatory FT protein; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c21B10.tab.seq.00028.out" FT misc_feature complement(1571047..1571057) FT /colour=6 FT /note="ttaatcattag, splice branch and acceptor" FT misc_feature complement(1571084..1571089) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT CDS complement(1571621..1572409) FT /colour=2 FT /gene="rps4-2" FT /gene="SPBC21B10.10" FT /label=rps4-2 FT /note="SPBC21B10.10, len:262" FT /product="40S ribosomal protein S4" FT /fasta_file="fasta/c21B10.tab.seq.03419.out" FT misc_feature complement(1571813..1572241) FT /colour=9 FT /note="Pfam match to entry PF00900 Ribosomal_S4e, FT Ribosomal family S4e," FT CDS complement(join(1573118..1573435,1573482..1573891, FT 1573936..1574592,1574700..1574874)) FT /colour=7 FT /gene="SPBC21B10.09" FT /label=SPBC21B10.09 FT /note="SPBC21B10.09, len:519, SIMILARITY:Homo sapiens, FT O00400, acetyl-coenzyme a transporter., (549 aa), fasta FT scores: opt: 700, E():0, (34.8% identity in 491 aa)" FT /product="putative acetyl-coenzyme a transporter" FT /fasta_file="fasta/c21B10.tab.seq.03420.out" FT misc_feature complement(1573436..1573451) FT /colour=6 FT /note="ctaatcaattaaatag, splice branch and acceptor" FT misc_feature complement(1573476..1573481) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1573892..1573908) FT /colour=6 FT /note="ttaaccttttacgatag, splice branch and acceptor" FT misc_feature complement(1573930..1573935) FT /colour=6 FT /note="gtgagt, splice donor sequence" FT misc_feature complement(1574593..1574605) FT /colour=6 FT /note="ttaacaattcaag, splice branch and acceptor" FT misc_feature complement(1574694..1574699) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS join(1576545..1576613,1576849..1577376) FT /colour=8 FT /gene="SPBC21B10.08c" FT /label=SPBC21B10.08c FT /note="SPBC21B10.08c, len:198" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c21B10.tab.seq.03421.out" FT misc_feature 1576614..1576619 FT /colour=6 FT /note="gtgagt, splice donor sequence" FT intron complement(2240538..2240587) FT /colour=2 FT /note="confirmed intron" FT intron complement(2240701..2240771) FT /colour=2 FT /note="confirmed intron" FT intron complement(2240790..2240837) FT /colour=2 FT /note="confirmed intron" FT LTR complement(3410983..3411209) FT /note="Tf2-type LTR" FT /note="242 (-1) 28 153 Tf1-type LTR" FT intron 1576614..1576848 FT /colour=2 FT /note="confirmed intron" FT misc_feature 1576833..1576848 FT /colour=6 FT /note="ctaactatatgtacag, splice branch and acceptor" FT CDS complement(1577785..1579044) FT /colour=7 FT /gene="SPBC21B10.07" FT /label=SPBC21B10.07 FT /note="SPBC21B10.07, len:419, SIMILARITY:Cochliobolus FT carbonum, O14421, mixed-linked glucanase ., (339 aa), FT fasta scores: opt: 878, E():0, (41.3% identity in 312 aa)" FT /product="putative glucanase; no apparent S. cerevisiae FT ortholog" FT /fasta_file="fasta/c21B10.tab.seq.03422.out" FT CDS join(1581462..1581492,1581553..1581665,1581720..1582988) FT /colour=8 FT /gene="SPBC21B10.06c" FT /label=SPBC21B10.06c FT /note="SPBC21B10.06c, len:470" FT /product="hypothetical protein; sequence orphan; contains FT 3 predicted transmembrane helices" FT /fasta_file="fasta/c21B10.tab.seq.03423.out" FT misc_feature 1581493..1581498 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 1581536..1581552 FT /colour=6 FT /note="ctgacacaatacactag, splice branch and acceptor" FT misc_feature 1581666..1581671 FT /colour=6 FT /note="gttagt, splice donor sequence" FT misc_feature 1581703..1581719 FT /colour=6 FT /note="ctaatgaacattttcag, splice branch and acceptor" FT CDS 1583546..1584490 FT /colour=2 FT /gene="pop3" FT /gene="wat1" FT /gene="SPBC21B10.05c" FT /label=pop3 FT /note="SPBC21B10.05c, len:314" FT /product="WD repeat protein; involved in peroxisomal FT targeting; secures genome stability (PMID: 11686295); FT involved in microtubule integrity (PMID: 11686295); FT possibly involved in mRNA maturation (PMID: 11686295)" FT /fasta_file="fasta/c21B10.tab.seq.03424.out" FT misc_feature 1583633..1583746 FT /colour=9 FT /note="Pfam match to entry PF00400 WD40, WD domain, G-beta FT repeat," FT misc_feature 1583762..1583878 FT /colour=9 FT /note="Pfam match to entry PF00400 WD40, WD domain, G-beta FT repeat," FT misc_feature 1584158..1584274 FT /colour=9 FT /note="Pfam match to entry PF00400 WD40, WD domain, G-beta FT repeat," FT misc_feature 1584290..1584406 FT /colour=9 FT /note="Pfam match to entry PF00400 WD40, WD domain, G-beta FT repeat," FT CDS 1585181..1585549 FT /colour=2 FT /gene="nrf1" FT /gene="SPBC21B10.04c" FT /label=nrf1 FT /note="SPBC21B10.04c, len:122" FT /product="negative regulator of cdc42p; involved in FT endocytosis; highly similar to S. cerevisiae VTC1- protein FT involved in vacuolar polyphosphate accumulation, and the FT distribution of V-ATPase and other membrane proteins; FT protein complex assembly" FT /fasta_file="fasta/c21B10.tab.seq.03425.out" FT CDS 1587658..1590033 FT /colour=7 FT /gene="SPBC21B10.03c" FT /label=SPBC21B10.03c FT /note="SPBC21B10.03c, len:791, SIMILARITY some FT to:Saccharomyces cerevisiae, PBP1_YEAST, pab1-binding FT protein 1., (722 aa), fasta scores: opt: 528, E():1e-18, FT (28.7% identity in 669 aa)" FT /product="putative polyadenylation factor; similar to S. FT cerevisiae PBP1" FT /fasta_file="fasta/c21B10.tab.seq.03426.out" FT CDS complement(join(1590223..1590294,1590336..1590743)) FT /colour=8 FT /gene="SPBC21B10.02" FT /label=SPBC21B10.02 FT /note="SPBC21B10.02, len:159" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c21B10.tab.seq.03427.out" FT misc_feature complement(1590295..1590313) FT /colour=6 FT /note="ctaatgtttttttttatag, splice branch and acceptor" FT misc_feature complement(1590330..1590335) FT /colour=6 FT /note="gtaggc, splice donor sequence" FT misc_feature 1593298..1593398 FT /note="nominal overlap with cosmid SPBC874, AL135748 S. FT pombe chromosome 2" FT misc_feature 1593298..1593398 FT /note="nominal overlap with cosmid SPBC21B10 S. pombe FT chromosome 2" FT misc_feature 1593983..1594084 FT /note="nominal overlap with cosmid SPBC19C2 S. pombe FT chromosome 2" FT misc_feature 1593983..1594084 FT /note="nominal overlap with cosmid c874 S. pombe FT chromosome 2" FT CDS join(1594665..1594832,1594877..1595701) FT /colour=2 FT /gene="pmt1" FT /gene="SPBC19C2.02" FT /label=pmt1 FT /note="SPBC19C2.02, len:330" FT /product="DNA methyltransferase pmt1; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c19C2.tab.seq.03952.out" FT misc_feature 1594683..1595039 FT /colour=9 FT /note="Pfam match to entry PF00145 DNA_methylase, C-5 FT cytosine-specific DNA methylase," FT misc_feature 1594833..1594838 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1594864..1594876 FT /colour=6 FT /note="ttaatacttatag, splice branch and acceptor" FT misc_feature 1595487..1595642 FT /colour=9 FT /note="Pfam match to entry PF00145 DNA_methylase, C-5 FT cytosine-specific DNA methylase," FT CDS join(1596334..1596409,1596463..1596578) FT /EC_number="2.7.7.6" FT /colour=2 FT /gene="rpc10" FT /gene="rpb12" FT /gene="SPBC19C2.03" FT /label=rpc10 FT /note="SPBC19C2.03, len:63" FT /product="DNA-directed RNA polymerases I, II, and III 7.3 FT kD subunit; abc10-alpha; similar to S. cerevisiae RPC10" FT /fasta_file="fasta/c19C2.tab.seq.03953.out" FT misc_feature 1596410..1596415 FT /colour=6 FT /note="gtatga, splice donor sequence" FT intron 1596410..1596462 FT /note="confirmed intron" FT misc_feature 1596452..1596462 FT /colour=6 FT /note="ctgaccatcag, splice branch and acceptor" FT CDS complement(1597123..1598175) FT /colour=7 FT /gene="SPBC19C2.04c" FT /label=SPBC19C2.04c FT /note="SPBC19C2.04c, len:350, SIMILARITY:Mus musculus, FT UBPW_MOUSE, ubiquitin carboxyl-terminal hydrolase dub-1, FT (526 aa), fasta scores: opt: 263, E():4.3e-10, (26.5% FT identity in 324 aa)" FT /product="ubiquitin carboxyl-terminal hydrolase" FT /fasta_file="fasta/c19C2.tab.seq.03954.out" FT misc_feature complement(1597213..1597320) FT /colour=9 FT /note="Pfam match to entry PF00443 UCH-2, Ubiquitin FT carboxyl-terminal hydrolases family 2," FT misc_feature complement(1597972..1598028) FT /colour=9 FT /note="Pfam match to entry PF00442 UCH-1, Ubiquitin FT carboxyl-terminal hydrolases family 2," FT misc_feature complement(1598176..1603459) FT /note="low complexity gene free region" FT CDS 1603460..1604872 FT /colour=2 FT /gene="ran1" FT /gene="pat1" FT /gene="SPBC19C2.05" FT /label=ran1 FT /note="SPBC19C2.05, len:470, identicle to, RAN1_SCHPO, FT Schizosaccharomyces pombe negative regulator of sexual FT conjugation and meiosis, except for a single aa difference FT at position 155 (V-G)" FT /product="serine/threonine protein kinase; negative FT regulator of sexual conjugation and meiosis" FT /fasta_file="fasta/c19C2.tab.seq.03955.out" FT misc_feature 1603511..1604332 FT /colour=9 FT /note="Pfam match to entry PF00069 pkinase, Eukaryotic FT protein kinase domain," FT CDS complement(1607367..1607804) FT /colour=8 FT /gene="SPBC19C2.06c" FT /label=SPBC19C2.06c FT /note="SPBC19C2.06c, len:145," FT /product="hypothetical protein; sequence orphan; has FT transcript profile on microarray" FT /fasta_file="fasta/c19C2.tab.seq.03956.out" FT CDS 1608966..1610042 FT /EC_number="4.1.2.13" FT /colour=2 FT /gene="fba1" FT /gene="SPBC19C2.07" FT /label=fba1 FT /note="SPBC19C2.07, len:358,identicle to FT Schizosaccharomyces pombe, ALF_SCHPO, except for a single FT amino acid difference at position 13 (T-A)" FT /product="fructose-bisphosphate aldolase; similar to S. FT cerevisiae FBA1" FT /fasta_file="fasta/c19C2.tab.seq.03957.out" FT misc_feature 1609002..1610039 FT /colour=9 FT /note="Pfam match to entry PF01116 F_bP_aldolase, Fructose- FT bisphosphate aldolase class-II," FT CDS join(1610747..1610888,1611087..1611577) FT /colour=10 FT /gene="SPBC19C2.08" FT /label=SPBC19C2.08 FT /note="SPBC19C2.08, len:210, SIMILARITY:Caenorhabditis FT elegans., Q18942, d1054.14 protein., (320 aa), fasta FT scores: opt: 566, E():1.7e-31, (45.5% identity in 189 aa)" FT /product="conserved protein; no apparent S. cerevisiae FT ortholog" FT /fasta_file="fasta/c19C2.tab.seq.03958.out" FT misc_feature 1610889..1610894 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1611073..1611086 FT /colour=6 FT /note="ctaatacatcttag, splice branch and acceptor" FT CDS 1612427..1615129 FT /colour=7 FT /gene="SPBC19C2.09" FT /label=SPBC19C2.09 FT /note="SPBC19C2.09, len:900, FT SIMILARITY:Schizosaccharomyces pombe, O43019, hypothetical FT 86.8 kD protein., (793 aa), fasta scores: opt: 331, FT E():2.5e-12, (30.3% identity in 337 aa)" FT /product="putative transcription factor; predicted FT membrane-tethered transcription factor (PMID: 11790253); FT basic helix-loop-helix DNA binding domain; Myc type FT dimerisation domain; contains 2 predicted transmembrane FT helices; similar to S. cerevisiae YOR032C" FT /fasta_file="fasta/c19C2.tab.seq.03959.out" FT misc_feature 1613207..1613425 FT /colour=9 FT /note="Pfam match to entry PF00010 HLH, Helix-loop-helix FT DNA-binding domain," FT CDS join(1615820..1616407,1616523..1617440) FT /colour=10 FT /gene="SPBC19C2.10" FT /label=SPBC19C2.10 FT /note="SPBC19C2.10, len:501, SIMILARITY:Homo sapiens, FT O60504, sh3-containing adaptor molecule-1., (671 aa), FT fasta scores: opt: 211, E():0.00028, (26.4% identity in FT 269 aa)" FT /product="SH3 Src homology domain protein; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c19C2.tab.seq.03960.out" FT misc_feature 1616408..1616413 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1616512..1616522 FT /colour=6 FT /note="ctaatttttag, splice branch and acceptor" FT misc_feature 1617089..1617274 FT /colour=9 FT /note="Pfam match to entry PF00018 SH3, Src homology FT domain 3," FT CDS complement(1618334..1619692) FT /colour=10 FT /gene="SPBC19C2.11c" FT /label=SPBC19C2.11c FT /note="SPBC19C2.11c, len:452, SIMILARITY:Saccharomyces FT cerevisiae, YGW9_YEAST, hypothetical 52.0 kD protein in FT nif3-clg1 intergenic region., (459 aa), fasta scores: opt: FT 273, E():1.3e-09, (25.1% identity in 451 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YGL219C; possibly fungal specific" FT /fasta_file="fasta/c19C2.tab.seq.03961.out" FT CDS join(1620681..1620746,1620838..1621000,1621097..1621305) FT /colour=10 FT /gene="SPBC19C2.12" FT /label=SPBC19C2.12 FT /note="SPBC19C2.12, len:145, SIMILARITY:Saccharomyces FT cerevisiae, Q06090, chromosome xvi cosmid 8283., (140 aa), FT fasta scores: opt: 434, E():3.4e-24, (47.2% identity in FT 142 aa)" FT /product="conserved protein; similar to S. cerevisiae FT YPR100W" FT /fasta_file="fasta/c19C2.tab.seq.03962.out" FT misc_feature 1620747..1620752 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 1620822..1620837 FT /colour=6 FT /note="ctaattttctttttag, splice branch and acceptor" FT misc_feature 1621001..1621006 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 1621079..1621096 FT /colour=6 FT /note="ctaatgctacgataatag, splice branch and acceptor" FT CDS complement(1621472..1622572) FT /colour=7 FT /gene="SPBC19C2.13c" FT /label=SPBC19C2.13c FT /note="SPBC19C2.13c, len:366," FT /product="possibly involved in cytoplasmic ribosome FT function; similar to S. cerevisiae YNL119W" FT /fasta_file="fasta/c19C2.tab.seq.03963.out" FT CDS join(1622781..1622817,1622863..1622922,1622978..1623107, FT 1623161..1623227) FT /colour=2 FT /gene="smd3" FT /gene="SPBC19C2.14" FT /label=smd3 FT /note="SPBC19C2.14, len:97, SIMILARITY:Homo sapiens, FT SMD3_HUMAN, small nuclear ribonucleoprotein smd3, (126 aa), FT fasta scores: opt: 395, E():2e-22, (74.4% identity in 78 FT aa)" FT /product="small nuclear ribonucleoprotein; putative pre- FT mRNA splicing factor; similar to S. cerevisiae SMD3" FT /fasta_file="fasta/c19C2.tab.seq.03964.out" FT misc_feature 1622818..1622823 FT /colour=6 FT /note="gtacga, splice donor sequence" FT misc_feature 1622852..1622862 FT /colour=6 FT /note="ctaatttttag, splice branch and acceptor" FT misc_feature 1622923..1622928 FT /colour=6 FT /note="gtatat, splice donor sequence" FT misc_feature 1622964..1622977 FT /colour=6 FT /note="cttacactaattag, splice branch and acceptor" FT misc_feature 1623108..1623113 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 1623143..1623160 FT /colour=6 FT /note="ttaacgtttttaaacaag, splice branch and acceptor" FT misc_feature complement(1623712..1623723) FT /colour=6 FT /note="ttaactttctag, splice branch and acceptor" FT misc_feature complement(1623758..1623763) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1623993..1624781) FT /note="nominal overlap with cosmid SPBC2F12, EM:Z97211 S. FT pombe chromosome 2" FT misc_feature 1623993..1624781 FT /note="nominal overlap with cosmid SPBC19C2, EM:AL109731 FT S.pombe chromosome 2" FT misc_feature complement(1624301..1624319) FT /colour=6 FT /note="ttaacaaagttaaaaatag, splice branch and acceptor" FT misc_feature complement(1624345..1624350) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT CDS join(1625000..1625227,1625300..1626061) FT /colour=10 FT /gene="SPBC2F12.15c" FT /label=SPBC2F12.15c FT /note="SPBC2F12.15c, len:329aa; similarity: to YNL326C, FT YN6 6_YEAST, P42836, hypothetical 39.2 kD protein, (336aa), FT fasta scores, opt:340, E():2.7e-1, (33.2% identity in FT 217 aa o verlap)" FT /product="zinc finger protein; zf-DHHC type" FT /fasta_file="fasta/c2F12.tab.seq.02483.out" FT misc_feature 1625228..1625233 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 1625282..1625299 FT /colour=6 FT /note="ctaactcttctgtttcag, splice branch and acceptor" FT CDS join(1627574..1628030,1628363..1629480) FT /EC_number="1.1.1.205" FT /colour=7 FT /gene="gua1" FT /gene="SPBC2F12.14c" FT /label=gau1 FT /note="SPBC2F12.14c, len:524aa, similarity: to IMH2_YEAST, FT P50095, putative inosine-5'-monophosphate dehydrogenase FT (52 3aa), fasta scores, opt:2200, E():0, (62.8% identity FT in 524 aa overlap)" FT /product="inosine-5'-monophosphate dehydrogenase; similar FT to S. cerevisiae IMD3" FT /fasta_file="fasta/c2F12.tab.seq.02484.out" FT misc_feature 1627649..1627918 FT /note="Match to PF01574, IMPDH_N, IMP dehydrogenase / GMP FT reductase N terminus" FT misc_feature join(1627943..1628030,1628363..1628421) FT /note="Match to PF00571 CBS, CBS domain Score 26.72" FT misc_feature 1628031..1628036 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT intron 1628031..1628362 FT /colour=2 FT /note="confirmed intron" FT snRNA 1628200..1628280 FT /gene="Sp-snR54-sno" FT /note="putative snoRNA Sp-snR54, complements: Sp-18S-rRNA FT and modifies Am989. Yeast snR54 homolog" FT misc_feature 1628352..1628362 FT /colour=6 FT /note="ctaacctttag, splice branch and acceptor" FT misc_feature 1628455..1628613 FT /note="Match to PF00571 CBS, CBS domain Score 46.07" FT misc_feature 1628707..1629372 FT /note="Match to PF00478 IMPDH_C, IMP dehydrogenase / GMP FT reductase C terminus Score 363.99" FT CDS complement(join(1629813..1632433,1632490..1632520)) FT /colour=2 FT /gene="klp5" FT /gene="SPBC2F12.13" FT /label=SPBC2F12.13 FT /note="SPBC2F12.13, len:883aa" FT /product="kinesin-like protein; KIP3 subfamily; regulates FT the establishment of metaphase" FT /fasta_file="fasta/c2F12.tab.seq.02485.out" FT misc_feature complement(1631211..1632155) FT /note="Match to PF00225 kinesin, Kinesin motor domain FT Score 362.06" FT misc_feature complement(1632012..1632035) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature complement(1632434..1632447) FT /colour=6 FT /note="ctaacataaaatag, splice branch and acceptor" FT misc_feature complement(1632484..1632489) FT /colour=6 FT /note="gttagt, splice donor sequence" FT CDS join(1633702..1633827,1633874..1634125,1634181..1634273, FT 1634320..1634772,1634856..1635485) FT /colour=10 FT /gene="SPBC2F12.12c" FT /label=SPBC2F12.12c FT /note="SPBC2F12.12c, len:517aa SIMILARITY: Arabidopsis FT thaliana Q9ZWB1 F21M11.16 PROTEIN, (672 aa), fasta FT scores, opt: 298, E(): 8.9e-11, (28.7% identity in 557 FT aa overlap)" FT /product="hypothetical protein; possibly interacts with FT ankyrin repeat containing protein by similar to Drosophila FT cactin; shares conserved C terminal domain with Human FT R31449_3 NY-REN-24 ANTIGEN; Drosophila melanogaster FT Cactin; C. elegans W03H9.4 Arabidopsis F21M11.16; FT {KR}KP..{YF}NRV..GF{DE}WN.YNQ.H.*PPPK{AI}VQGYKFNIFYPDL; FT PfamB-Pfam-B_37718; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c2F12.tab.seq.02486.out" FT misc_feature 1633828..1633833 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1633858..1633873 FT /colour=6 FT /note="ttaaccttccctttag, splice branch and acceptor" FT misc_feature 1634126..1634131 FT /colour=6 FT /note="gtaagg, splice donor sequence" FT misc_feature 1634168..1634180 FT /colour=6 FT /note="ttaacatacttag, splice branch and acceptor" FT misc_feature 1634274..1634279 FT /colour=6 FT /note="gtatgg, splice donor sequence" FT misc_feature 1634302..1634319 FT /colour=6 FT /note="ctaaattatacattatag, splice branch and acceptor" FT misc_feature 1634773..1634778 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 1634836..1634855 FT /colour=6 FT /note="ctaaccaaaatcttttctag, splice branch and acceptor" FT CDS 1638823..1639482 FT /colour=2 FT /function="required for mitotic cell cycle start" FT /gene="rep2" FT /gene="SPBC2F12.11c" FT /label=rep2 FT /note="SPBC2F12.11c, len:219aa" FT /product="transcriptional regulator; transcriptional FT activator; zinc finger protein; zf-C2H2 type; required for FT mitotic cell cycle start; interacts with the MBC binding FT subunit complex; Mlu-box binding factor component (MBF); FT no apparent orthologs" FT /fasta_file="fasta/c2F12.tab.seq.00047.out" FT misc_feature 1639345..1639413 FT /colour=9 FT /note="Pfam match to entry PF00096 zf-C2H2, zinc finger, FT C2 H2 type" FT misc_feature 1639351..1639413 FT /note="Match to PF00096 zf-C2H2, zinc finger, C2H2 type FT Score 23.65" FT CDS complement(1640150..1641262) FT /colour=7 FT /gene="SPBC2F12.10" FT /label=SPBC2F12.10 FT /note="SPBC2F12.10, len:370aa; similarity: to YDR322W, FT Q066 78, chromosome iv cosmid, (367aa), fasta scores, FT opt:171, E ():7.1e-17, (29.5% identity in 312 aa overlap)" FT /product="putative mitochondrial ribosomal protein of the FT large subunit; similar to S. cerevisiae MRPL35" FT /fasta_file="fasta/c2F12.tab.seq.02488.out" FT CDS 1643612..1644679 FT /colour=2 FT /function="cell cycle regulation" FT /gene="atf21" FT /gene="SPBC2F12.09c" FT /label=atf21 FT /note="SPBC2F12.09c" FT /product="atf creb-family transcription factor; bZIP FT (basic leucine zipper) transcription factor family" FT /fasta_file="fasta/c2F12.tab.seq.02489.out" FT misc_feature 1644407..1644592 FT /note="Match to PF00170 bZIP, bZIP transcription factor FT Score 39.52" FT misc_feature 1644425..1644472 FT /colour=8 FT /note="PS00036 bZIP transcription factors basic domain FT sign ature" FT misc_feature 1645446..1646540 FT /note="Match to PF01331 mRNA_cap_enzyme, mRNA capping FT enzyme Score 677.60" FT CDS 1645446..1646654 FT /EC_number="2.7.7.50" FT /colour=2 FT /gene="ceg1" FT /gene="pce1" FT /gene="SPBC2F12.08c" FT /label=ceg1 FT /note="SPBC2F12.08c, len:402aa" FT /product="mRNA capping enzyme; mRNA guanylyltransferase; FT similar to S. cerevisiae CEG1" FT /fasta_file="fasta/c2F12.tab.seq.02490.out" FT CDS 1647276..1648037 FT /colour=2 FT /gene="rpl8-2" FT /gene="rpk37" FT /gene="SPBC2F12.07c" FT /gene="rpk5b" FT /label=rpl8-2 FT /note="SPBC2F12.07c, len:253aa" FT /product="60S ribosomal protein L8 or L2" FT /fasta_file="fasta/c2F12.tab.seq.02491.out" FT misc_feature 1647309..1648034 FT /note="Match to PF00181 Ribosomal_L2, Ribosomal proteins FT L2 Score 507.74" FT misc_feature 1647861..1647896 FT /colour=8 FT /note="PS00467 Ribosomal protein L2 signature" FT CDS join(1649433..1649490,1649556..1649597,1649659..1649831, FT 1650077..1653736) FT /colour=7 FT /gene="SPBC2F12.05c" FT /label=SPBC2F12.05c FT /note="SPBC2F12.05c, len:1310aa, similarity: to YAR044W, FT OS H1_YEAST, P35845, osh1 protein, (859aa), fasta scores, FT opt: 1090, E():0,(35.3% identity in 814 aa overlap), also FT simila r eg. to YDL019C, Q12451, chromosome iv orf, FT (1283aa), fast a scores, opt:1061, E():0, (31.6% identity FT in 1245 aa overl ap)" FT /product="possibly involved in ergosterol biosynthesis; FT putative oxysterol binding protein; similar to S. FT cerevisiae OSH1" FT /fasta_file="fasta/c2F12.tab.seq.02492.out" FT misc_feature 1649491..1649496 FT /colour=6 FT /note="gttagt, splice donor sequence" FT misc_feature 1649539..1649555 FT /colour=6 FT /note="ctaactacgcgttttag, splice branch and acceptor" FT misc_feature 1649598..1649603 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 1649640..1649658 FT /colour=6 FT /note="ctgacgtgtgaatgaatag, splice branch and acceptor" FT misc_feature 1649832..1649837 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 1650058..1650076 FT /colour=6 FT /note="ttaacatttgtttctttag, splice branch and acceptor" FT misc_feature 1650077..1650136 FT /note="Match to PF00023 ank, Ank repeat Score 26.61" FT misc_feature 1650368..1650463 FT /note="Match to PF00023 ank, Ank repeat Score 36.62" FT misc_feature 1650572..1650847 FT /note="Match to PF00169 PH, PH domain Score 55.11" FT misc_feature 1652546..1653673 FT /note="Match to PF01237 Oxysterol_BP, Oxysterol-binding FT protein Score 372.97" FT CDS complement(1654019..1654582) FT /colour=2 FT /gene="rpl17" FT /gene="SPBC2F12.04" FT /label=rpl17 FT /note="SPBC2F12.04, len:187aa" FT /product="60S ribosomal protein L17" FT /fasta_file="fasta/c2F12.tab.seq.02493.out" FT misc_feature complement(1654127..1654534) FT /note="Match to PF00237 Ribosomal_L22, Ribosomal protein FT L22 Score 237.49" FT misc_feature complement(1654133..1654207) FT /colour=8 FT /note="PS00464 Ribosomal protein L22 signature" FT LTR 4330392..4330738 FT /note="partially degraded Tf2-type LTR" FT /colour=4 FT /note="Similar to tf1 ltr" FT promoter complement(1654657..1654664) FT /colour=4 FT /note="Homol D box" FT promoter complement(1654677..1654686) FT /colour=4 FT /note="Homol E box" FT CDS 1654953..1657628 FT /colour=7 FT /gene="SPBC2F12.03c" FT /label=SPBC2F12.03c FT /note="SPBC2F12.03c, len:891aa" FT /note="putative in-frame splice between codons 689 and 760" FT /product="protein containing 1.5 TPR repeats; possibly FT involved in telomere length regulation; possibly involved FT in transcriptional silencing; putative phopshodiesterase FT activity; putative 5' exonuclease/ribonuclease" FT /fasta_file="fasta/c2F12.tab.seq.02494.out" FT misc_feature 1655841..1656020 FT /note="1.5 TPR domains" FT LTR 4334796..4335088 FT /note="Tf2-type LTR" FT /note="similar to a region of tf2 LTR" FT intron 1657016..1657234 FT /colour=7 FT /note="Intron predicted by HMM_intron, Score=10.99, FT putative in-frame splice in SPBC2F12.03C" FT misc_feature 1660114..1660392 FT /note="Match to PF00673 Ribosomal_L5_C, ribosomal L5P FT family C-terminus Score 32.82" FT misc_feature 1660114..1660410 FT /colour=9 FT /note="Pfam match to entry PF00673 L5_C, ribosomal L5P FT fami ly C-terminus" FT misc_feature 1660440..1662004 FT /note="nominal overlap with cosmid SPBC1D7, EM:Z98270 FT S.pombe chromosome 2" FT misc_feature complement(1660922..1661716) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 342.58" FT misc_feature complement(1661306..1661344) FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT misc_feature complement(1661627..1661698) FT /colour=8 FT /note="PS00107 protein kinases ATP-binding region FT signature" FT CDS 1659577..1660440 FT /colour=7 FT /gene="SPBC2F12.02c" FT /label=SPBC2F12.02c FT /note="SPBC2F12.02c, len:287aa; similarity: to YDR237W, FT RM0 7_YEAST, P36519, mitochondrial 60S ribosomal protein, FT (292a a), fasta scores, opt:542, E():2.2e-30, (34.7% FT identity in 259 aa overlap)" FT /product="mitochondrial ribosomal protein L5/L7" FT /fasta_file="fasta/c2F12.tab.seq.02495.out" FT misc_feature complement(1660440..1662004) FT /note="nominal overlap with cosmid SPBC2F12, EM:Z97211 FT S.pombe chromosome 2" FT misc_feature complement(1660922..1661716) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 342.58" FT misc_feature complement(1661306..1661344) FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT misc_feature complement(1661627..1661698) FT /colour=8 FT /note="PS00107 protein kinases ATP-binding region FT signature" FT misc_feature complement(1662701..1662892) FT /note="Match to PF00536 SAM, SAM domain (Sterile alpha FT motif) Score 99.66" FT CDS complement(1664712..1665311) FT /colour=2 FT /gene="mlo3" FT /gene="SPBC1D7.04" FT /label=mlo3 FT /note="SPBC1D7.04, len:199" FT /product="mlo3 protein; interferes with mitotic chromosome FT segregation" FT /fasta_file="fasta/c1D7.tab.seq.02448.out" FT misc_feature complement(1664937..1665143) FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 63.29" FT CDS complement(1666640..1668025) FT /colour=7 FT /gene="SPBC1D7.03" FT /label=SPBC1D7.03 FT /note="SPBC1D7.03, len:461, SIMILARITY:Saccharomyces FT cerevisiae, CLG1_YEAST, cyclin-like protein clg1., (452 FT aa), fasta scores: opt: 235, E():4.9e-06, (28.9% identity FT in 280 aa)" FT /product="cyclin-like protein" FT /fasta_file="fasta/c1D7.tab.seq.02449.out" FT misc_feature complement(1668026..1674187) FT /note="low complexity gene free region, with high G-C/G+C FT in first in 4253-7500 and low G-C/G+C in 7500-10000" FT misc_feature 1670133..1670188 FT /note="putative misc RNA, short region of DNA highly FT conserved with c2D10" FT CDS 1674188..1675885 FT /colour=2 FT /gene="scr1" FT /gene="SPBC1D7.02c" FT /label=scr1 FT /note="SPBC1D7.02c, len:565, SIMILARITY:Candida albicans, FT CAB41348, zinc finger protein., (574 aa), fasta scores: FT opt: 532, E():2.4e-19, (29.5% identity in 577 aa)" FT /product="transcriptional regulator; zinc finger protein; FT zf-C2H2 type; glucose mediated repressor of inv1 and fbp1" FT /fasta_file="fasta/c1D7.tab.seq.02450.out" FT misc_feature 1674263..1674331 FT /note="Match to PF00096 zf-C2H2, zinc finger, C2H2 type FT Score 31.42" FT misc_feature 1674269..1674331 FT /colour=8 FT /note="PS00028 zinc finger, C2H2 type, domain, C" FT misc_feature 1674347..1674421 FT /note="Match to PF00096 zf-C2H2, zinc finger, C2H2 type FT Score 32.68" FT misc_feature 1674353..1674421 FT /colour=8 FT /note="PS00028 zinc finger, C2H2 type" FT intron complement(1676642..1676864) FT /colour=2 FT /note="confirmed intron - probably from the 3' UTR of FT SPBC1D7.01c" FT snRNA complement(1676721..1676821) FT /note="SPO223844 Schizosaccharomyces pombe Z15 small FT nucleolar RNA gene" FT CDS complement(join(1677109..1677271,1677423..1677589, FT 1677687..1677695)) FT /colour=7 FT /gene="SPBC1D7.01" FT /label=SPBC1D7.01 FT /note="SPBC1D7.01, len:112aa" FT /product="putative GIM complex; prefoldin subunit 1" FT /fasta_file="fasta/c1D7.tab.seq.02451.out" FT misc_feature complement(1677272..1677289) FT /colour=6 FT /note="ctaactgtttatttacag, splice branch and acceptor" FT misc_feature complement(1677417..1677422) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1677590..1677612) FT /colour=6 FT /note="ctaatgagctttgggcatattag, splice branch and acceptor" FT misc_feature complement(1677681..1677686) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 1678340..1678439 FT /note="nominal overlap with cosmid SPBC11G11, EM:AL132717 FT S. pombe chromosome 2" FT misc_feature 1678406..1678439 FT /note="SPBC11G11.01- see full length protein in c11G11" FT CDS join(1678406..1678787,1678901..1679001) FT /colour=7 FT /gene="SPBC11G11.01" FT /label=SPBC11G11.01 FT /note="SPBC11G11.01, len:160, SIMILARITY:Saccharomyces FT cerevisiae, YIG5_YEAST, hypothetical 17.7 kD protein in FT rnr3-arc15 intergenic region., (155 aa), fasta scores: FT opt: 282, E():1.4e-12, (37.3% identity in 134 aa)" FT /product="possibly involved in mitochondrial division; FT similar to S. cerevisiae FIS1" FT /fasta_file="fasta/c11G11.tab.seq.04064.out" FT misc_feature 1678340..1678439 FT /note="nominal overlap with cosmid SPBC1D7, EM:Z98270 S. FT pombe chromosome 2" FT misc_feature 1678788..1678793 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1678886..1678900 FT /colour=6 FT /note="ctaacccgtttttag, splice branch and acceptor" FT CDS complement(join(1679557..1680459,1680684..1680760, FT 1680831..1680978)) FT /colour=2 FT /gene="end3" FT /gene="SPBC11G11.02c" FT /label=end3 FT /note="SPBC11G11.02c, len:375, SIMILARITY:Emericella FT nidulans, Q12076, saga., (378 aa), fasta scores: opt: 790, FT E():0, (38.3% identity in 371 aa)" FT /product="putative endocytosis and cytoskeletal protein; FT EF hand motif" FT /fasta_file="fasta/c11G11.tab.seq.04065.out" FT misc_feature complement(1680460..1680470) FT /colour=6 FT /note="ctaaccattag, splice branch and acceptor" FT misc_feature complement(1680678..1680683) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(1680761..1680782) FT /colour=6 FT /note="ctaatgttacgaatatggatag, splice branch and acceptor" FT misc_feature complement(1680772..1680858) FT /colour=9 FT /note="Pfam match to entry PF00036 efhand, EF hand," FT misc_feature complement(1680825..1680830) FT /colour=6 FT /note="gtacgg, splice donor sequence" FT CDS join(1681331..1681447,1681783..1682391) FT /colour=7 FT /gene="SPBC11G11.03" FT /label=SPBC11G11.03 FT /note="SPBC11G11.03, len:241, SIMILARITY:Saccharomyces FT cerevisiae, YKA9_YEAST, hypothetical 27.1 kD protein ufd4- FT cap1 intergenic region., (236 aa), fasta scores: opt: 731, FT E():0, (46.7% identity in 229 aa)" FT /product="putative 60S acidic ribosomal protein" FT /fasta_file="fasta/c11G11.tab.seq.04066.out" FT misc_feature 1681382..1681693 FT /colour=9 FT /note="Pfam match to entry PF00466 Ribosomal_L10, FT Ribosomal protein L10," FT misc_feature 1681448..1681453 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1681762..1681782 FT /colour=6 FT /note="ctaactgtttattttcaatag, splice branch and acceptor" FT CDS join(1683035..1683121,1683169..1683251,1683312..1683373, FT 1683443..1683621) FT /colour=2 FT /gene="trs20" FT /gene="SPBC11G11.04" FT /label=trs20 FT /note="SPBC11G11.04, len:136, SIMILARITY:Homo sapiens, FT O14582, r29515_1., (140 aa), fasta scores: opt: 474, FT E():1.8e-26, (48.1% identity in 133 aa)" FT /product="putative TRAPP golgi traffic protein" FT /fasta_file="fasta/c11G11.tab.seq.04067.out" FT misc_feature 1683122..1683127 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1683153..1683168 FT /colour=6 FT /note="ctaatatctgaattag, splice branch and acceptor" FT misc_feature 1683252..1683257 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 1683290..1683311 FT /colour=6 FT /note="ctaatactctgtttttgtatag, splice branch and acceptor" FT misc_feature 1683374..1683379 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1683423..1683442 FT /colour=6 FT /note="ctaatgttcattatttttag, splice branch and acceptor" FT CDS 1684351..1685106 FT /colour=8 FT /gene="SPBC11G11.05" FT /label=SPBC11G11.05 FT /note="SPBC11G11.05, len:251. Note: overlaps SPBC11G11.06 FT by 4bp" FT /product="putative surface protein; sequence orphan" FT /fasta_file="fasta/c11G11.tab.seq.04068.out" FT CDS complement(join(1685103..1685152,1685382..1685457, FT 1685567..1685656,1685694..1685732)) FT /colour=2 FT /gene="sme1" FT /gene="SPBC11G11.06c" FT /label=sme1 FT /note="SPBC11G11.06c, len:84, SIMILARITY:Saccharomyces FT cerevisiae, RUXE_YEAST, small nuclear ribonucleoprotein e, FT (94 aa), fasta scores: opt: 332, E():1.7e-18, (58.9% FT identity in 90 aa). Note: overlaps SPBC11G11.05 by 4bp" FT /product="small nuclear ribonucleoprotein E; putative pre- FT mRNA splicing factor; similar to S. cerevisiae SME1" FT /fasta_file="fasta/c11G11.tab.seq.04069.out" FT misc_feature complement(1685153..1685166) FT /colour=6 FT /note="ctaacattgcttag, splice branch and acceptor" FT misc_feature complement(1685376..1685381) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature complement(1685458..1685474) FT /colour=6 FT /note="ctaacgatatatgacag, splice branch and acceptor" FT misc_feature complement(1685484..1685681) FT /colour=9 FT /note="Pfam match to entry PF01423 Sm, Sm protein," FT misc_feature complement(1685561..1685566) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature complement(1685657..1685669) FT /colour=6 FT /note="ctaacttacgcag, splice branch and acceptor" FT misc_feature complement(1685688..1685693) FT /colour=6 FT /note="gtatgg, splice donor sequence" FT misc_feature 1686849..1686854 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1686881..1686899 FT /colour=6 FT /note="ttaacctgcatatttttag, splice branch and acceptor" FT misc_feature 1687812..1687934 FT /note="nominal overlap with cosmid SPBC18H10, EM:AL022304 FT S. pombe chromosome 2" FT misc_feature 1687812..1687934 FT /note="nominal overlap with cosmid SPBC11G11, EM:AL132717 FT S. pombe chromosome 2" FT CDS join(1690692..1690710,1690837..1692848) FT /colour=7 FT /gene="SPBC18H10.02" FT /label=SPBC18H10.02 FT /note="SPBC18H10.02, len:676, SIMILARITY:Saccharomyces FT cerevisiae, LCF1_YEAST, long-chain-fatty-acid--coa ligase FT 1, (700 aa), fasta scores: opt: 1470, E():0, (43.5% FT identity in 689 aa)" FT /product="putative long-chain-fatty-acid--coa ligase" FT /fasta_file="fasta/c18H10.tab.seq.02923.out" FT misc_feature 1690711..1690716 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1690820..1690836 FT /colour=6 FT /note="ctaactgtaccatgtag, splice branch and acceptor" FT misc_feature 1690983..1692389 FT /colour=9 FT /note="Pfam match to entry AMP-binding PF00501, AMP- FT binding enzymes" FT misc_feature 1691547..1691582 FT /colour=8 FT /note="PS00455 putative AMP-binding domain signature" FT CDS join(1693622..1693632,1693674..1694511) FT /colour=2 FT /gene="tif35" FT /gene="SPBC18H10.03" FT /label=tif35 FT /note="SPBC18H10.03, len:282" FT /product="eukaryotic translation initiation factor 3 RNA- FT binding subunit" FT /fasta_file="fasta/c18H10.tab.seq.02924.out" FT misc_feature 1693633..1693638 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1693662..1693673 FT /colour=6 FT /note="ctaacaaagtag, splice branch and acceptor" FT misc_feature 1694272..1694487 FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 79.89" FT misc_feature 1694389..1694412 FT /colour=8 FT /note="PS00030 Eukaryotic putative RNA-binding region RNP- FT 1 signature" FT tRNA 1695459..1695531 FT /note="tRNA Trp anticodon CCA, Cove score 68.85" FT CDS complement(join(1696088..1697148,1697313..1697403, FT 1697445..1697455,1697493..1697496)) FT /colour=2 FT /gene="sce3" FT /gene="SPBC18H10.04c" FT /label=sce3 FT /note="SPBC18H10.04c, len:388" FT /product="putative RNA-binding protein" FT /fasta_file="fasta/c18H10.tab.seq.02925.out" FT misc_feature complement(1696763..1696963) FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 71.13" FT misc_feature complement(1696835..1696858) FT /colour=8 FT /note="PS00030 Eukaryotic putative RNA-binding region RNP- FT 1 signature" FT misc_feature complement(1697149..1697169) FT /colour=6 FT /note="ctaactcaatttatctattag, splice branch and acceptor" FT misc_feature complement(1697307..1697312) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1697404..1697417) FT /colour=6 FT /note="ctgaacgatatcag, splice branch and acceptor" FT misc_feature complement(1697439..1697444) FT /colour=6 FT /note="gtttgt, splice donor sequence" FT misc_feature complement(1697456..1697465) FT /colour=6 FT /note="ttaataatag, splice branch and acceptor" FT misc_feature complement(1697487..1697492) FT /colour=6 FT /note="gcaagt, splice donor sequence" FT misc_RNA 1697974..1698387 FT /gene="meu11" FT /note="putative non-coding RNA" FT /product="putative non-coding RNA; meu11; meiotic FT expression upregulated" FT CDS 1700613..1702373 FT /colour=10 FT /gene="SPBC18H10.05" FT /label=SPBC18H10.05 FT /note="SPBC18H10.05, len:586, SIMILARITY: in the central FT region to Schizosaccharomyces pombe, O42670, hypothetical FT 95.2 kD protein trp-asp repeats containing proteinc3h5.08c FT in chromosome i., (855 aa), fasta scores: opt: 788, E():0, FT (35.4% identity in 322 aa)" FT /product="WD repeat protein" FT /fasta_file="fasta/c18H10.tab.seq.02926.out" FT misc_feature 1701348..1701458 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 40.67" FT misc_feature 1701363..1701458 FT /colour=9 FT /note="Pfam match to entry G-beta PF00400, WD domain, G- FT bet a repeats" FT misc_feature 1701492..1701584 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 31.81" FT CDS complement(join(1702574..1703206,1703255..1703519, FT 1703580..1703755)) FT /colour=10 FT /gene="SPBC18H10.06c" FT /label=SPBC18H10.06c FT /note="SPBC18H10.06c, len:357, SIMILARITY:Saccharomyces FT cerevisiae, YKB8_YEAST, hypothetical 37.1 kD protein in FT ram2-atp7 intergenic region., (329 aa), fasta scores: opt: FT 608, E():7.8e-33, (33.0% identity in 358 aa)" FT /product="WD repeat protein" FT /fasta_file="fasta/c18H10.tab.seq.02927.out" FT misc_feature complement(1703207..1703224) FT /colour=6 FT /note="ctaactaggaatacgtag, splice branch and acceptor" FT misc_feature complement(1703249..1703254) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(1703276..1703374) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 42.39" FT misc_feature complement(1703520..1703541) FT /colour=6 FT /note="ctaactgaccatgaacttctag, splice branch and acceptor" FT misc_feature complement(1703574..1703579) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS join(1703858..1703911,1703985..1704605) FT /colour=7 FT /gene="SPBC18H10.07" FT /label=SPBC18H10.07 FT /note="SPBC18H10.07, len:224, SIMILARITY:Homo sapiens, FT O75554, formin binding protein 21., (376 aa), fasta FT scores: opt: 176, E():0.0011, (30.6% identity in 111 aa)" FT /product="similar to human SNRPC, small nuclear FT ribonucleoprotein polypeptide C; no apparent S. cerevisiae FT ortholog" FT /fasta_file="fasta/c18H10.tab.seq.02928.out" FT misc_feature 1703912..1703917 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1703973..1703984 FT /colour=6 FT /note="ctaacagtacag, splice branch and acceptor" FT CDS complement(1704818..1706134) FT /colour=7 FT /gene="SPBC18H10.08c" FT /label=SPBC18H10.08c FT /note="SPBC18H10.08c, len:438, SIMILARITY:Saccharomyces FT cerevisiae, UBP5_YEAST, ubiquitin carboxyl-terminal FT hydrolase 5, (805 aa), fasta scores: opt: 633, E():0, FT (32.4% identity in 364 aa)" FT /product="ubiquitin carboxyl-terminal hydrolase; similar FT to S. cerevisiae UBP4 and UBP5" FT /fasta_file="fasta/c18H10.tab.seq.02929.out" FT misc_feature complement(1704884..1705069) FT /note="Match to PF00443 UCH-2, Ubiquitin carboxyl-terminal FT hydrolase family 2 Score 93.44" FT misc_feature complement(1704953..1705060) FT /colour=9 FT /note="Pfam match to entry UCH-2 PF00443, Ubiquitin FT carboxy l-terminal hydrolases family 2" FT misc_feature complement(1705007..1705060) FT /colour=8 FT /note="PS00973 Ubiquitin carboxyl-terminal hydrolases FT famil y 2 signature 2" FT misc_feature complement(1705826..1705918) FT /note="Match to PF00442 UCH-1, Ubiquitin carboxyl-terminal FT hydrolases family 2 Score 63.37" FT misc_feature complement(1705865..1705918) FT /colour=9 FT /note="Pfam match to entry UCH-1 PF00442, Ubiquitin FT carboxy l-terminal hydrolases family 2" FT misc_feature complement(1705871..1705918) FT /colour=8 FT /note="PS00972 Ubiquitin carboxyl-terminal hydrolases FT famil y 2 signature 1" FT CDS join(1707195..1708206,1708242..1708516) FT /colour=8 FT /gene="SPBC18H10.09" FT /label=SPBC18H10.09 FT /note="SPBC18H10.09, len:428" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c18H10.tab.seq.02930.out" FT misc_feature 1708207..1708212 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1708231..1708241 FT /colour=6 FT /note="ttaacaatcag, splice branch and acceptor" FT CDS complement(join(1708646..1709035,1709091..1709339, FT 1709385..1709630)) FT /colour=10 FT /gene="SPBC18H10.10c" FT /label=SPBC18H10.10c FT /note="SPBC18H10.10c, len:294, SIMILARITY:Caenorhabditis FT elegans., YS19_CAEEL, hypothetical 42.1 kD protein FT zk1307.9 in chromosome iii., (369 aa), fasta scores: opt: FT 399, E():1.5e-18, (32.6% identity in 224 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YKL095W predicted to interact with SYF1 Pre-mRNA splicing FT factor (spcwf3 homolog) by 2-hybrid" FT /fasta_file="fasta/c18H10.tab.seq.02931.out" FT misc_feature complement(1709036..1709051) FT /colour=6 FT /note="ctaacccataacttag, splice branch and acceptor" FT misc_feature complement(1709085..1709090) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature complement(1709340..1709352) FT /colour=6 FT /note="ctgacataaatag, splice branch and acceptor" FT misc_feature complement(1709379..1709384) FT /colour=6 FT /note="gtactg, splice donor sequence" FT CDS complement(1709983..1711281) FT /colour=10 FT /gene="SPBC18H10.11c" FT /label=SPBC18H10.11c FT /note="SPBC18H10.11c, len:432, SIMILARITY: to the c FT terminal of Arabidopsis thaliana, E1388494, hypothetical FT 79.1 kD protein., (704 aa), fasta scores: opt: 140, FT E():0.047, (20.9% identity in 350 aa)" FT /product="hypothetical protein; contains PPR domain which FT has been possibly involved in RNA stabilisation; contains FT predicted N-terminal signal sequence" FT /fasta_file="fasta/c18H10.tab.seq.00048.out" FT CDS complement(join(1711618..1712244,1712686..1712814)) FT /colour=2 FT /gene="rpl7-2" FT /gene="SPBC18H10.12c" FT /label=rpl7-2 FT /note="SPBC18H10.12c, len:251" FT /product="60S ribosomal protein L7" FT /fasta_file="fasta/c18H10.tab.seq.02933.out" FT misc_feature complement(1711948..1712046) FT /colour=8 FT /note="PS00634 Ribosomal protein L30 signature" FT misc_feature complement(1711948..1712106) FT /note="Match to PF00327 Ribosomal_L30, Ribosomal protein FT L30p/L7e Score 111.80" FT misc_feature complement(1712245..1712265) FT /colour=6 FT /note="tgtattaactgttatgtttag, splice branch and acceptor" FT intron complement(1712245..1712685) FT /note="confirmed by mRNA" FT snRNA complement(1712342..1712419) FT /gene="Sp-snR39b-sno" FT /note="putative snoRNA Sp-snR39b, complements: Sp-25S-rRNA FT and modifies Gm837. Yeast snR39b homolog" FT misc_feature complement(1712680..1712685) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS 1712983..1713402 FT /colour=2 FT /gene="rps14-2" FT /gene="SPBC18H10.13" FT /label=rps14-2 FT /note="SPBC18H10.13, len:139" FT /product="40S ribosomal protein S14" FT /fasta_file="fasta/c18H10.tab.seq.02934.out" FT misc_feature 1713031..1713387 FT /note="Match to PF00411 Ribosomal_S11, Ribosomal protein FT S11 Score 245.13" FT misc_feature 1713292..1713360 FT /colour=8 FT /note="PS00054 Ribosomal protein S11 signature" FT CDS join(1714546..1714920,1715092..1715139) FT /colour=2 FT /gene="rps16-1" FT /gene="SPBC18H10.14" FT /label=rps16-1 FT /note="SPBC18H10.14, len:140" FT /product="40S ribosomal protein S16" FT /fasta_file="fasta/c18H10.tab.seq.02935.out" FT misc_feature 1714567..1714923 FT /note="Match to PF00380 Ribosomal_S9, Ribosomal protein FT S9/S16 Score 212.84" FT misc_feature 1714747..1714803 FT /colour=8 FT /note="PS00360 Ribosomal protein S9 signature" FT misc_feature 1714921..1714926 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT intron 1714921..1715091 FT /colour=2 FT /note="confirmed intron" FT misc_feature 1715075..1715091 FT /colour=6 FT /note="ctaatgattttttttag, splice branch and acceptor" FT CDS join(1715839..1716693,1716752..1717093) FT /colour=7 FT /gene="SPBC18H10.15" FT /label=SPBC18H10.15 FT /note="SPBC18H10.15, len:398, SIMILARITY:Homo sapiens, FT Q12817, pitslre alpha 1., (461 aa), fasta scores: opt: FT 1099, E():0, (48.4% identity in 318 aa)" FT /product="putative serine/threonine protein kinase" FT /fasta_file="fasta/c18H10.tab.seq.02936.out" FT misc_feature 1716058..1716705 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 215.72" FT misc_feature 1716418..1716456 FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT misc_feature 1716694..1716699 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 1716735..1716751 FT /colour=6 FT /note="ctaacaataatattaag, splice branch and acceptor" FT misc_feature 1716746..1716973 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 39.95" FT CDS join(1717613..1719353,1719400..1720811) FT /colour=7 FT /gene="SPBC18H10.16" FT /label=SPBC18H10.16 FT /note="SPBC18H10.16, len:1050, SIMILARITY:Saccharomyces FT cerevisiae, YB85_YEAST, similar to bumetanide-sensitive Na- FT K-Cl cotransport protein, (1120 aa), fasta scores: opt: FT 1898, E():0, (36.9% identity in 1114 aa)" FT /product="CCC Na-K-Cl transporter" FT /fasta_file="fasta/c18H10.tab.seq.02937.out" FT misc_feature 1719354..1719359 FT /note="gcatgt, splice donor sequence" FT misc_feature 1719382..1719399 FT /colour=6 FT /note="ctaacccataaattatag, splice branch and acceptor" FT CDS complement(1721330..1721857) FT /colour=8 FT /gene="SPBC18H10.17c" FT /label=SPBC18H10.17c FT /note="SPBC18H10.17c, len:175" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c18H10.tab.seq.02938.out" FT CDS complement(join(1722955..1723292,1723338..1723728)) FT /colour=12 FT /gene="SPBC18H10.18c" FT /label=SPBC18H10.18c FT /note="SPBC18H10.18c, len:234, almost identical to FT SPCC1682.06" FT /product="hypothetical protein; contains 2 predicted FT transmembrane helices; very high similar to SPCC1682.06; FT possibly S. pombe specific" FT /fasta_file="fasta/c18H10.tab.seq.02939.out" FT misc_feature complement(1723293..1723307) FT /colour=6 FT /note="ctaacgattttctag, splice branch and acceptor" FT misc_feature complement(1723332..1723337) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT LTR 4339308..4339656 FT /note="tf2 type LTR" FT /colour=4 FT /note="Highly similar to tf2 LTR" FT LTR complement(3203459..3203807) FT /note="TF2 type" FT /note="Tf2-type LTR" FT intron 3204066..3204135 FT /colour=2 FT /note="confirmed intron" FT intron 3204237..3204292 FT /colour=2 FT /note="confirmed intron" FT LTR 1726371..1726726 FT /colour=4 FT /note="Tf1 or Tf2 type ltr" FT CDS 1727656..1728579 FT /colour=10 FT /gene="SPBC18H10.19" FT /label=SPBC18H10.19 FT /note="SPBC18H10.19, len:307, SIMILARITY:Homo sapiens, FT O00392, uv radiation resistance associated gene-like(uv FT radiation resistance associated protein)., (648 aa), fasta FT scores: opt: 252, E():9.3e-09, (24.2% identity in 277 aa)" FT /product="hypothetical protein; Pfam-B_13432 a coiled-coil FT domain also in human UVRAG a protein Confers UV radiation FT resistance to a xeroderma pigmentosum cell line; no FT apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c18H10.tab.seq.00046.out" FT CDS complement(1729001..1730086) FT /colour=10 FT /gene="SPBC18H10.20c" FT /label=SPBC18H10.20c FT /note="SPBC18H10.20c, len:361, FT SIMILARITY:Schizosaccharomyces pombe, YDA5_SCHPO, FT hypothetical 42.4 kD protein c1f12.05 in chromosome i., FT (377 aa), fasta scores: opt: 896, E():0, (38.2% identity FT in 364 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YOR322C" FT /fasta_file="fasta/c18H10.tab.seq.02941.out" FT misc_feature 1730959..1734024 FT /note="nominal overlap with cosmid SPBC9B6, EM:AL049769 S. FT pombe chromosome 2" FT misc_feature complement(1732948..1734024) FT /note="retrotransposable element tf2 155 kD- see cosmid FT c9B6 for full length entry" FT /partial FT CDS complement(1733347..1737348) FT /colour=9 FT /gene="tf2-8" FT /gene="SPBC9B6.02c" FT /label=tf2-8 FT /note="SPBC9B6.02c, len:1333" FT /product="retrotransposable element tf2" FT /fasta_file="fasta/c9B6.tab.seq.03138.out" FT LTR complement(1732948..1733296) FT /colour=4 FT /note="Tf2 type ltr" FT /note="Tf2-type LTR" FT misc_feature 1730959..1734024 FT /note="nominal overlap with cosmid SPBC18H10, EM:AL022304 FT S. pombe chromosome 2" FT misc_feature complement(1732137..1732155) FT /colour=6 FT /note="cttacattcactctgtcag, splice branch and acceptor" FT misc_feature complement(1732686..1732691) FT /colour=6 FT /note="gtaagg, splice donor sequence" FT misc_feature complement(1735504..1736043) FT /note="Match to PF00078 Score 154.28" FT LTR complement(1737513..1737861) FT /note="Tf2-type LTR" FT CDS 1738876..1739757 FT /colour=10 FT /gene="SPBC9B6.03" FT /label=SPBC9B6.03 FT /note="SPBC9B6.03, len:293, SIMILARITY:Homo sapiens, FT O15023, kiaa0305., (1539 aa), fasta scores: opt: 263, FT E():3.2e-08, (24.0% identity in 254 aa)" FT /product="hypothetical zinc finger protein" FT /fasta_file="fasta/c9B6.tab.seq.03139.out" FT misc_feature 1739317..1739523 FT /note="Match to PF01363, FYVE, FYVE zinc finger" FT CDS complement(join(1740638..1741822,1741874..1742008)) FT /colour=7 FT /gene="SPBC9B6.04c" FT /label=SPBC9B6.04c FT /note="SPBC9B6.04c, len:439, SIMILARITY:Saccharomyces FT cerevisiae, EFTU_YEAST, elongation factor tu, FT mitochondrial ., (437 aa), fasta scores: opt: 1923, E():0, FT (69.0% identity in 429 aa)" FT /product="elongation factor Tu, mitochondrial; similar to FT S. cerevisiae TUF1" FT /fasta_file="fasta/c9B6.tab.seq.03140.out" FT misc_feature complement(1740701..1741807) FT /note="Match to PF00009, GTP_EFTU, Elongation factor Tu FT family" FT misc_feature complement(1741823..1741836) FT /colour=6 FT /note="ttaacttttttaag, splice branch and acceptor" FT misc_feature complement(1741868..1741873) FT /colour=6 FT /note="gtattt, splice donor sequence" FT CDS complement(join(1742725..1742762,1742864..1742978, FT 1743033..1743050,1743121..1743213,1743255..1743272)) FT /colour=2 FT /gene="lsm3" FT /gene="SPBC9B6.05c" FT /label=lsm3 FT /note="SPBC9B6.05c, len:93, SIMILARITY:Homo sapiens, FT AAD56227, u6 snRNA-associated sm-like protein lsm3., (102 FT aa), fasta scores: opt: 369, E():1.9e-21, (57.8% identity FT in 90 aa)" FT /product="U6 snRNA-associated Sm-like protein; putative FT pre-mRNA splicing factor; similar to S. cerevisiae LSM3" FT /fasta_file="fasta/c9B6.tab.seq.03141.out" FT misc_feature complement(1742763..1742776) FT /colour=6 FT /note="ctaatgaactttag, splice branch and acceptor" FT misc_feature complement(1742858..1742863) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(1742979..1742994) FT /colour=6 FT /note="cttacacgtattttag, splice branch and acceptor" FT misc_feature complement(1743024..1743239) FT /colour=9 FT /note="Pfam match to entry PF01423 Sm, Sm protein, score FT 36.40, E-value 6.4e-07" FT misc_feature complement(1743027..1743032) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(1743051..1743065) FT /colour=6 FT /note="ctaactcgattgtag, splice branch and acceptor" FT misc_feature complement(1743115..1743120) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(1743214..1743226) FT /colour=6 FT /note="ctaatgtttgtag, splice branch and acceptor" FT misc_feature complement(1743249..1743254) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT CDS 1743637..1744299 FT /colour=7 FT /gene="SPBC9B6.06" FT /label=SPBC9B6.06 FT /note="SPBC9B6.06, len:220, SIMILARITY:Saccharomyces FT cerevisiae, RM10_YEAST, mitochondrial 60s ribosomal FT protein l10 , (322 aa), fasta scores: opt: 457, E():1e-20, FT (42.6% identity in 209 aa)" FT /product="mitochondrial ribosomal protein L15 family (L10)" FT /fasta_file="fasta/c9B6.tab.seq.03142.out" FT misc_feature 1743670..1743942 FT /note="Match to PF01305, Ribosomal_L15, Ribosomal protein FT L15 amino terminal region" FT CDS join(1745161..1745203,1745248..1745355,1745412..1745700, FT 1745883..1746096) FT /colour=7 FT /gene="SPBC9B6.07" FT /label=SPBC9B6.07 FT /note="SPBC9B6.07, len:217, SIMILARITY: (At the N FT terminal) to Homo sapiens, NNP1_HUMAN, nnp-1 protein, (461 FT aa), fasta scores: opt: 410, E():1.5e-21, (37.5% identity FT in 184 aa)" FT /product="possibly involved in maturation of 25S rRNA; FT similar to S. cerevisiae RRP1" FT /fasta_file="fasta/c9B6.tab.seq.03143.out" FT misc_feature 1745204..1745209 FT /colour=6 FT /note="gtaaat, splice donor sequence" FT misc_feature 1745235..1745247 FT /colour=6 FT /note="ctaacactgtaag, splice branch and acceptor" FT misc_feature 1745356..1745361 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 1745401..1745411 FT /colour=6 FT /note="ttaatatgcag, splice branch and acceptor" FT misc_feature 1745701..1745706 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1745869..1745882 FT /colour=6 FT /note="ctaactgcttttag, splice branch and acceptor" FT tRNA complement(1746386..1746457) FT /note="tRNA Pro anticodon AGG" FT LTR 1746866..1747205 FT /note="Tf2-type LTR" FT CDS 1747762..1748451 FT /colour=2 FT /gene="clc1" FT /gene="SPBC9B6.08" FT /label=clc1 FT /note="SPBC9B6.08, len:229" FT /product="clathrin light chain; involved in the FT internalisation step of endocytosis" FT /fasta_file="fasta/c9B6.tab.seq.03144.out" FT misc_feature 1747768..1748421 FT /note="Match to PF01086 Score 27.56" FT CDS complement(1749259..1751439) FT /colour=7 FT /gene="SPBC9B6.09c" FT /label=SPBC9B6.09c FT /note="SPBC9B6.09c, len:726, SIMILARITY:Aspergillus FT fumigatus, O43129, multidrug resistance protein 2., (791 FT aa), fasta scores: opt: 1882, E():0, (51.5% identity in FT 610 aa)" FT /product="transport ATP binding protein" FT /fasta_file="fasta/c9B6.tab.seq.03145.out" FT misc_feature complement(1749355..1749912) FT /note="Match to PF00005, ABC_tran, ABC transporter" FT misc_feature complement(1750135..1750968) FT /note="Match to PF00664, ABC_membrane, ABC transporter FT transmembrane region" FT CDS join(1751788..1751810,1751871..1751897,1752227..1752237, FT 1752280..1753619) FT /colour=2 FT /gene="cdc37" FT /gene="SPBC9B6.10" FT /label=cdc37 FT /note="SPBC9B6.10, len:466" FT /product="cell division cycle protein; putative chaperone; FT similar to S. cerevisiae CDC37" FT /fasta_file="fasta/c9B6.tab.seq.03146.out" FT misc_feature 1751811..1751816 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1751855..1751870 FT /colour=6 FT /note="ttaacagaattgacag, splice branch and acceptor" FT misc_feature 1751898..1751903 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 1752213..1752226 FT /colour=6 FT /note="ctaacaacatttag, splice branch and acceptor" FT misc_feature 1752238..1752243 FT /colour=6 FT /note="gtttgt, splice donor sequence" FT misc_feature 1752266..1752279 FT /colour=6 FT /note="ttaaccacatgcag, splice branch and acceptor" FT misc_feature 1754957..1758957 FT /note="nominal overlap with cosmid SPBC28E12, EM:AL031517 FT S.pombe chromosome 2" FT misc_feature complement(1755049..1755059) FT /colour=6 FT /note="ctgattattag, splice branch and acceptor" FT misc_feature complement(1755172..1755177) FT /colour=6 FT /note="gtatga, splice donor sequence" FT CDS complement(join(1753766..1755048,1755178..1755403)) FT /colour=10 FT /gene="SPBC9B6.11c" FT /label=SPBC9B6.11c FT /note="SPBC9B6.11c, len:502, SIMILARITY:Saccharomyces FT cerevisiae, YML8_YEAST, hypothetical 57.7 kD protein in FT ndi1-atr1 intergenic region., (505 aa), fasta scores: opt: FT 856, E():0, (34.0% identity in 467 aa)" FT /product="hypothetical protein; conserved in S. pombe and FT S. cerevisiae" FT /fasta_file="fasta/c9B6.tab.seq.03147.out" FT misc_feature complement(join(1754957..1755048,1755178..1755403)) FT /note="see c9B6 SPAC9B6.11c for full length CDS" FT misc_feature complement(1754957..1758957) FT /note="nominal overlap with cosmid SPBC9B6, EM:AL049769 S. FT pombe chromosome 2" FT CDS join(1760222..1760308,1760446..1760501,1760644..1760993, FT 1761057..1763365) FT /colour=2 FT /gene="rga4" FT /gene="SPBC28E12.03" FT /label=rga4 FT /note="SPBC28E12.03, len:892, FT SIMILARITY:Schizosaccharomyce s pombe, O14014, FT hypothetical 108.6 kD protein c29a4.11 in chromosome I, FT (969 aa), fasta scores: opt: 404, E():8.2e-18 , (23.2% FT identity in 966 aa), also similar to RGA1_YEAST, R HO-TYPE FT GTPASE ACTIVATING PROTEIN RGA1/DBM, (1007 aa),fasta scores, FT opt:230, E():4.5e-17, (21.9% identity in 990 aa ov FT erlap)" FT /product="GTPase activator; RhoGAP domain; similar to S. FT cerevisiae RGA1 required for Rho-like GTPases" FT /fasta_file="fasta/c28E12.tab.seq.03431.out" FT misc_feature 1760596..1760601 FT /colour=6 FT /note="gtttgt, splice donor sequence" FT misc_feature 1760623..1760643 FT /colour=6 FT /note="ctaattaagacggtttgctag, splice branch and acceptor" FT misc_feature 1760994..1760999 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1761041..1761056 FT /colour=6 FT /note="ctaactttaattttag, splice branch and acceptor" FT mRNA 1762783..1762933 FT /colour=3 FT /note="mRNA from AU014507 1 151" FT misc_feature 1762844..1763281 FT /note="Match to PF00620 RhoGAP, RhoGAP domain Score 168.05" FT CDS 1764060..1765130 FT /colour=8 FT /gene="SPBC28E12.04" FT /label=SPBC28E12.04 FT /note="SPBC28E12.04, len:356" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c28E12.tab.seq.03432.out" FT misc_feature complement(1765873..1767956) FT /note="nominal overlap with cosmid SPBC3H7, EM:AL031261 S. FT pombe chromosome 2" FT misc_feature complement(1767753..1767866) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 24.09" FT misc_feature 1765873..1767956 FT /note="nominal overlap with cosmid SPBC28E12, EM:AL031517 FT S. pombe chromosome 2" FT misc_feature complement(1767753..1767869) FT /colour=9 FT /note="Pfam match to entry PF00400 G-beta, WD domain, G- FT bet a repeats" FT misc_feature complement(1767897..1767986) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 22.47" FT CDS complement(join(1776188..1776394,1776517..1777407)) FT /colour=2 FT /gene="hhp1" FT /gene="SPBC3H7.15" FT /label=hhp1 FT /note="SPBC3H7.15, len:365" FT /product="serine/threonine protein kinase; casein kinase FT i; required for DNA repair; similar to S. cerevisiae HRR25" FT /fasta_file="fasta/c3H7.tab.seq.02852.out" FT misc_feature complement(1776395..1776412) FT /colour=6 FT /note="ctaacatttaaattgtag, splice branch and acceptor" FT intron complement(1776395..1776516) FT /note="confirmed by mRNA" FT misc_feature complement(1776511..1776516) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(1776646..1777377) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 142.71" FT CDS complement(1778362..1779582) FT /colour=8 FT /gene="SPBC3H7.14" FT /label=SPBC3H7.14 FT /note="SPBC3H7.14, len:437aa" FT /note="SPBC3H7.14, len:406, SIMILARITY:Schizosaccharomyces FT pombe, O13769, hypothetical 73.8 kD protein c17a5.07c in FT chromosome i., (652 aa), fasta scores: opt: 137, E():0.31, FT (26.0% identity in 154 aa)" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c3H7.tab.seq.02853.out" FT CDS complement(1780793..1781698) FT /colour=7 FT /gene="SPBC3H7.13" FT /label=SPBC3H7.13 FT /note="SPBC3H7.13, len:301, SIMILARITY:Schizosaccharomyces FT pombe, DMA1_SCHPO, dma1 protein., (267 aa), fasta scores: FT opt: 234, E():1.5e-08, (39.6% identity in 101 aa)" FT /product="forkhead nuclear signalling domain protein" FT /fasta_file="fasta/c3H7.tab.seq.02854.out" FT misc_feature complement(1781381..1781617) FT /note="Match to PF00498 FHA, Forkhead-associated (FHA) FT domain Score 53.24" FT CDS complement(1782765..1783628) FT /colour=8 FT /gene="SPBC3H7.12" FT /label=SPBC3H7.12 FT /note="SPBC3H7.12, len:287aa" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c3H7.tab.seq.02855.out" FT CDS complement(join(1783967..1784425,1784498..1784785)) FT /colour=7 FT /gene="SPBC3H7.11" FT /label=SPBC3H7.11 FT /note="SPBC3H7.11, len:248, SIMILARITY:Arabidopsis FT thaliana, O64850, t1d16.16 protein., (581 aa), fasta FT scores: opt: 689, E():0, (42.6% identity in 242 aa)" FT /product="putative methyltransferase" FT /fasta_file="fasta/c3H7.tab.seq.02856.out" FT misc_feature complement(1784426..1784446) FT /colour=6 FT /note="ctaacctttgtcttaatttag, splice branch and acceptor" FT misc_feature complement(1784492..1784497) FT /colour=6 FT /note="gtaagg, splice donor sequence" FT CDS complement(join(1785376..1785930,1786013..1786207)) FT /colour=10 FT /gene="SPBC3H7.10" FT /label=SPBC3H7.10 FT /note="SPBC3H7.10, len:249aa" FT /product="hypothetical protein; conserved in human, FT Drosophila, mouse; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c3H7.tab.seq.02857.out" FT misc_feature complement(1785931..1785953) FT /colour=6 FT /note="ctaacctactgaaccaatattag, splice branch and acceptor" FT misc_feature complement(1786007..1786012) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS complement(1786996..1788048) FT /colour=10 FT /gene="SPBC3H7.09" FT /label=SPBC3H7.09 FT /note="SPBC3H7.09, len:350, SIMILARITY:Homo sapiens, FT AAD34084, cgi-89 protein., (382 aa), fasta scores: opt: FT 559, E():1.8e-29, (31.7% identity in 290 aa)" FT /product="conserved protein; zinc finger protein; zf-DHHC FT type" FT /fasta_file="fasta/c3H7.tab.seq.02858.out" FT CDS join(1789851..1789919,1789989..1790040,1790201..1790442) FT /colour=8 FT /gene="SPBC3H7.08c" FT /label=SPBC3H7.08c FT /note="SPBC3H7.08c, len:121aa" FT /note="SPBC3H7.08c, len:120, SIMILARITY:Caenorhabditis FT elegans., O16749, similar to a homeobox domain., (543 aa), FT fasta scores: opt: 103, E():3.3, (25.3% identity in 75 aa)" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c3H7.tab.seq.02859.out" FT misc_feature 1789920..1789925 FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature 1789970..1789988 FT /colour=6 FT /note="ctgatcagtttgctgttag, splice branch and acceptor" FT misc_feature 1790041..1790046 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1790186..1790200 FT /colour=6 FT /note="ctaacagttttttag, splice branch and acceptor" FT CDS join(1790933..1791730,1791802..1791900) FT /colour=7 FT /gene="SPBC3H7.07c" FT /label=SPBC3H7.07c FT /note="SPBC3H7.07c, len:298, SIMILARITY:Saccharomyces FT cerevisiae, SERB_YEAST, phosphoserine phosphatase, (309 FT aa), fasta scores: opt: 638, E():0, (43.2% identity in 266 FT aa)" FT /product="phosphoserine phosphatase; possibly involved in FT synthesis of serine from 3-phosphoglycerate" FT /fasta_file="fasta/c3H7.tab.seq.02860.out" FT misc_feature 1791731..1791736 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT intron 1791731..1791801 FT /note="confirmed by mRNA" FT misc_feature 1791776..1791801 FT /colour=6 FT /note="ctaactcgatttttttttttaattag, splice branch and FT accept or" FT CDS join(1792446..1792810,1792881..1793919) FT /colour=2 FT /gene="pof9" FT /gene="SPBC3H7.06c" FT /label=pof9 FT /note="SPBC3H7.06c, len:467, SIMILARITY:Saccharomyces FT cerevisiae, YB9W_YEAST, hypothetical 71.1 kD protein in FT paf1-mrpl27 intergenic region.hypothetical 71.1 kD protein FT in paf1-mrpl27 intergenic region., (642 aa), fasta scores: FT opt: 244, E():1e-08, (25.5% identity in 302 aa)" FT /product="F-box protein" FT /fasta_file="fasta/c3H7.tab.seq.02861.out" FT misc_feature 1792811..1792816 FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature 1792855..1792880 FT /colour=6 FT /note="ctaactattccctatgcggaatttag, splice branch and FT accept or" FT CDS 1795058..1796131 FT /colour=8 FT /gene="SPBC3H7.05c" FT /label=SPBC3H7.05c FT /note="SPBC3H7.05c, len:357aa" FT /product="hypothetical protein; sequence orphan; contains FT 7 predicted transmembrane helices; predicted N-terminal FT signal sequence" FT /fasta_file="fasta/c3H7.tab.seq.02862.out" FT CDS complement(1796496..1797158) FT /colour=7 FT /gene="SPBC3H7.04" FT /label=SPBC3H7.04 FT /note="SPBC3H7.04, len:220, SIMILARITY:Chlamydomonas FT reinhardtii., SODM_CHLRE, superoxide dismutase [mn] , (218 FT aa), fasta scores: opt: 268, E():3.5e-11, (32.9% identity FT in 140 aa)" FT /product="putative superoxide dismutase" FT /fasta_file="fasta/c3H7.tab.seq.02863.out" FT misc_feature complement(1796511..1796843) FT /colour=9 FT /note="Pfam match to entry PF00081 sodfe, Iron/manganese FT su peroxide dismutases (SODM)" FT misc_feature complement(1796517..1796843) FT /note="Match to PF00081 sodfe, Iron/manganese superoxide FT dismutases (SODM) Score 40.25" FT tRNA 1797820..1797891 FT /note="tRNA Pro anticodon AGG, Cove score 48.70" FT CDS 1801338..1804367 FT /colour=7 FT /gene="SPBC3H7.03c" FT /label=SPBC3H7.03c FT /note="SPBC3H7.03c, len:1009, SIMILARITY:Saccharomyces FT cerevisiae, ODO1_YEAST, 2-oxoglutarate dehydrogenase e1 FT component, mitochondrial (ec 1.2.4.2), (1014 aa), fasta FT scores: opt: 4131, E():0, (59.2% identity in 1018 aa)" FT /product="Putative 2-oxoglutarate dehydrogenase e1 FT component; similar to S. cerevisiae KGD1" FT /fasta_file="fasta/c3H7.tab.seq.02864.out" FT misc_feature 1802082..1803062 FT /colour=9 FT /note="Pfam match to entry PF00676 E1_dehydrog, FT Dehydrogena se E1 component" FT misc_feature 1802106..1803047 FT /note="Match to PF00676 E1_dehydrog, Dehydrogenase E1 FT component Score 190.75" FT CDS complement(1804964..1807597) FT /colour=7 FT /gene="SPBC3H7.02" FT /label=SPBC3H7.02 FT /note="SPBC3H7.02, len:877, SIMILARITY:Neurospora crassa., FT CY14_NEUCR, sulfate permease ii., (788 aa), fasta scores: FT opt: 1199, E():0, (36.8% identity in 786 aa)" FT /product="SulP sulfate transporter" FT /fasta_file="fasta/c3H7.tab.seq.02865.out" FT misc_feature complement(1805942..1806904) FT /note="Match to PF00916 Sulfate_transp, Sulfate FT transporter family Score 324.87" FT misc_feature complement(1811084..1811099) FT /colour=6 FT /note="ctaatatgcatgctag, splice branch and acceptor" FT intron complement(1811084..1811139) FT /note="confirmed by mRNA" FT misc_feature complement(1811134..1811139) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1811482..1811499) FT /colour=6 FT /note="cttaccattcttttgtag, splice branch and acceptor" FT misc_feature complement(1811532..1811537) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT intron complement(1811482..1811537) FT /note="confirmed by mRNA" FT /colour=2 FT /note="confirmed intron" FT misc_feature 1811178..1811603 FT /note="nominal overlap with cosmid SPBC3H7 S. pombe FT chromosome 2" FT intron complement(1811823..1811868) FT /colour=2 FT /note="confirmed intron" FT intron complement(1811995..1812141) FT /colour=2 FT /note="confirmed intron" FT intron complement(1812353..1812389) FT /colour=2 FT /note="confirmed intron" FT CDS join(1813755..1814027,1814114..1814187,1814240..1814861) FT /colour=2 FT /gene="mcs2" FT /gene="SPBP16F5.02" FT /label=mcs2 FT /note="SPBP16F5.02, len:323" FT /product="cyclin; transcription initiation factor TFIIH FT subunit; similar to S. cerevisiae CCL1" FT /fasta_file="fasta/p16F5.tab.seq.04323.out" FT misc_feature 1814250..1814834 FT /note="Match to PF00134 cyclin, Cyclin Score 86.68" FT CDS complement(1815032..1826131) FT /colour=7 FT /gene="SPBP16F5.03c" FT /label=SPBP16F5.03c FT /note="SPBP16F5.03c, len:3700, FT SIMILARITY:Schizosaccharomyces pombe, YAMB_SCHPO, FT hypothetical 420.8 kDa protein c1f5.11c in chromosome i., FT (3655 aa), fasta scores: opt: 3110, E():0, (35.3% identity FT in 3713 aa)" FT /product="putative phosphatidylinositol kinase; putative FT SAGA complex (Spt-Ada-Gcn5-Acetyltransferase); similar to FT S. cerevisiae TRA1" FT /fasta_file="fasta/p16F5.tab.seq.04324.out" FT misc_feature complement(1815245..1815649) FT /note="Match to PF00454 PI3_PI4_kinase, FT Phosphatidylinositol 3- and 4-kinases Score 68.80" FT misc_feature complement(1815842..1816021) FT /note="Match to PF00454 PI3_PI4_kinase, FT Phosphatidylinositol 3- and 4-kinases Score 38.11" FT misc_feature join(1826389..1826586,1826983..1827040,1827090..1827328) FT /note="Match to PF00179 UQ_con, Ubiquitin-conjugating FT enzyme Score 233.50" FT CDS join(1826398..1826586,1826983..1827040,1827090..1827343) FT /EC_number="6.3.2.19" FT /colour=2 FT /gene="ubcp3" FT /gene="SPBP16F5.04" FT /label=ubcp3 FT /note="SPBP16F5.04, len:167" FT /product="ubiquitin-conjugating enzyme e2-18 kDa" FT /fasta_file="fasta/p16F5.tab.seq.04325.out" FT intron 1826587..1826982 FT /note="confirmed by mRNA" FT CDS complement(1827831..1828271) FT /colour=7 FT /gene="SPBP16F5.05c" FT /label=SPBP16F5.05c FT /note="SPBP16F5.05c, len:147, SIMILARITY:Neurospora FT crassa., CAB88595, ankyrin repeat-containing yar1 related FT protein., (189 aa), fasta scores: opt: 270, E():2.5e-12, FT (36.5% identity in 148 aa)" FT /product="ankyrin repeat protein; S. cerevisiae YAR1 FT related protein" FT /fasta_file="fasta/p16F5.tab.seq.04326.out" FT misc_feature complement(1827966..1828064) FT /note="Match to PF00023 ank, Ank repeat Score 45.56" FT CDS 1828731..1830167 FT /colour=7 FT /gene="SPBP16F5.06" FT /label=SPBP16F5.06 FT /note="SPBP16F5.06, len:479, SIMILARITY:Homo sapiens, FT BAA91479, cDNA flj10187 fis, clone hemba1004596, (427 aa), FT fasta scores: opt: 273, E():2.3e-09, (26.6% identity in FT 418 aa)" FT /product="putative nucleolar required for 60S ribosome FT biogenesis; similar to S. cerevisiae YOL144W" FT /fasta_file="fasta/p16F5.tab.seq.04327.out" FT CDS join(1830779..1830840,1830916..1831021,1831092..1831739, FT 1831818..1832282) FT /colour=2 FT /gene="apm1" FT /gene="SPBP16F5.07" FT /label=apm1 FT /note="SPBP16F5.07, len:427, SIMILARITY:Mus musculus, FT AAF61814, clathrin-associated adaptor medium chain mu 1a., FT (423 aa), fasta scores: opt: 1801, E():0, (62.4% identity FT in 425 aa)" FT /product="clathrin-associated protein (AP) complex subunit" FT /fasta_file="fasta/p16F5.tab.seq.04328.out" FT misc_feature join(1830791..1830840,1830916..1831021,1831092..1831739, FT 1831818..1832276) FT /note="Match to PF00928 Adap_comp_sub, Adaptor complexes FT medium subunit family Score 671.57" FT CDS complement(1832735..1834078) FT /colour=7 FT /gene="SPBP16F5.08c" FT /label=SPBP16F5.08c FT /note="SPBP16F5.08c, len:448, SIMILARITY:Arabidopsis FT thaliana, BAB09944, dimethylaniline monooxygenase-like FT protein., (460 aa), fasta scores: opt: 568, E():2.4e-28, FT (30.5% identity in 429 aa)" FT /product=" similar to flavin-containing monooxygenases and FT to mammalian dimethylalanine monooxygenases" FT /fasta_file="fasta/p16F5.tab.seq.04329.out" FT misc_feature 1836853..1836976 FT /note="nominal overlap with SPBC16E9 S. pombe chromosome 2" FT CDS complement(join(1838760..1840300,1840518..1840587, FT 1840674..1840772)) FT /colour=10 FT /gene="SPBC16E9.02c" FT /label=SPBC16E9.02c FT /note="SPBC16E9.02c, len:569, SIMILARITY:Homo sapiens, FT O95815, dentin phosphoryn, (788 aa), fasta scores: opt: FT 316, E():1.3e-08, (17.1% identity in 516 aa)" FT /product="hypothetical protein; contains cue domain-Domain FT that possibly involved in binding ubiquitin-conjugating FT enzymes (UBCs)" FT /fasta_file="fasta/c16E9.tab.seq.02518.out" FT misc_feature complement(1840301..1840313) FT /colour=6 FT /note="ctaaccataatag, splice branch and acceptor" FT misc_feature complement(1840512..1840517) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1840588..1840608) FT /colour=6 FT /note="ctaacatatatttatctatag, splice branch and acceptor" FT misc_feature complement(1840668..1840673) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS complement(1841362..1842111) FT /colour=8 FT /gene="SPBC16E9.03c" FT /label=SPBC16E9.03c FT /note="SPBC16E9.03c, len:249aa" FT /product="hypothetical protein; sequence orphan; contains FT predicted N-terminal signal sequence" FT /fasta_file="fasta/c16E9.tab.seq.02519.out" FT CDS 1842467..1842772 FT /colour=9 FT /gene="SPBC16E9.19" FT /label=SPBC16E9.19 FT /note="SPBC16E9.19, unknown, len:101aa" FT /product="very hypothetical protein" FT /fasta_file="fasta/c16E9.tab.seq.02520.out" FT CDS 1844585..1845721 FT /EC_number="2.1.1.41" FT /colour=7 FT /gene="SPBC16E9.05" FT /label=SPBC16E9.05 FT /note="SPBC16E9.05, len:378, SIMILARITY:Candida albicans, FT ERG6_CANAL, delta(24)-sterol c-methyltransferase, (376 aa), FT fasta scores: opt: 1401, E():0, (54.8% identity in 376 FT aa)" FT /product="putative delta-sterol c-methyltransferase" FT /fasta_file="fasta/c16E9.tab.seq.02521.out" FT CDS complement(1846285..1846593) FT /colour=2 FT /gene="uvi31" FT /gene="SPBC16E9.06c" FT /label=uvi31 FT /note="SPBC16E9.06c, len:102" FT /product="uv-induced protein uvi31" FT /fasta_file="fasta/c16E9.tab.seq.02522.out" FT CDS 1847739..1848680 FT /colour=8 FT /gene="SPBC16E9.07" FT /label=SPBC16E9.07 FT /note="SPBC16E9.07, unknown, len:313aa" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c16E9.tab.seq.02523.out" FT CDS 1849402..1850469 FT /colour=8 FT /gene="SPBC16E9.08" FT /label=SPBC16E9.08 FT /note="SPBC16E9.08, unknown, len:355aa" FT /product="hypothetical protein; predicted coiled-coil FT region; sequence orphan" FT /fasta_file="fasta/c16E9.tab.seq.02524.out" FT CDS complement(join(1851111..1851139,1851181..1851372, FT 1851434..1851647,1851711..1851923)) FT /colour=7 FT /gene="SPBC16E9.09c" FT /label=SPBC16E9.09c FT /note="SPBC16E9.09c, len:215, SIMILARITY:Saccharomyces FT cerevisiae, Q05359, similar to s. cerevisiae yhr110p., FT (219 aa), fasta scores: opt: 442, E():8.2e-24, (32.2% FT identity in 202 aa)" FT /product="similar to COPII-coated vesicle proteins" FT /fasta_file="fasta/c16E9.tab.seq.02525.out" FT misc_feature complement(join(1851114..1851139,1851181..1851372, FT 1851434..1851647,1851711..1851911)) FT /note="Match to PF01105 EMP24_GP25L, emp24/gp25L/p24 FT family Score 250.09" FT misc_feature complement(1851140..1851152) FT /colour=6 FT /note="ctaacttttccag, splice branch and acceptor" FT misc_feature complement(1851175..1851180) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1851279..1851914) FT /colour=9 FT /note="Pfam match to entry PF01105 EMP24_GP25L, FT emp24/gp25L/p24 family" FT misc_feature complement(1851373..1851390) FT /colour=6 FT /note="ctaatcccttttttgtag, splice branch and acceptor" FT misc_feature complement(1851428..1851433) FT /colour=6 FT /note="gtttgt, splice donor sequence" FT misc_feature complement(1851648..1851662) FT /colour=6 FT /note="ctaacaaatatttag, splice branch and acceptor" FT misc_feature complement(1851705..1851710) FT /colour=6 FT /note="gtatga, splice donor sequence" FT CDS complement(join(1852498..1853927,1853971..1854399, FT 1854459..1854624,1854686..1855000)) FT /colour=7 FT /gene="SPBC16E9.10c" FT /label=SPBC16E9.10c FT /note="SPBC16E9.10c, unknown, len:779aa, similar eg. to FT YLL 034C, YL34_YEAST, Q07844, similar to mammalian valosin, FT (837aa), fasta scores, opt:1409, E():0, (57.5% identity FT in 767 aa overlap)" FT /product="AAA family ATPase; similar to S. cerevisiae FT YLL034C" FT /fasta_file="fasta/c16E9.tab.seq.02526.out" FT misc_feature complement(1852696..1853256) FT /note="Match to PF00004 AAA, ATPases associated with FT various cellular activities (AAA) Score 337.42" FT misc_feature complement(join(1853644..1853932,1853967..1854253)) FT /note="Match to PF00004 AAA, ATPases associated with FT various cellular activities (AAA) Score 282.64" FT misc_feature complement(1853928..1853943) FT /colour=6 FT /note="ctaacagttcag, splice branch and acceptor" FT misc_feature complement(1853965..1853970) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1854400..1854416) FT /colour=6 FT /note="ctaacacttttttaaag, splice branch and acceptor" FT misc_feature complement(1854453..1854458) FT /colour=6 FT /note="gtttgt, splice donor sequence" FT misc_feature complement(1854680..1854685) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT CDS complement(join(1856376..1858557,1858900..1859078)) FT /colour=7 FT /gene="SPBC16E9.11c" FT /label=SPBC16E9.11c FT /note="SPBC16E9.11c, len:786, FT SIMILARITY:Schizosaccharomyces pombe, PUB1_SCHPO, FT ubiquitin--protein ligase pub1, (767 aa), fasta scores: FT opt: 2620, E():0, (62.2% identity in 796 aa)" FT /product="ubiquitin--protein ligase" FT /fasta_file="fasta/c16E9.tab.seq.02527.out" FT misc_feature complement(1856385..1857293) FT /note="Match to PF00632 HECT, HECT-domain (ubiquitin- FT transferase). Score 552.92" FT misc_feature complement(1857552..1857629) FT /colour=8 FT /note="PS01159 WW/rsp5/WWP domain signature" FT misc_feature complement(1857552..1857641) FT /note="Match to PF00397 WW_rsp5_WWP, WW domain Score 53.17" FT misc_feature complement(1857726..1857803) FT /colour=8 FT /note="PS01159 WW/rsp5/WWP domain signature" FT misc_feature complement(1857726..1857815) FT /note="Match to PF00397 WW_rsp5_WWP, WW domain Score 55.85" FT misc_feature complement(1857936..1858013) FT /colour=8 FT /note="PS01159 WW/rsp5/WWP domain signature" FT misc_feature complement(1857936..1858025) FT /note="Match to PF00397 WW_rsp5_WWP, WW domain Score 56.47" FT misc_feature complement(1858558..1858572) FT /colour=6 FT /note="ctaactaaattctag, splice branch and acceptor" FT misc_feature complement(1858809..1859057) FT /colour=9 FT /note="Pfam match to entry PF00168 C2, C2 domain" FT misc_feature complement(1858894..1858899) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT CDS complement(join(1860693..1860815,1860872..1860959, FT 1861015..1861268,1861320..1861355)) FT /colour=2 FT /gene="pab2" FT /gene="SPBC16E9.12c" FT /label=pab2 FT /note="SPBC16E9.12c, len:166, SIMILARITY:Mus musculus, FT O35935, poly(a) binding protein ii., (302 aa), fasta FT scores: opt: 457, E():7.5e-20, (46.4% identity in 192 aa)" FT /product="poly(A)-binding protein; polyadenylation factor" FT /fasta_file="fasta/c16E9.tab.seq.02528.out" FT misc_feature complement(1860816..1860831) FT /colour=6 FT /note="ctaacttgaaatgtag, splice branch and acceptor" FT misc_feature complement(1860866..1860871) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(join(1860869..1860959,1861015..1861136)) FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 58.63" FT misc_feature complement(1860960..1860976) FT /colour=6 FT /note="ctaacctagtttcgtag, splice branch and acceptor" FT misc_feature complement(1861009..1861014) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(1861269..1861281) FT /colour=6 FT /note="cttacatgattag, splice branch and acceptor" FT misc_feature complement(1861314..1861319) FT /colour=6 FT /note="gtagga, splice donor sequence" FT CDS 1863826..1865250 FT /colour=7 FT /gene="SPBC16E9.13" FT /label=SPBC16E9.13 FT /note="SPBC16E9.13, len:474, SIMILARITY:Saccharomyces FT cerevisiae, KSP1_YEAST, serine/threonine-protein kinase FT ksp1, (1029 aa), fasta scores: opt: 588, E():1.1e-27, FT (29.7% identity in 417 aa)" FT /product="putative serine/threonine protein kinase; FT similar to S. cerevisiae KSP1" FT /fasta_file="fasta/c16E9.tab.seq.02529.out" FT misc_feature 1863850..1864629 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 205.89" FT misc_feature 1864222..1864260 FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT CDS complement(1865761..1866921) FT /colour=7 FT /gene="SPBC16E9.14c" FT /label=SPBC16E9.14c FT /note="SPBC16E9.14c, len:386, SIMILARITY:Saccharomyces FT cerevisiae, YN8N_YEAST, hypothetical 67.5 kD protein, (605 FT aa), fasta scores: opt: 300, E():4.6e-12, (27.7% identity FT in 325 aa)" FT /product="zinc-regulated gene suggested to function in FT zinc-uptake; similar to S. cerevisiae ZRG17" FT /fasta_file="fasta/c16E9.tab.seq.02530.out" FT CDS join(1867577..1867639,1867697..1867720,1867770..1867812, FT 1867877..1867974) FT /colour=7 FT /gene="SPBC16E9.15" FT /label=SPBC16E9.15 FT /note="SPBC16E9.15, len:75, SIMILARITY:Homo sapiens, FT O75506, heat shock factor binding protein 1 hsbp1., (76 FT aa), fasta scores: opt: 112, E():0.072, (25.9% identity in FT 54 aa)" FT /product="small protein conserved in human and D. FT melanogasta; similar to human heat shock factor binding FT protein 1 a negative regulator of the heat shock FT response; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c16E9.tab.seq.02531.out" FT misc_feature 1867640..1867645 FT /colour=6 FT /note="gtgcgt, splice donor sequence" FT misc_feature 1867677..1867696 FT /colour=6 FT /note="ctaaccttgtttacttttag, splice branch and acceptor" FT misc_feature 1867721..1867726 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 1867753..1867769 FT /colour=6 FT /note="ctaacagatttttatag, splice branch and acceptor" FT misc_feature 1867813..1867818 FT /colour=6 FT /note="gtacga, splice donor sequence" FT misc_feature 1867851..1867876 FT /colour=6 FT /note="ctaatcataactttttatgttaacag, splice branch and FT accept or" FT CDS complement(join(1868584..1869516,1869515..1870657, FT 1870852..1870854)) FT /colour=4 FT /gene="SPBC16E9.16c" FT /label=SPBC16E9.16c FT /note="region has been base checked" FT /note="has frameshift, & non consensus branch" FT /note="SPBC16E9.16c, len:677, SIMILARITY:Pecten maximus., FT AAD52842, myosin heavy chain., (1940 aa), fasta scores: FT opt: 272, E():5.6e-06, (22.2% identity in 526 aa)" FT /product="pseudogene" FT /pseudo FT /fasta_file="fasta/c16E9.tab.seq.02532.out" FT misc_feature complement(1868683..1868706) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature complement(1870846..1870851) FT /colour=6 FT /note="gttgga, splice donor sequence" FT misc_feature complement(1870855..1874021) FT /note="gene free region, with strand specific FT compositional bias, main strand is ag rich, comp strand ct FT rich" FT CDS complement(join(1874018..1874764,1874850..1875311)) FT /colour=2 FT /gene="rem1" FT /gene="SPBC16E9.17c" FT /label=rem1 FT /note="SPBC16E9.17c, len:402, FT SIMILARITY:Schizosaccharomyces pombe, CAB39897, g2/mitotic- FT specific cyclin cig1p., (415 aa), fasta scores: opt: 617, FT E():6.3e-33, (35.9% identity in 256 aa)" FT /product="putative g2/mitotic-specific cyclin" FT /fasta_file="fasta/c16E9.tab.seq.02533.out" FT misc_feature complement(1874078..1874764) FT /note="Match to PF00134 cyclin, Cyclin Score 171.02" FT misc_feature complement(1874609..1874704) FT /colour=8 FT /note="PS00292 Cyclins signature" FT misc_feature complement(1874765..1874778) FT /colour=6 FT /note="ttaacattttttag, splice branch and acceptor" FT misc_feature complement(1874844..1874849) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 1876534..1876917 FT /note="nominal overlap with cosmid SPBC1E8 S. pombe FT chromosome 2" FT misc_feature 1876534..1876917 FT /note="nominal overlap with cosmid SPBC16E9, EM:Z99759 FT S.pombe chromosome 2" FT CDS 1878724..1880535 FT /colour=10 FT /gene="SPBC1E8.02" FT /label=SPBC1E8.02 FT /note="SPBC1E8.02, unknown, len:603aa, Pfam PF0024 0, FT Ubiquitin family" FT /product="proline-rich ubiquitin family domain similar to FT human bat3" FT /fasta_file="fasta/c1E8.tab.seq.02679.out" FT misc_feature 1878733..1878906 FT /colour=9 FT /note="Pfam PF00240, Ubiquitin family" FT CDS complement(1880983..1882416) FT /colour=8 FT /gene="SPBC1E8.03c" FT /label=SPBC1E8.03c FT /note="SPBC1E8.03c, unknown, len:477aa" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c1E8.tab.seq.02680.out" FT LTR 1885474..1885822 FT /colour=4 FT /note="tf2 type LTR" FT misc_feature 1885474..1890388 FT /note="transposon and LTRs- pseudo" FT CDS 1885989..1889986 FT /colour=4 FT /gene="SPBC1E8.04c" FT /label=SPBC1E8.04c FT /product="frameshifted transposon" FT /pseudo FT /fasta_file="fasta/c1E8.tab.seq.02681.out" FT misc_feature 1886790..1886825 FT /colour=8 FT /note="PS00141 Eukaryotic and viral aspartyl proteases FT acti ve site" FT misc_feature 1887294..1887833 FT /note="Match to PF00078 rvt, Reverse transcriptase (RNA- FT dependent DNA polymerase) Score 154.95" FT LTR 1890040..1890388 FT /colour=4 FT /note="tf2 type LTR" FT CDS 1891513..1892466 FT /colour=8 FT /gene="SPBC1E8.05" FT /label=SPBC1E8.05 FT /note="SPBC1E8.05" FT /product="hypothetical serine-rich protein; with low FT similar to proteophosphoglycans; sequence orphan; contains FT predicted N-terminal signal sequence" FT /fasta_file="fasta/c1E8.tab.seq.02682.out" FT misc_feature 1892726..1895751 FT /note="nominal overlap with cosmid SPBC1A45P, EM:AL031174 FT S. pombe chromosome 2" FT misc_feature 1894133..1894138 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1894177..1894203 FT /colour=6 FT /note="ctaactataattttctttgtctttaag, splice branch and FT accep tor" FT misc_feature 1894531..1894536 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 1894574..1894588 FT /colour=6 FT /note="ctaacactgatgcag, splice branch and acceptor" FT misc_feature complement(1895114..1895743) FT /note="Match to PF00180 isodh, Isocitrate and FT isopropylmalate dehydrogenases Score 384.92" FT misc_feature complement(1895411..1895470) FT /colour=8 FT /note="PS00470 Isocitrate and isopropylmalate FT dehydrogenase s signature" FT misc_feature 1892726..1895751 FT /note="nominal overlap with cosmid SPBC1E8, EM:AL021746 S. FT pombe chromosome 2" FT misc_feature 1894133..1894138 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1894177..1894203 FT /colour=6 FT /note="ctaactataattttctttgtctttaag, splice branch and FT accep tor" FT misc_feature 1894531..1894536 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 1894574..1894588 FT /colour=6 FT /note="ctaacactgatgcag, splice branch and acceptor" FT misc_feature complement(1895102..1896196) FT /colour=9 FT /note="Pfam match to entry isodh PF00180, Isocitrate and FT is opropylmalate dehydrogenases" FT CDS complement(join(1896852..1901225,1901282..1901365)) FT /EC_number="5.99.1.3" FT /colour=2 FT /gene="top2" FT /gene="SPBC1A4.03c" FT /label=top2 FT /note="SPBC1A4.03c, len:1485aa, anomoly: we predict FT additional N-terminal exon which increases homology with FT TOP2_CANAL/P87078" FT /product="DNA topoisomerase II" FT /fasta_file="fasta/c1A4.tab.seq.03152.out" FT misc_feature complement(1899390..1901078) FT /note="Match to PF00204 DNA_topoisoII, DNA topoisomerase FT II (N-terminal region) Score 1148.41" FT misc_feature complement(1901226..1901241) FT /colour=6 FT /note="ctaacaacaacttttttag, splice branch and acceptor" FT misc_feature complement(1901276..1901281) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT CDS 1903872..1904621 FT /colour=8 FT /gene="SPBC1A4.04" FT /label=SPBC1A4.04 FT /note="SPBC1A4.04, len:249aa" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c1A4.tab.seq.03153.out" FT CDS join(1905115..1905161,1905215..1907270) FT /colour=8 FT /gene="SPBC1A4.05" FT /label=SPBC1A4.05 FT /note="SPBC1A4.05, len:700, LOW SIMILARITY:Homo sapiens, FT REST_HUMAN, restin, (1427 aa), fasta scores: opt: 183, FT E():0.01, (18.9% identity in 609 aa)" FT /product="hypothetical protein; sequence orphan; predicted FT coiled-coil protein" FT /fasta_file="fasta/c1A4.tab.seq.03154.out" FT misc_feature 1905162..1905167 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1905198..1905214 FT /colour=6 FT /note="ctaacggtaattaatag, splice branch and acceptor" FT CDS complement(join(1907675..1908274,1908336..1908614, FT 1908680..1908952)) FT /colour=7 FT /gene="SPBC1A4.06c" FT /label=SPBC1A4.06c FT /note="SPBC1A4.06c, len:383, SIMILARITY:Saccharomyces FT cerevisiae, YG1W_YEAST, hypothetical 44.2 kD protein in FT rme1-tfc4 intergenic region., (385 aa), fasta scores: opt: FT 630, E():0, (42.0% identity in 269 aa)" FT /product="similar to proline transport helper protein" FT /fasta_file="fasta/c1A4.tab.seq.03155.out" FT misc_feature complement(1908275..1908296) FT /colour=6 FT /note="ttaaccgaatttgaacaaatag, splice branch and acceptor" FT misc_feature complement(1908330..1908335) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1908615..1908634) FT /colour=6 FT /note="ctaacttatgtctctgctag, splice branch and acceptor" FT misc_feature complement(1908674..1908679) FT /colour=6 FT /note="gtaaat, splice donor sequence" FT CDS complement(join(1909585..1910633,1910690..1910951)) FT /colour=7 FT /gene="SPBC1A4.07c" FT /label=SPBC1A4.07c FT /note="SPBC1A4.07c, len:436, SIMILARITY:Saccharomyces FT cerevisiae, SOF1_YEAST, sof1 protein, associated with U3 FT small nucleolar RNA (snoRNA) and involved in 18S pre-rRNA FT maturation, (489 aa), fasta scores: opt: 1192, E():0, FT (51.2% identity in 465 aa)" FT /product="WD repeat protein; putative U3 snoRNP complex FT associated; involved in 18S pre-rRNA maturation; similar FT to S. cerevisiae SOF1" FT /fasta_file="fasta/c1A4.tab.seq.03156.out" FT misc_feature complement(1909867..1909947) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 31.40" FT misc_feature complement(1909993..1910100) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 39.61" FT misc_feature complement(1910304..1910423) FT /colour=9 FT /note="Pfam match to entry PF00400 WD40, WD domain, G-beta FT repeat, score 5.00, E-value 12" FT misc_feature complement(1910433..1910543) FT /colour=9 FT /note="Pfam match to entry PF00400 WD40, WD domain, G-beta FT repeat, score 6.40, E-value 7.9" FT misc_feature complement(1910550..1910663) FT /colour=9 FT /note="Pfam match to entry PF00400 WD40, WD domain, G-beta FT repeat, score 10.60, E-value 2.3" FT misc_feature complement(1910634..1910649) FT /colour=6 FT /note="ctaacacattttctag, splice branch and acceptor" FT misc_feature complement(1910673..1910792) FT /colour=9 FT /note="Pfam match to entry PF00400 WD40, WD domain, G-beta FT repeat, score 18.40, E-value 0.17" FT misc_feature complement(1910684..1910689) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS complement(join(1911368..1912855,1912926..1912999, FT 1913038..1913062)) FT /colour=2 FT /gene="cct3" FT /gene="SPBC1A4.08c" FT /label=cct3 FT /note="SPBC1A4.08c, len:528, SIMILARITY:Saccharomyces FT cerevisiae, TCPG_YEAST, t-complex protein 1, gamma subunit, FT (534 aa), fasta scores: opt: 2478, E():0, (68.9% FT identity in 533 aa)" FT /product="t-complex protein 1, gamma subunit" FT /fasta_file="fasta/c1A4.tab.seq.03157.out" FT misc_feature complement(1911383..1912855) FT /note="Match to PF00118 cpn60_TCP1, TCP-1/cpn60 chaperonin FT family Score 593.58" FT misc_feature complement(1912856..1912867) FT /colour=6 FT /note="ctgacattatag, splice branch and acceptor" FT intron complement(1912856..1912925) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1912920..1912925) FT /colour=6 FT /note="gtacgg, splice donor sequence" FT misc_feature complement(1913000..1913013) FT /colour=6 FT /note="ttaattaaccaaag, splice branch and acceptor" FT misc_feature complement(1913032..1913037) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS complement(1913875..1914249) FT /colour=9 FT /gene="SPBC1A4.09c" FT /label=SPBC1A4.09c FT /note="SPBC1A4.09c, len:124aa" FT /product="very hypothetical protein" FT /fasta_file="fasta/c1A4.tab.seq.03158.out" FT CDS 1914526..1916568 FT /colour=10 FT /gene="SPBC1A4.09" FT /label=SPBC1A4.09 FT /note="SPBC1A4.09, len:680, SIMILARITY:Saccharomyces FT cerevisiae, YOR243C, YO43_YEAST, hypothetical 77.0 kD FT protein in hes1-sec63 intergenic region., (676 aa), fasta FT scores: opt: 1088, E():0, (37.4% identity in 700 aa)" FT /product="conserved protein" FT /fasta_file="fasta/c1A4.tab.seq.03159.out" FT misc_feature 1915075..1916349 FT /note="Match to PF01142 UPF0024, Uncharacterized protein FT family UPF0024 Score 194.26" FT misc_feature 1918309..1918909 FT /note="nominal overlap with p1 clone p23A10 S. pombe FT chromosome 2" FT misc_feature 1918309..1918909 FT /note="nominal overlap with cosmid SPBC1A45P S. pombe FT chromosome 2" FT CDS join(1920497..1920684,1920765..1920975) FT /colour=7 FT /gene="SPBP23A10.02" FT /label=SPBP23A10.02 FT /note="SPBP23A10.02, len:132, SIMILARITY:Saccharomyces FT cerevisiae, YM10_YEAST, hypothetical 14.0 kD protein in FT rpl15b-gcr3 intergenic region., (122 aa), fasta scores: FT opt: 257, E():4.2e-11, (34.2% identity in 117 aa)" FT /note="overlaps CDS SPBP23A10.03c by 64bps and 3' end" FT /product="hypothetical protein; similar to S. cerevisiae FT PKR1" FT /fasta_file="fasta/p23A10.tab.seq.04095.out" FT misc_feature 1920685..1920690 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT intron 1920685..1920764 FT /colour=2 FT /note="confirmed intron" FT misc_feature 1920750..1920764 FT /colour=6 FT /note="ttaacaactttatag, splice branch and acceptor" FT CDS complement(join(1920911..1920958,1921074..1921373)) FT /colour=10 FT /gene="SPBP23A10.03c" FT /label=SPBP23A10.03c FT /note="SPBP23A10.03c, len:115, SIMILARITY:Saccharomyces FT cerevisiae, Q02562, suppressor of mif2 smt3p, (133 aa), FT fasta scores: opt: 290, E():7.3e-15, (43.2% identity in 95 FT aa)" FT /note="overlaps CDS SPBP23A10.02 by 64bp at 3' end" FT /product="hypothetical protein; similar to S. cerevisiae FT YDR511W" FT /fasta_file="fasta/p23A10.tab.seq.04096.out" FT misc_feature complement(1920959..1920975) FT /colour=6 FT /note="ctaactattattggcag, splice branch and acceptor" FT misc_feature complement(1921068..1921073) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT CDS join(1921734..1922969,1923014..1923868) FT /colour=7 FT /gene="SPBP23A10.04" FT /label=SPBP23A10.04 FT /note="SPBP23A10.04, len:696, SIMILARITY:Homo sapiens, FT AAF05751, anaphase-promoting complex subunit 2., (822 aa), FT fasta scores: opt: 476, E():8.6e-25, (29.6% identity in FT 598 aa)" FT /product="putative Anaphase-Promoting Complex (APC FT SUBUNIT); required for cyclin degradation; which is FT required for metaphase-anaphase transition; cullin-family" FT /fasta_file="fasta/p23A10.tab.seq.04097.out" FT misc_feature 1922970..1922975 FT /colour=6 FT /note="gtttgt, splice donor sequence" FT misc_feature 1923000..1923013 FT /colour=6 FT /note="ctaacgttttttag, splice branch and acceptor" FT CDS join(1924315..1924473,1924521..1924664,1924814..1925698) FT /colour=8 FT /gene="SPBP23A10.05" FT /label=SPBP23A10.05 FT /note="SPBP23A10.05, len:395, predicted to contain coiled- FT coil region" FT /product="predicted coiled-coil protein; sequence orphan" FT /fasta_file="fasta/p23A10.tab.seq.04098.out" FT misc_feature 1924474..1924479 FT /colour=6 FT /note="gtagtt, splice donor sequence" FT misc_feature 1924507..1924520 FT /colour=6 FT /note="ctaacaaattttag, splice branch and acceptor" FT misc_feature 1924665..1924670 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1924797..1924813 FT /colour=6 FT /note="ctaatacaatacgatag, splice branch and acceptor" FT CDS 1926567..1927574 FT /colour=7 FT /gene="SPBP23A10.06" FT /label=SPBP23A10.06 FT /note="SPBP23A10.06, len:335, SIMILARITY:Homo sapiens, FT CAB63728, hypothetical 38.5 kD protein., (351 aa), fasta FT scores: opt: 434, E():6.1e-21, (35.8% identity in 349 aa)" FT /product="MC transporter of unknown specificity" FT /fasta_file="fasta/p23A10.tab.seq.04099.out" FT misc_feature 1926633..1927550 FT /note="Match to PF00153 mito_carr, Mitochondrial carrier FT proteins Score 168.38" FT CDS 1928559..1932242 FT /EC_number="2.7.7.6" FT /colour=2 FT /gene="rpa2" FT /gene="SPBP23A10.07" FT /label=rpa2 FT /note="SPBP23A10.07, len:1227, SIMILARITY:Saccharomyces FT cerevisiae, RPA2_YEAST, DNA-directed RNA polymerase i 135 FT kD polypeptide, (1203 aa), fasta scores: opt: 3799, E():0, FT (62.3% identity in 1211 aa)" FT /product="DNA-directed RNA polymerase I subunit; similar FT to S. cerevisiae RPA2" FT /fasta_file="fasta/p23A10.tab.seq.04100.out" FT misc_feature 1929024..1931972 FT /note="Match to PF00562 RNA_pol_B, RNA polymerase beta FT subunit Score 523.99" FT LTR complement(1932904..1933247) FT /note="Tf2-type LTR" FT CDS 1933661..1934962 FT /colour=7 FT /gene="SPBP23A10.08" FT /label=SPBP23A10.08 FT /note="SPBP23A10.08, len:433, FT SIMILARITY:Schizosaccharomyces pombe, YAE9_SCHPO, FT hypothetical 47.8 kD protein c23d3.09 in chromosome i., FT (430 aa), fasta scores: opt: 913, E():0, (39.9% identity FT in 444 aa)" FT /product="actin-like protein" FT /fasta_file="fasta/p23A10.tab.seq.04101.out" FT misc_feature 1933685..1934251 FT /note="Match to PF00022 actin, Actin Score 99.21" FT misc_feature 1934636..1934923 FT /note="Match to PF00022 actin, Actin Score 97.50" FT CDS 1936099..1936707 FT /colour=10 FT /gene="SPBP23A10.09" FT /label=SPBP23A10.09 FT /note="SPBP23A10.09, len:202, SIMILARITY:Saccharomyces FT cerevisiae, YD13_YEAST, hypothetical 24.2 kD protein in FT rpl4b-kcs1 intergenic region., (208 aa), fasta scores: FT opt: 384, E():2.1e-19, (38.2% identity in 212 aa)" FT /product="conserved protein" FT /fasta_file="fasta/p23A10.tab.seq.04102.out" FT CDS join(1936994..1937018,1937169..1939393) FT /colour=7 FT /gene="SPBP23A10.10" FT /label=SPBP23A10.10 FT /note="SPBP23A10.10, len:749, SIMILARITY:Caenorhabditis FT elegans., O01776, coded for by c. elegans cDNA yk93c10.5., FT (689 aa), fasta scores: opt: 401, E():1.1e-15, (25.4% FT identity in 449 aa)" FT /product="putative serine/threonine protein kinase" FT /fasta_file="fasta/p23A10.tab.seq.04103.out" FT misc_feature 1937019..1937024 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 1937151..1937168 FT /colour=6 FT /note="ctaacgttgaatgtttag, splice branch and acceptor" FT misc_feature 1937240..1938094 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 47.38" FT CDS complement(1939765..1941288) FT /colour=7 FT /gene="SPBP23A10.11c" FT /label=SPBP23A10.11c FT /note="SPBP23A10.11c, len:507, signal sequence predicted 1- FT 22aa, SIMILARITY:Saccharomyces cerevisiae, YB12_YEAST, FT hypothetical 48.0 kD protein in cdc28-arl1 intergenic FT region ., (455 aa), fasta scores: opt: 995, E():0, (43.8% FT identity in 502 aa)" FT /product="serine-rich protein; putative cell wall; FT putative septation and/or ageing, by similarity" FT /fasta_file="fasta/p23A10.tab.seq.04104.out" FT CDS join(1944548..1944585,1944658..1944777,1944838..1945296, FT 1945368..1945488) FT /colour=10 FT /gene="SPBP23A10.12" FT /label=SPBP23A10.12 FT /note="SPBP23A10.12, len:245, LOW SIMILARITY:Mus musculus, FT P97376, frg1., (258 aa), fasta scores: opt: 230, E():2.2e- FT 08, (27.3% identity in 256 aa)" FT /product="hypothetical protein; similar to human frg1; no FT apparent S. cerevisiae ortholog" FT /fasta_file="fasta/p23A10.tab.seq.04105.out" FT misc_feature 1944586..1944591 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 1944643..1944657 FT /colour=6 FT /note="ctaacaagaaatcag, splice branch and acceptor" FT misc_feature 1944778..1944783 FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature 1944813..1944837 FT /colour=6 FT /note="ctaatttacttacaactttatgtag, splice branch and FT acceptor" FT misc_feature 1945297..1945302 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1945348..1945367 FT /colour=6 FT /note="ctaactttgtaattttacag, splice branch and acceptor" FT CDS 1946142..1949060 FT /colour=2 FT /gene="orc4" FT /gene="orp4" FT /gene="SPBP23A10.13" FT /label=orp4 FT /note="SPBP23A10.13, len:972" FT /product="origin recognition complex subunit 4" FT /fasta_file="fasta/p23A10.tab.seq.04106.out" FT CDS complement(join(1949858..1951085,1951186..1951394, FT 1951470..1951634)) FT /colour=8 FT /gene="SPBP23A10.14c" FT /label=SPBP23A10.14c FT /note="SPBP23A10.14c, len:533, predicted to contain coiled- FT coil region" FT /product="predicted coiled-coil protein; sequence orphan" FT /fasta_file="fasta/p23A10.tab.seq.04107.out" FT misc_feature complement(1951086..1951104) FT /colour=6 FT /note="ctaatatttgtaaaaatag, splice branch and acceptor" FT misc_feature complement(1951180..1951185) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(1951395..1951416) FT /colour=6 FT /note="ctaaccaatatactttttttag, splice branch and acceptor" FT misc_feature complement(1951464..1951469) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT tRNA 1952759..1952832 FT /note="tRNA Asn anticodon GTT, Cove score 86.64" FT rRNA 1953009..1953127 FT /note="5S ribosomal RNA" FT CDS complement(1954069..1955442) FT /EC_number="3.4.24.64" FT /colour=7 FT /gene="qcr1" FT /gene="mas1" FT /gene="SPBP23A10.15c" FT /label=qcr1 FT /note="SPBP23A10.15c, len:457, transit peptide predicted 1- FT 23aa, SIMILARITY:Neurospora crassa., MPPB_NEUCR, FT mitochondrial processing peptidase beta subunit (ec FT 3.4.24.64), (476 aa), fasta scores: opt: 1840, E():0, FT (64.4% identity in 436 aa)" FT /product="putative ubiquinol cytochrome c reductase FT complex subunit ( cytochrome bc1 complex ); respiratory FT complex III; putative mitochondrial processing peptidase FT beta (enhancing) subunit" FT /fasta_file="fasta/p23A10.tab.seq.04108.out" FT misc_feature complement(1954903..1955352) FT /note="Match to PF00675 Peptidase_M16, Insulinase FT (Peptidase family M16) Score 246.12" FT CDS 1956618..1957178 FT /colour=7 FT /gene="sdh4" FT /gene="SPBP23A10.16" FT /label=sdh4 FT /note="SPBP23A10.16, len:186, SIMILARITY:Saccharomyces FT cerevisiae, Q06236, similar to sdh4p., (168 aa), fasta FT scores: opt: 339, E():2.8e-16, (34.8% identity in 138 aa)" FT /product="putative succinate dehydrogenase (ubiquinone) FT reductase complex subunit; TCA cycle; mitochondrial ; FT membrane anchor subunit" FT /fasta_file="fasta/p23A10.tab.seq.04109.out" FT misc_feature 1957372..1958307 FT /note="nominal overlap with cosmid SPBC29A3 S. pombe FT chromosome 2" FT CDS 1957691..1957993 FT /colour=9 FT /gene="SPBC29A3.21" FT /label=SPBC29A3.21 FT /note="SPBC29A3.21 len:100aa" FT /product="very hypothetical protein" FT /fasta_file="fasta/c29A3.tab.seq.02811.out" FT misc_feature 1957372..1958307 FT /note="nominal overlap with p1 clone SPBP23A10 S. pombe FT chromosome 2" FT CDS 1958586..1961300 FT /EC_number="3.6.1.36" FT /colour=7 FT /gene="SPBC29A3.01" FT /label=SPBC29A3.01 FT /note="SPBC29A3.01, len:903, SIMILARITY:Arabidopsis FT thaliana, AAD29109, ATP-dependent copper transporter., FT (1001 aa), fasta scores: opt: 1792, E():0, (38.5% identity FT in 877 aa)" FT /product="putative P-type copper ATPase" FT /fasta_file="fasta/c29A3.tab.seq.02812.out" FT misc_feature 1958607..1958696 FT /note="Match to PF00403 HMA, Heavy-metal-associated domain FT Score 33.39" FT misc_feature 1959438..1961123 FT /note="Match to PF00122 E1-E2_ATPase, E1-E2 ATPase Score FT 570.97" FT misc_feature 1960170..1960190 FT /colour=8 FT /note="PS00154 E1-E2 ATPases phosphorylation site" FT misc_feature 1960803..1960871 FT /colour=8 FT /note="PS01229 Hypothetical cof family signature 2" FT CDS complement(1961492..1962745) FT /EC_number="1.1.1.23" FT /colour=2 FT /gene="his7" FT /gene="SPBC29A3.02c" FT /label=his7 FT /note="SPBC29A3.02c, len:416" FT /note="this protein does not contain the C terminal FT histadinol dehydrogenase domain" FT /product="phosphoribosyl-amp cyclohydrolase" FT /fasta_file="fasta/c29A3.tab.seq.02813.out" FT CDS complement(join(1963106..1963659,1963720..1964362)) FT /colour=10 FT /gene="SPBC29A3.03c" FT /label=SPBC29A3.03c FT /note="SPBC29A3.03c, len:397, SIMILARITY:Arabidopsis FT thaliana, CAB38936, hypothetical 44.4 kD protein., (388 FT aa), fasta scores: opt: 466, E():1.3e-23, (33.3% identity FT in 387 aa)" FT /product="zinc finger protein; zf-C3HC4 type (RING finger)" FT /fasta_file="fasta/c29A3.tab.seq.02814.out" FT misc_feature complement(1963211..1963342) FT /colour=9 FT /note="Pfam match to entry zf-C3HC4 PF00097, zinc finger, FT C 3HC4 type (RING finger)" FT misc_feature complement(1963660..1963673) FT /colour=6 FT /note="ttaacttatataag, splice branch and acceptor" FT misc_feature complement(1963714..1963719) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_RNA 1964872..1965171 FT /gene="mgU6-47" FT /product="C/D containing snoRNA; required for 2'-O- FT methylation of U6 snRNA at A41(PMID: 11842100)" FT misc_feature 1965016..1965021 FT /note="Box C" FT misc_feature 1965097..1965100 FT /note="Box D" FT CDS join(1966094..1966096,1966163..1966939) FT /colour=2 FT /gene="rpl7a" FT /gene="SPBC29A3.04" FT /label=rpl7a FT /note="SPBC29A3.04, len:258" FT /product="60S ribosomal protein L7a (L8)" FT /fasta_file="fasta/c29A3.tab.seq.02815.out" FT misc_feature 1966097..1966102 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1966148..1966162 FT /colour=6 FT /note="ctaacataaatgtag, splice branch and acceptor" FT misc_feature 1966499..1966795 FT /note="Match to PF01248 Ribosomal_L7Ae, Ribosomal protein FT L7Ae" FT misc_feature 1966862..1966885 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS join(1967711..1967767,1967810..1967915,1967964..1968043, FT 1968089..1968265) FT /colour=7 FT /gene="SPBC29A3.05" FT /label=SPBC29A3.05 FT /note="SPBC29A3.05, len:139, SIMILARITY: O43257, PUTATIVE FT CYCLIN G1 INTERACTING PROTEIN., (154 aa), fasta scores, FT opt: 199, E(): 4.1e-06, (32.9% identity in 152 aa FT overlap)" FT /product="putative cyclin G1 interacting protein" FT /fasta_file="fasta/c29A3.tab.seq.02816.out" FT misc_feature 1967768..1967773 FT /colour=6 FT /note="gtttgt, splice donor sequence" FT misc_feature 1967796..1967809 FT /colour=6 FT /note="ctaatggatgatag, splice branch and acceptor" FT misc_feature 1967916..1967921 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT intron 1967916..1967963 FT /colour=2 FT /note="confirmed" FT misc_feature 1967950..1967963 FT /colour=6 FT /note="ctaacttgttacag, splice branch and acceptor" FT misc_feature 1968044..1968049 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT intron 1968044..1968088 FT /colour=2 FT /note="confirmed" FT misc_feature 1968075..1968088 FT /colour=6 FT /note="ctaaccatatatag, splice branch and acceptor" FT CDS 1968935..1970605 FT /colour=10 FT /gene="SPBC29A3.06" FT /label=SPBC29A3.06 FT /note="SPBC29A3.06, len:555, SIMILARITY:Homo sapiens, FT AAD34043, cgi-48 protein., (521 aa), fasta scores: opt: FT 566, E():1.7e-28, (27.0% identity in 488 aa)" FT /product="WD repeat protein" FT /fasta_file="fasta/c29A3.tab.seq.02817.out" FT misc_feature 1970417..1970452 FT /colour=8 FT /note="PS00070 Aldehyde dehydrogenases cysteine active FT site" FT misc_feature 1970491..1970493 FT /note="discrepency with p23A10 - which has only 2 Ts. FT Waiting for base check." FT CDS complement(join(1970668..1970782,1970903..1970957, FT 1971051..1971294)) FT /colour=7 FT /gene="SPBC29A3.07c" FT /label=SPBC29A3.07c FT /note="SPBC29A3.07c, len:137, SIMILARITY:Homo sapiens, FT AAD34105, cgi-110 protein., (125 aa), fasta scores: opt: FT 395, E():1.5e-21, (63.2% identity in 95 aa)" FT /product="putative pre-mRNA splicing factor p14; RNA- FT binding protein; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c29A3.tab.seq.02818.out" FT misc_feature complement(1970783..1970796) FT /colour=6 FT /note="ttaacgtgtaatag, splice branch and acceptor" FT misc_feature complement(1970897..1970902) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature complement(1970958..1970973) FT /colour=6 FT /note="ttaactttttttttag, splice branch and acceptor" FT misc_feature complement(1971045..1971050) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(1971049..1971255) FT /colour=9 FT /note="Pfam match to entry rrm PF00076, RNA recognition FT mot if. (aka RRM, RBD, or RNP domain)" FT misc_feature complement(1971055..1971255) FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain)" FT misc_feature complement(1971124..1971147) FT /colour=8 FT /note="PS00030 Eukaryotic putative RNA-binding region RNP- FT 1 signature" FT CDS 1973632..1974231 FT /colour=2 FT /gene="pof4" FT /gene="SPBC29A3.08" FT /label=pof4 FT /note="SPBC29A3.08, len:198" FT /product="F-box protein; putative elongin A transcription FT elongation factor; similar to S. cerevisiae ELA1" FT /fasta_file="fasta/c29A3.tab.seq.02819.out" FT CDS complement(1974813..1977023) FT /colour=7 FT /gene="SPBC29A3.09c" FT /label=SPBC29A3.09c FT /note="SPBC29A3.09c, len:735, SIMILARITY:Saccharomyces FT cerevisiae, GC20_YEAST, gcn20 protein., (752 aa), fasta FT scores: opt: 2612, E():0, (55.1% identity in 741 aa)" FT /product="putative amino acid starvation response; yeast FT gcn protein kinase activator homolog; non-transporter FT (ABC) family" FT /fasta_file="fasta/c29A3.tab.seq.02820.out" FT misc_feature complement(1974912..1975388) FT /note="Match to PF00005 ABC_tran, ABC transporter" FT misc_feature complement(1975350..1975373) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature complement(1975758..1976402) FT /note="Match to PF00005 ABC_tran, ABC transporter" FT misc_feature complement(1975917..1975961) FT /colour=8 FT /note="PS00211 ABC transporters family signature" FT misc_feature complement(1976358..1976381) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS complement(join(1977697..1977720,1977767..1977957, FT 1978010..1978045,1978094..1978139,1978187..1978201)) FT /colour=7 FT /gene="SPBC29A3.10c" FT /label=SPBC29A3.10c FT /note="SPBC29A3.10c, len:103aa" FT /product="putative mitochondrial F1-ATPase, subunit H; FT atp14 homolog" FT /fasta_file="fasta/c29A3.tab.seq.02821.out" FT misc_feature complement(1977721..1977736) FT /colour=6 FT /note="ctaacttttccttcag, splice branch and acceptor" FT misc_feature complement(1977761..1977766) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1977958..1977976) FT /colour=6 FT /note="cttacacgtcgtgtcttag, splice branch and acceptor" FT misc_feature complement(1978004..1978009) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1978046..1978060) FT /colour=6 FT /note="ctaatggcaatttag, splice branch and acceptor" FT misc_feature complement(1978088..1978093) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(1978140..1978150) FT /colour=6 FT /note="ctaatatatag, splice branch and acceptor" FT misc_feature complement(1978181..1978186) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT CDS complement(1978862..1979755) FT /colour=7 FT /gene="SPBC29A3.11c" FT /label=SPBC29A3.11c FT /note="SPBC29A3.11c, len:296, SIMILARITY:Saccharomyces FT cerevisiae, YMC2_YEAST, mitochondrial carrier protein ymc2 FT ., (329 aa), fasta scores: opt: 300, E():7.4e-14, (26.7% FT identity in 318 aa)" FT /product="MC transporter of unknown specificity" FT /fasta_file="fasta/c29A3.tab.seq.02822.out" FT misc_feature complement(1979138..1979278) FT /note="Match to PF00153 mito_carr, Mitochondrial carrier FT proteins" FT misc_feature complement(1979375..1979689) FT /note="Match to PF00153 mito_carr, Mitochondrial carrier FT proteins" FT CDS 1980391..1980969 FT /colour=2 FT /gene="rps9-2" FT /gene="rps9b" FT /gene="SPBC29A3.12" FT /label=rps9-2 FT /note="SPBC29A3.12, len:192" FT /product="40S ribosomal protein S9" FT /fasta_file="fasta/c29A3.tab.seq.02823.out" FT misc_feature 1980400..1980966 FT /note="Match to PF00163 Ribosomal_S4, Ribosomal protein FT S4/S9 N-terminal domain Score 313.17" FT misc_feature 1980703..1980777 FT /colour=8 FT /note="PS00632 Ribosomal protein S4 signature" FT CDS complement(1981702..1982781) FT /colour=10 FT /gene="SPBC29A3.13" FT /label=SPBC29A3.13c FT /note="SPBC29A3.13c, len:358, FT SIMILARITY:Schizosaccharomyces pombe, O94312, hypothetical FT 62.8 kD protein., (568 aa), fasta scores: opt: 245, FT E():3.1e-08, (26.9% identity in 376 aa)" FT /product="PWWP domain protein; putative nuclear protein; FT putative cell growth" FT /fasta_file="fasta/c29A3.tab.seq.02824.out" FT misc_feature complement(1982401..1982637) FT /note="Match to PF00855 PWWP, PWWP domain" FT CDS complement(join(1983071..1983233,1983276..1983372, FT 1983416..1983582,1983622..1983871,1983909..1984122, FT 1984164..1984312,1984359..1984543,1984585..1984754, FT 1984806..1984922,1984963..1985232,1985272..1985342, FT 1985382..1985774,1985811..1986073,1986125..1986243, FT 1986315..1986395,1986452..1986709)) FT /colour=2 FT /gene="trt1" FT /gene="SPBC29A3.14c" FT /label=trt1 FT /note="SPBC29A3.14c, len:987" FT /note="alteRNAtive splicing putative using 27386 acceptor - FT from embl record /EXPERIMENTAL" FT /product="telomerase catalytic subunit; reverse FT transcriptase 1; similar to S. cerevisiae EST2" FT /fasta_file="fasta/c29A3.tab.seq.02825.out" FT misc_feature complement(1983234..1983245) FT /colour=6 FT /note="ttgacacatcag, splice branch and acceptor" FT misc_feature complement(1983270..1983275) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(1983373..1983386) FT /colour=6 FT /note="ttaattaaccttag, splice branch and acceptor" FT misc_feature complement(1983410..1983415) FT /colour=6 FT /note="gtgagt, splice donor sequence" FT misc_feature complement(1983583..1983597) FT /colour=6 FT /note="ctgacaaataatcag, splice branch and acceptor" FT misc_feature complement(1983616..1983621) FT /colour=6 FT /note="gtatac, splice donor sequence" FT misc_feature complement(1983872..1983884) FT /colour=6 FT /note="ctaaccgttgaag, splice branch and acceptor" FT misc_feature complement(1983903..1983908) FT /colour=6 FT /note="gtgagt, splice donor sequence" FT misc_feature complement(1984123..1984135) FT /colour=6 FT /note="ctaatgaaactag, splice branch and acceptor" FT misc_feature complement(1984158..1984163) FT /colour=6 FT /note="gtatac, splice donor sequence" FT misc_feature complement(1984289..1985254) FT /colour=9 FT /note="Pfam match to entry rvt PF00078, Reverse FT transcripta se (RNA-dependent DNA polymerase)" FT misc_feature complement(1984313..1984330) FT /colour=6 FT /note="ttaacaaattcttttttag, splice branch and acceptor" FT misc_feature complement(1984353..1984358) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1984544..1984555) FT /colour=6 FT /note="ttaattttgcag, splice branch and acceptor" FT misc_feature complement(1984579..1984584) FT /colour=6 FT /note="gtaatt, splice donor sequence" FT misc_feature complement(1984755..1984772) FT /colour=6 FT /note="ctaatctattattagcag, splice branch and acceptor" FT misc_feature complement(1984800..1984805) FT /colour=6 FT /note="gtatta, splice donor sequence" FT misc_feature complement(1984923..1984935) FT /colour=6 FT /note="ctaatattttcag, splice branch and acceptor" FT misc_feature complement(1984957..1984962) FT /colour=6 FT /note="gtattt, splice donor sequence" FT misc_feature complement(1985233..1985243) FT /colour=6 FT /note="ttaacaatcag, splice branch and acceptor" FT misc_feature complement(1985266..1985271) FT /colour=6 FT /note="gtaata, splice donor sequence" FT misc_feature complement(1985343..1985358) FT /colour=6 FT /note="ctaacgattttaccag, splice branch and acceptor" FT misc_feature complement(1985376..1985381) FT /colour=6 FT /note="gtattg, splice donor sequence" FT misc_feature complement(1985775..1985784) FT /colour=6 FT /note="ctaattttag, splice branch and acceptor" FT misc_feature complement(1985805..1985810) FT /colour=6 FT /note="gtaact, splice donor sequence" FT misc_feature complement(1986074..1986086) FT /colour=6 FT /note="ctgacaagtatag, splice branch and acceptor" FT misc_feature complement(1986119..1986124) FT /colour=6 FT /note="gtaaat, splice donor sequence" FT misc_feature complement(1986244..1986256) FT /colour=6 FT /note="ttaaccgataaag, splice branch and acceptor" FT misc_feature complement(1986309..1986314) FT /colour=6 FT /note="gtaagg, splice donor sequence" FT misc_feature complement(1986396..1986410) FT /colour=6 FT /note="ctaatatatgggcag, splice branch and acceptor" FT misc_feature complement(1986446..1986451) FT /colour=6 FT /note="gtatat, splice donor sequence" FT CDS complement(1987107..1988537) FT /colour=7 FT /gene="SPBC29A3.15c" FT /label=SPBC29A3.15c FT /note="SPBC29A3.15c, len:475, SIMILARITY:Saccharomyces FT cerevisiae, YGM9_YEAST, hypothetical 55.6 kD protein, (488 FT aa), fasta scores: opt: 211, E():2e-06, (21.7% identity in FT 447 aa)" FT /product="putative mitochondrial ribosomal small subunit; FT required for respiration; required for mitochondrial FT maintenance; similar to S. cerevisiae RSM23; contains myc- FT type 'helix-loop-helix' dimerization domain" FT /fasta_file="fasta/c29A3.tab.seq.02826.out" FT misc_feature complement(1988214..1988261) FT /colour=8 FT /note="PS00038 Myc-type, 'helix-loop-helix' dimerization FT do main signature" FT CDS 1988992..1989492 FT /colour=7 FT /gene="SPBC29A3.16" FT /label=SPBC29A3.16 FT /note="SPBC29A3.16, len:165, SIMILARITY:Saccharomysec FT cerevisaae, YOR294W, Q08746, hypothetical protein (203aa), FT fasta scores, o pt:387, E():0, (47.8% identity in 178 aa FT overlap)" FT /product="putative regulator of ribosome synthesis by FT similar to S. cerevisiae rrs1" FT /fasta_file="fasta/c29A3.tab.seq.02827.out" FT tRNA 1990086..1990156 FT /note="tRNA Gly anticodon CCC, Cove score 60.35" FT CDS join(1990985..1991890,1991947..1992618) FT /colour=7 FT /gene="SPBC29A3.17" FT /label=SPBC29A3.17 FT /note="SPBC29A3.17, len:524, FT SIMILARITY:Schizosaccharomyces pombe, YA79_SCHPO, FT hypothetical 84.5 kD protein c24h6.09 in chromosome i., FT (753 aa), fasta scores: opt: 280, E():3.5e-11, (23.2% FT identity in 379 aa)" FT /product="RhoGEF domain; guanine nucleotide exchange FT factor" FT /fasta_file="fasta/c29A3.tab.seq.02828.out" FT misc_feature 1991210..1991785 FT /note="Match to PF00621 RhoGEF, RhoGEF domain" FT misc_feature 1991891..1991896 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 1991932..1991947 FT /colour=6 FT /note="ctaattgttttttag, splice branch and acceptor" FT CDS join(1993922..1993981,1994066..1994929) FT /colour=7 FT /gene="cyt1" FT /gene="SPBC29A3.18" FT /label=cyt1 FT /note="SPBC29A3.18, len:306, SIMILARITY:Neurospora crassa., FT CY1_NEUCR, cytochrome c1, heme protein ., (332 aa), FT fasta scores: opt: 1118, E():0, (55.1% identity in 303 aa)" FT /product="putative cytochrome c1; heme protein ; FT respiratory complex III" FT /fasta_file="fasta/c29A3.tab.seq.02829.out" FT misc_feature 1993982..1993987 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1994052..1994065 FT /colour=6 FT /note="ttaacggggtttag, splice branch and acceptor" FT misc_feature 1994309..1994326 FT /colour=8 FT /note="PS00190 Cytochrome c family heme-binding site FT signat ure" FT misc_feature 1996854..2000141 FT /note="nominal overlap with cosmid SPBC18E5, EM:AL035077 FT S. pombe chromosome 2" FT misc_feature complement(1997954..1997966) FT /colour=6 FT /note="ctaacatttttag, splice branch and acceptor" FT misc_feature complement(1998001..1998006) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1998004..1998840) FT /note="Match to PF00222 aminotran_2, Aminotransferases FT class-II" FT misc_feature complement(1998998..1999011) FT /colour=6 FT /note="ctgaccatatttag, splice branch and acceptor" FT misc_feature complement(1999048..1999053) FT /colour=6 FT /note="gtatac, splice donor sequence" FT misc_feature complement(1999155..1999169) FT /colour=6 FT /note="ctaatgagcctatag, splice branch and acceptor" FT misc_feature complement(1999207..1999212) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(2000088..2000141) FT /note="SPBC18E5.03c; see complete CDS in cosmid c18E5" FT CDS complement(join(2000088..2000240,2000317..2000997)) FT /colour=8 FT /gene="SPBC18E5.03c" FT /label=SPBC18E5.03c FT /note="SPBC18E5.03c, len:277" FT /product="hypothetical protein; predicted coiled-coil FT region; sequence orphan" FT /fasta_file="fasta/c18E5.tab.seq.03669.out" FT misc_feature 1996854..2000141 FT /note="nominal overlap with cosmid SPBC29A3, EM:AL022299 FT S.pombe chromosome 2" FT misc_feature complement(1997954..1997966) FT /colour=6 FT /note="ctaacatttttag, splice branch and acceptor" FT misc_feature complement(1997989..1998840) FT /colour=9 FT /note="Pfam match to entry PF00222 aminotran_2, FT Aminotransf erases class-II" FT misc_feature complement(1998001..1998006) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1998998..1999011) FT /colour=6 FT /note="ctgaccatatttag, splice branch and acceptor" FT misc_feature complement(1999048..1999053) FT /colour=6 FT /note="gtatac, splice donor sequence" FT misc_feature complement(1999155..1999169) FT /colour=6 FT /note="ctaatgagcctatag, splice branch and acceptor" FT misc_feature complement(1999207..1999212) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(2000241..2000254) FT /colour=6 FT /note="ctaactaaattaag, splice branch and acceptor" FT misc_feature complement(2000311..2000316) FT /colour=6 FT /note="gtaagg, splice donor sequence" FT LTR complement(2001528..2001875) FT /note="tf2-type lone LTR" FT misc_feature 2002113..2002640 FT /colour=9 FT /note="Pfam match to entry PF00826 Ribosomal_L10e, FT Ribosoma l L10" FT CDS 2002113..2002778 FT /colour=2 FT /gene="rpl10-1" FT /gene="SPBC18E5.04" FT /label=rpl10-1 FT /note="SPBC18E5.04, len:221" FT /product="60S ribosomal protein L10" FT /fasta_file="fasta/c18E5.tab.seq.03670.out" FT CDS complement(join(2003086..2003908,2003963..2004084)) FT /colour=10 FT /gene="SPBC18E5.05c" FT /label=SPBC18E5.05c FT /note="SPBC18E5.05c, len:314, LOW SIMILARITY:Saccharomyces FT cerevisiae, IKI1_YEAST, iki1 protein, (309 aa), fasta FT score s: opt: 288, E():7.2e-09, (26.4% identity in 322 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YHR187W" FT /fasta_file="fasta/c18E5.tab.seq.03671.out" FT misc_feature complement(2003909..2003922) FT /colour=6 FT /note="ctcatacattttag, splice branch and acceptor" FT misc_feature complement(2003957..2003962) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature join(2004467..2004516,2004570..2004765) FT /colour=9 FT /note="Pfam match to entry PF01249 Ribosomal_S21e, FT Ribosoma l protein S21e" FT CDS join(2004467..2004516,2004570..2004783) FT /colour=2 FT /gene="rps21" FT /gene="SPBC18E5.06" FT /label=rps21 FT /note="SPBC18E5.06, len:87" FT /product="40S ribosomal protein S21" FT /fasta_file="fasta/c18E5.tab.seq.03672.out" FT misc_feature 2004517..2004522 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT intron 2004517..2004569 FT /colour=2 FT /note="confirmed intron" FT misc_feature 2004556..2004569 FT /colour=6 FT /note="ctaattagaaatag, splice branch and acceptor" FT CDS 2006221..2008068 FT /colour=8 FT /gene="SPBC18E5.07" FT /label=SPBC18E5.07 FT /note="SPBC18E5.07, len:615" FT /product="hypothetical proline-serine rich protein; with FT low similar to glucoamylase; sequence orphan" FT /fasta_file="fasta/c18E5.tab.seq.03673.out" FT CDS 2009039..2009599 FT /colour=7 FT /gene="SPBC18E5.08" FT /label=SPBC18E5.08 FT /note="SPBC18E5.08, len:186, SIMILARITY: low to the c term FT of Rickettsia prowazekii., E1342974, ribosomal-protein- FT alan ine acetyltransferase, (183 aa), fasta scores: opt: FT 105, E( ):0.0037, (24.0% identity in 75 aa)" FT /product="putative N-acetyltransferase; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c18E5.tab.seq.03674.out" FT CDS complement(2010543..2010926) FT /colour=9 FT /gene="SPBC18E5.14c" FT /label=SPBC18E5.14c FT /note="SPBC18E5.14c, len:127" FT /product="very hypothetical protein" FT /fasta_file="fasta/c18E5.tab.seq.03675.out" FT misc_RNA 2010928..2011173 FT /note="region similar to 7244 7489 SPCC1884 AL031787 FT S.pombe chromosome III cosmid c1884.; putative cellular FT RNA" FT CDS complement(2011156..2011542) FT /colour=9 FT /gene="SPBC18E5.09c" FT /label=SPBC18E5.09c FT /note="SPBC18E5.09c, len:128" FT /product="very hypothetical protein" FT /fasta_file="fasta/c18E5.tab.seq.03676.out" FT LTR 2012086..2012319 FT /colour=4 FT /note="degraded LTR" FT CDS join(2012491..2012581,2012640..2012833) FT /colour=4 FT /gene="SPBC18E5.14" FT /note="putative pseudogene. similar to the non-repeat FT region of S. pombe TR:O74876 hypothetical repeat FT containing protein" FT /product="similar to S. pombe hypothetical repeat FT containing protein; N-terminal truncated, possibly by FT transposition event" FT /pseudo FT /fasta_file="fasta/c18E5.tab.seq.03677.out" FT misc_feature 2013528..2014433 FT /colour=9 FT /note="Pfam match to entry PF01512 Complex1_51K, FT Respiratory-chain NADH dehydrogenase 51 Kd subunit" FT misc_feature 2013657..2013662 FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature 2013711..2013724 FT /colour=6 FT /note="ctaatatgacgaag, splice branch and acceptor" FT misc_feature 2014816..2019853 FT /note="nominal overlap with cosmid SPBC23G7, EM:AL035065 FT S. pombe chromosome 2" FT misc_feature complement(2016003..2016018) FT /colour=6 FT /note="ctaattgagttatcag, splice branch and acceptor" FT misc_feature complement(2016088..2016093) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature complement(2018003..2018446) FT /colour=9 FT /note="Pfam match to entry PF00675 Insulinase, Insulinase FT ( proteinase M16)" FT CDS join(2013450..2013656,2013725..2014876) FT /colour=7 FT /gene="SPBC18E5.10" FT /label=SPBC18E5.10 FT /note="SPBC18E5.10, len:452, SIMILARITY:Caenorhabditis FT elegans., Q17880, c09h10.3., (479 aa), fasta scores: opt: FT 1029, E():0, (40.0% identity in 420 aa)" FT /product="putative respiratory chain NADH dehydrogenase FT complex subunit F; contains PF01512 Complex1_51K, FT Respiratory-chain NADH dehydrogenase 51 Kd subunit; no FT apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c18E5.tab.seq.03678.out" FT misc_feature 2014816..2014876 FT /note="SPBC18E5.10, see c18E5 for complete CDS" FT misc_feature 2014816..2019853 FT /note="nominal overlap with cosmid SPBC18E5, EM:AL035077 FT S. pombe chromosome 2" FT misc_feature complement(2016003..2016018) FT /colour=6 FT /note="ctaattgagttatcag, splice branch and acceptor" FT misc_feature complement(2016088..2016093) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature complement(2018003..2018421) FT /colour=9 FT /note="Pfam match to entry PF00675, Insulinase, Insulinase FT (proteinase M16)" FT CDS join(2020872..2020916,2020986..2021011,2021119..2021379, FT 2021474..2021495,2021568..2021660) FT /colour=7 FT /gene="SPBC23G7.16" FT /label=SPBC23G7.16 FT /note="SPBC23G7.16, len:148, SIMILARITY:S cerevisiae, FT CTR2_YEAST, POSSIBLE COPPER TRANSPORT PROTEIN CTR2, (189 FT aa), fasta scores, opt:254, E(): 5.9e-12, (39.0% FT identity in 141 aa overlap)" FT /product="Ctr2 copper transporter" FT /fasta_file="fasta/c23G7.tab.seq.03685.out" FT misc_feature 2020917..2020922 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 2020973..2020985 FT /colour=6 FT /note="ttaacatgcttag, splice branch and acceptor" FT misc_feature 2021012..2021017 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 2021107..2021118 FT /colour=6 FT /note="ctaaccttgcag, splice branch and acceptor" FT misc_feature 2021380..2021385 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2021456..2021473 FT /colour=6 FT /note="ctaactaaagtgacttag, splice branch and acceptor" FT misc_feature 2021555..2021567 FT /colour=6 FT /note="cttacttatttag, splice branch and acceptor" FT CDS complement(2022045..2024090) FT /colour=2 FT /gene="nif1" FT /gene="SPBC23G7.04c" FT /label=nif1 FT /note="SPBC23G7.04c, len:681" FT /product="cell cycle inhibitor; low complexity protein; no FT apparent orthologs" FT /fasta_file="fasta/c23G7.tab.seq.00038.out" FT CDS join(2026225..2026255,2026471..2026769) FT /colour=2 FT /gene="sui1" FT /gene="psu1" FT /gene="SPBC23G7.05" FT /label=sui1 FT /note="SPBC23G7.05, len:109" FT /product="protein translation factor; similar to S. FT cerevisiae SUI1" FT /fasta_file="fasta/c23G7.tab.seq.03687.out" FT misc_feature 2026256..2026261 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT intron 2026256..2026470 FT /colour=2 FT /note="confirmed intron" FT misc_feature 2026452..2026470 FT /colour=6 FT /note="ctaaactaacatgtgttag, splice branch and acceptor" FT misc_feature 2026464..2026754 FT /colour=9 FT /note="Pfam match to entry PF01253 SUI1, Translation FT initia tion factor SUI1" FT CDS complement(join(2027047..2028853,2028955..2029385)) FT /colour=10 FT /gene="SPBC23G7.06c" FT /label=SPBC23G7.06c FT /note="SPBC23G7.06c, len:745, SIMILARITY:Saccharomyces FT cerevisiae, Q06833, similar in central region to c. FT elegans hypothetical proteinf55c12.5., (770 aa), fasta FT scores: opt: 5 73, E():0, (24.7% identity in 619 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YPR091C; predicted N-terminal signal sequence" FT /fasta_file="fasta/c23G7.tab.seq.03688.out" FT misc_feature complement(2028854..2028865) FT /colour=6 FT /note="ctcacaaaaaag, splice branch and acceptor" FT misc_feature complement(2028949..2028954) FT /colour=6 FT /note="gtattt, splice donor sequence" FT CDS complement(join(2030008..2030183,2030243..2030557, FT 2030614..2030956)) FT /colour=10 FT /gene="SPBC23G7.07c" FT /label=SPBC23G7.07c FT /note="SPBC23G7.07c, len:277, SIMILARITY:Saccharomyces FT cere visiae, Q07897, chromosome xii reading frame orf FT ylr003c., (291 aa), fasta scores: opt: 162, E():1.3e-09, FT (23.3% ident ity in 292 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YLR003C" FT /fasta_file="fasta/c23G7.tab.seq.03689.out" FT misc_feature complement(2030184..2030196) FT /colour=6 FT /note="ctaacatttttag, splice branch and acceptor" FT intron complement(2030184..2030242) FT /note="confirmed by mRNA" FT misc_feature complement(2030237..2030242) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(2030558..2030572) FT /colour=6 FT /note="ctaactcactataag, splice branch and acceptor" FT intron complement(2030558..2030613) FT /note="confirmed by mRNA" FT misc_feature complement(2030608..2030613) FT /colour=6 FT /note="gtataa, splice donor sequence" FT CDS complement(2031406..2033493) FT /colour=2 FT /gene="rga7" FT /gene="SPBC23G7.08c" FT /label=rga7 FT /note="SPBC23G7.08c, len:695, SIMILARITY:Cochliobolus FT heter ostrophus, O13384, GTPase activating protein FT homolog., (714 aa), fasta scores: opt: 418, E():4.4e-24, FT (27.6% identity in 707 aa)" FT /product="GTPase activator; RhoGAP domain; similar to S. FT cerevisiae RGD1" FT /fasta_file="fasta/c23G7.tab.seq.03690.out" FT misc_feature complement(2031481..2031936) FT /colour=9 FT /note="Pfam match to entry PF00620 RhoGAP, RhoGAP domain" FT misc_feature complement(2033098..2033379) FT /colour=9 FT /note="Match to PF00611 FCH, Fes/CIP4 homology domain FT Score 20.97" FT CDS complement(2034818..2034946) FT /colour=2 FT /gene="matmi" FT /gene="mat1" FT /gene="SPBC23G7.17c" FT /label=matmi FT /note="SPBC23G7.17c, len:42" FT /product="mating-type M-specific polypeptide Mi" FT /fasta_file="fasta/c23G7.tab.seq.03691.out" FT CDS 2035081..2035626 FT /colour=2 FT /gene="matmc" FT /gene="SPBC23G7.09" FT /label=matmc FT /note="SPBC23G7.09, len:181" FT /product="mating-type m-specific polypeptide mc" FT /fasta_file="fasta/c23G7.tab.seq.03692.out" FT misc_feature 2035387..2035593 FT /colour=9 FT /note="Pfam match to entry PF00505 HMG_box, HMG (high FT mobil ity group) box" FT misc_feature 2037351..2039049 FT /note="8495 (+1) 1 1699 SPARS756 X07890 Yeast ARS element FT ( pARS756)" FT CDS complement(2038866..2040053) FT /colour=7 FT /gene="SPBC23G7.10c" FT /label=SPBC23G7.10c FT /note="SPBC23G7.10c, len:395, SIMILARITY:Bacillus FT subtilis. , YQJM_BACSU, putative nadh-dependent flavin FT oxidoreductase yqjm, (338 aa), fasta scores: opt: 343, FT E():0, (43.5% iden tity in 356 aa)" FT /product="putative nadh-dependent flavin oxidoreductase" FT /fasta_file="fasta/c23G7.tab.seq.03693.out" FT misc_feature complement(2038923..2039960) FT /colour=9 FT /note="Pfam match to entry PF00724 oxidored_FMN, FMN FT oxidoreductase" FT misc_feature 2040885..2041505 FT /colour=9 FT /note="Pfam match to entry PF01332 AlkA_DNA_repair, FT Alkylbase DNA glycosidases alkA family" FT CDS 2040885..2041526 FT /EC_number="3.2.2.21" FT /colour=7 FT /gene="SPBC23G7.11" FT /label=SPBC23G7.11 FT /note="SPBC23G7.11, len:213, FT SIMILARITY:Schizosaccharomyces pombe, MAG_SCHPO, DNA-3- FT methyladenine glycosidase, (228 aa ), fasta scores: opt: FT 586, E():0, (44.3% identity in 203 aa )" FT /product="DNA-3-methyladenine glycosidase; putative base FT excision repair" FT /fasta_file="fasta/c23G7.tab.seq.03694.out" FT CDS complement(join(2042129..2043286,2043329..2043382)) FT /colour=2 FT /gene="rpt6" FT /gene="let1" FT /gene="SPBC23G7.12c" FT /label=rpt6 FT /note="SPBC23G7.12c, len:403" FT /product="19S proteasome regulatory subunit" FT /fasta_file="fasta/c23G7.tab.seq.03695.out" FT misc_feature complement(2042234..2042800) FT /colour=9 FT /note="Pfam match to entry PF00004 AAA, ATPases associated FT with various cellular activities (AAA)" FT misc_feature complement(2043287..2043301) FT /colour=6 FT /note="ttaacataaaatgtag, splice branch and acceptor" FT misc_feature complement(2043323..2043328) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS complement(2043859..2045853) FT /colour=7 FT /gene="SPBC23G7.13c" FT /label=SPBC23G7.13c FT /note="SPBC23G7.13c, len:664, SIMILARITY:Saccharomyces FT cere visiae, DUR3_YEAST, urea active transporter., (735 FT aa), fas ta scores: opt: 1998, E():0, (47.4% identity in FT 730 aa)" FT /product="SSS urea transporter" FT /fasta_file="fasta/c23G7.tab.seq.03696.out" FT misc_feature complement(2044408..2044431) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS 2047232..2047627 FT /colour=9 FT /gene="SPBC23G7.14" FT /label=SPBC23G7.14 FT /note="SPBC23G7.14, len:131" FT /product="very hypothetical protein" FT /fasta_file="fasta/c23G7.tab.seq.03697.out" FT CDS complement(join(2048631..2048654,2048701..2049009)) FT /colour=2 FT /gene="rpp2-2" FT /gene="SPBC23G7.15c" FT /label=rpa4 FT /note="SPBC23G7.15c, len:113" FT /product="60s acidic ribosomal protein (P2B)" FT /fasta_file="fasta/c23G7.tab.seq.03698.out" FT misc_feature complement(join(2048634..2048654,2048701..2049024)) FT /colour=9 FT /note="Pfam match to entry PF00428 60s_ribosomal, 60s FT Acidi c ribosomal protein" FT misc_feature complement(2048655..2048667) FT /colour=6 FT /note="ctaactaatttag, splice branch and acceptor" FT misc_feature complement(2048686..2048691) FT /colour=6 FT /note="atatgc, splice donor sequence" FT misc_feature 2049807..2050509 FT /note="duplaicated region flanking matmc S. pombe FT chromosome 2" FT misc_feature 2050413..2050509 FT /note="nominal overlap with c702" FT misc_feature 2050413..2050509 FT /note="nominal overlap with SPBC23G7 S. pombe chromosome 2" FT misc_feature complement(2050413..2051715) FT /note="duplicated region; flanking matmc" FT misc_feature 2051595..2051715 FT /note="nominal overlap with SPBC1711 S. pombe chromosome 2" FT misc_feature complement(2051595..2051715) FT /note="nominal overlap with c702" FT BLASTN_HIT complement(2051595..2051926) FT /note="1579 (-1) 4007 4338 SPBC1711 S. pombe chromosome 2" FT misc_feature complement(2051595..2051926) FT /note="duplicated region flanking matmc" FT misc_feature 2053066..2054388 FT /note="similar to region of SPBC23G7 S. pombe chromosome 2" FT CDS complement(2053185..2053313) FT /colour=2 FT /gene="matmi" FT /gene="SPBC1711.01c" FT /label=matmi FT /note="SPBC1711.01c, len:43" FT /product="mating-type m-specific polypeptide mi" FT /fasta_file="fasta/c1711.tab.seq.04077.out" FT CDS 2053448..2053993 FT /colour=2 FT /gene="matmc" FT /gene="SPBC1711.02" FT /label=matmc FT /note="SPBC1711.02, len:182" FT /product="mating-type m-specific polypeptide mc; HMG box" FT /fasta_file="fasta/c1711.tab.seq.04078.out" FT misc_feature 2053754..2053960 FT /note="Match to PF00505 HMG_box, HMG (high mobility group) FT box Score 118.06" FT misc_feature complement(2055601..2057720) FT /note="duplicated region flanking matmc SPBC1711 S. pombe FT chromosome 2" FT misc_feature complement(2057018..2057720) FT /note="region of similar to SPBC23G7 S. pombe chromosome 2" FT CDS join(2058962..2058986,2059026..2059152,2059201..2059475, FT 2059681..2059842,2059888..2060075) FT /colour=10 FT /gene="SPBC1711.03" FT /label=SPBC1711.03 FT /note="SPBC1711.03, len:259, SIMILARITY:Arabidopsis FT thaliana, CAB78302, hypothetical 27.9 kD protein., (246 FT aa), fasta scores: opt: 568, E():4.3e-31, (38.5% identity FT in 252 aa)" FT /product="conserved protein; similar to S. cerevisiae FT YKL207W; predicted transmembrane" FT /fasta_file="fasta/c1711.tab.seq.04079.out" FT misc_feature 2058987..2058992 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 2059013..2059025 FT /colour=6 FT /note="ttaacgtatctag, splice branch and acceptor" FT misc_feature 2059153..2059158 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 2059184..2059200 FT /colour=6 FT /note="ctaacagcaatcttcag, splice branch and acceptor" FT misc_feature 2059476..2059481 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2059668..2059680 FT /colour=6 FT /note="ctaactatcaaag, splice branch and acceptor" FT misc_feature 2059843..2059848 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 2059874..2059887 FT /colour=6 FT /note="ttaacattttttag, splice branch and acceptor" FT CDS join(2060461..2060500,2060616..2060747,2060800..2061590) FT /colour=7 FT /gene="SPBC1711.04" FT /label=SPBC1711.04 FT /note="SPBC1711.04, len:320, SIMILARITY:Saccharomyces FT cerevisiae, MTD1_YEAST, methylenetetrahydrofolate FT dehydrogenase [nad+], (320 aa), fasta scores: opt: 1132, FT E():0, (58.5% identity in 299 aa)" FT /product="methylenetetrahydrofolate dehydrogenase [nad+]" FT /fasta_file="fasta/c1711.tab.seq.04080.out" FT misc_feature 2060501..2060506 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2060599..2060615 FT /note="ttaattgaatttttacag, splice branch and acceptor" FT misc_feature 2060748..2060753 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2060781..2060799 FT /colour=6 FT /note="ctaatcatgaacaatttag, splice branch and acceptor" FT misc_feature 2061147..2061170 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop), FT [AG].{4}GK[ST], info count = 13.8" FT CDS 2061867..2063222 FT /colour=10 FT /gene="SPBC1711.05" FT /label=SPBC1711.05 FT /note="SPBC1711.05, len:452, SIMILARITY:Homo sapiens, FT O95815, dentin phosphoryn, (788 aa), fasta scores: opt: FT 769, E():8.5e-27, (48.2% identity in 334 aa)" FT /product="hypothetical serine-rich repeat protein; similar FT to S. cerevisiae SRP40- nucleolar protein" FT /fasta_file="fasta/c1711.tab.seq.04081.out" FT CDS 2063736..2064827 FT /colour=2 FT /gene="rpl4" FT /gene="SPBC1711.06" FT /label=rpl4 FT /note="SPBC1711.06, len:364" FT /product="60S ribosomal protein L2" FT /fasta_file="fasta/c1711.tab.seq.04082.out" FT misc_feature 2063793..2064524 FT /note="Match to PF00573 Ribosomal_L4, Ribosomal protein FT L4/L1 family Score 503.17" FT CDS 2066855..2068297 FT /colour=7 FT /gene="SPBC1711.07" FT /label=SPBC1711.07 FT /note="SPBC1711.07, len:481, SIMILARITY:Saccharomyces FT cerevisiae, YM15_YEAST, hypothetical 57.3 kD trp-asp FT repeats containing protein in pom152-rec114 intergenic FT region., (511 aa), fasta scores: opt: 1234, E():0, (40.4% FT identity in 480 aa)" FT /product="WD repeat protein; putative nuclear pore complex FT associated" FT /fasta_file="fasta/c1711.tab.seq.04083.out" FT misc_feature 2067722..2067814 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 40.47" FT misc_feature 2067986..2068102 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 26.67" FT CDS join(2069724..2069755,2070131..2071109) FT /colour=10 FT /gene="SPBC1711.08" FT /label=SPBC1711.08 FT /note="SPBC1711.08, len:337" FT /product="conserved protein" FT /fasta_file="fasta/c1711.tab.seq.04084.out" FT misc_feature 2069756..2069761 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT intron 2069756..2070130 FT /colour=2 FT /note="confirmed intron" FT misc_feature 2070116..2070130 FT /colour=6 FT /note="ctaactcaattttag, splice branch and acceptor" FT CDS complement(join(2071559..2072359,2072426..2072437)) FT /colour=10 FT /gene="SPBC1711.09c" FT /label=SPBC1711.09c FT /note="SPBC1711.09c, len:271, SIMILARITY:Saccharomyces FT cerevisiae, YK68_YEAST, hypothetical 38.3 kD protein in FT prp16-srp40 intergenic region., (337 aa), fasta scores: FT opt: 238, E():2e-08, (24.2% identity in 240 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YKR088C" FT /fasta_file="fasta/c1711.tab.seq.04085.out" FT misc_feature complement(2072360..2072374) FT /colour=6 FT /note="ctaatcttgaactag, splice branch and acceptor" FT misc_feature complement(2072420..2072425) FT /colour=6 FT /note="gtatct, splice donor sequence" FT CDS complement(join(2073190..2074743,2074806..2074886, FT 2074932..2074934)) FT /colour=7 FT /gene="SPBC1711.10c" FT /label=SPBC1711.10c FT /note="SPBC1711.10c, len:546, SIMILARITY:Saccharomyces FT cerevisiae, NPL4_YEAST, npl4 protein., (580 aa), fasta FT scores: opt: 1495, E():0, (43.6% identity in 546 aa)" FT /product="putative nuclear pore protein" FT /fasta_file="fasta/c1711.tab.seq.04086.out" FT misc_feature complement(2074744..2074755) FT /colour=6 FT /note="ctaacaaatcag, splice branch and acceptor" FT misc_feature complement(2074800..2074805) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(2074887..2074900) FT /colour=6 FT /note="ctaacagtttaaag, splice branch and acceptor" FT misc_feature complement(2074926..2074931) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT CDS 2075872..2077044 FT /colour=7 FT /gene="SPBC1711.11" FT /label=SPBC1711.11 FT /note="SPBC1711.11, len:391, FT SIMILARITY:Schizosaccharomyces pombe, O14243, hypothetical FT 46.4 kD protein c6f6.12 in chromosome i., (401 aa), fasta FT scores: opt: 397, E():2.7e-18, (25.7% identity in 401 aa)" FT /product="putative nexin sorting PX domain" FT /fasta_file="fasta/c1711.tab.seq.04087.out" FT misc_feature 2075875..2076228 FT /note="Match to PF00787 PX, PX domain Score 85.55" FT CDS 2078224..2080275 FT /colour=7 FT /gene="SPBC1711.12" FT /label=SPBC1711.12 FT /note="SPBC1711.12, len:684, signal sequence predicted 1- FT 19aa, SIMILARITY:Trichophyton rubrum., AAD52012, tri r 4 FT allergen., (726 aa), fasta scores: opt: 1244, E():0, FT (37.2% identity in 701 aa)" FT /product="putative dipeptidyl peptidase; predicted N- FT terminal signal sequence; no apparent S. cerevisiae FT orthologs" FT /fasta_file="fasta/c1711.tab.seq.04088.out" FT CDS 2080516..2081835 FT /colour=2 FT /gene="his2" FT /gene="SPBC1711.13" FT /label=his2 FT /note="SPBC1711.13, len:440, SIMILARITY:Pichia pastoris, FT HIS2_PICPA, histidine biosynthesis trifunctional protein FT [includes:phosphoribosyl-amp cyclohydrolase, (842 aa), FT fasta scores: opt: 1587, E():0, (53.5% identity in 437 aa)" FT /product="putative histidinol dehydrogenase; similar to S. FT cerevisiae HIS4" FT /fasta_file="fasta/c1711.tab.seq.04089.out" FT misc_feature 2080582..2081820 FT /note="Match to PF00815 Histidinol_dh, Histidinol FT dehydrogenase Score 746.59" FT CDS join(2082141..2082345,2082395..2082732) FT /colour=2 FT /gene="rec15" FT /gene="SPBC1711.14" FT /label=rec15 FT /note="SPBC1711.14, len:181" FT /product="meiotic recombination protein; no apparent FT orthologs; low complexity protein" FT /fasta_file="fasta/c1711.tab.seq.00052.out" FT misc_feature 2082346..2082351 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2082383..2082394 FT /colour=6 FT /note="ctgacttaatag, splice branch and acceptor" FT CDS complement(2082712..2082810) FT /colour=9 FT /gene="SPBC1711.15c" FT /label=SPBC1711.15c FT /note="SPBC1711.15c, len:33, questionable ORF" FT /product="very hypothetical protein; has confirmed FT upstream intron and is largest reading frame in region FT with MET" FT /fasta_file="fasta/c1711.tab.seq.04091.out" FT intron complement(2082856..2083084) FT /colour=2 FT /note="confirmed intron" FT LTR 2084062..2084409 FT /note="Tf2-type LTR" FT CDS 2084877..2086427 FT /colour=7 FT /gene="SPBC1711.16" FT /label=SPBC1711.16 FT /note="SPBC1711.16, len:517, SIMILARITY:Homo sapiens, FT PWP1_HUMAN, periodic tryptophan protein 1 homolog, (501 FT aa), fasta scores: opt: 961, E():0, (36.6% identity in 481 FT aa)" FT /product="WD repeat protein" FT /fasta_file="fasta/c1711.tab.seq.04092.out" FT misc_feature 2085633..2085725 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 32.44" FT misc_feature 2085735..2085848 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 34.88" FT misc_feature 2085996..2086112 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 41.55" FT misc_feature 2087392..2089594 FT /note="Nominal overlap with SPBC17G9 S. pombe chromosome 2" FT misc_feature 2089009..2089314 FT /note="Match to PF00271 helicase_C, Helicases conserved C- FT terminal domain Score 27.97" FT misc_feature complement(2087392..2089594) FT /note="nominal overlap with cosmid SPBC1711 S. pombe FT chromosome 2;" FT misc_feature 2088400..2088423 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 2089009..2089314 FT /note="Match to PF00271 helicase_C, Helicases conserved C- FT terminal domain Score 27.97" FT CDS complement(join(2090590..2091098,2091140..2091242, FT 2091293..2091438,2091502..2091859)) FT /colour=7 FT /gene="SPBC17G9.02c" FT /label=SPBC17G9.02c FT /note="SPBC17G9.02c, len:371, SIMILARITY:Candida albicans, FT O94026, hypothetical 42.5 kD protein., (370 aa), fasta FT scores: opt: 640, E():0, (32.2% identity in 366 aa)" FT /product="putative RNA polymerase II accessory protein by FT similar to S. cerevisiae cdc73" FT /fasta_file="fasta/c17G9.tab.seq.03044.out" FT misc_feature complement(2091099..2091113) FT /colour=6 FT /note="ctaatcaatttttag, splice branch and acceptor" FT misc_feature complement(2091134..2091139) FT /colour=6 FT /note="gtgtgt, splice donor sequence" FT misc_feature complement(2091243..2091256) FT /colour=6 FT /note="ctaactttttttag, splice branch and acceptor" FT misc_feature complement(2091287..2091292) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(2091439..2091458) FT /colour=6 FT /note="ctaacattgtttatgagtag, splice branch and acceptor" FT misc_feature complement(2091496..2091501) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT CDS complement(2092456..2094231) FT /colour=7 FT /gene="SPBC17G9.03c" FT /label=SPBC17G9.03c FT /note="SPBC17G9.03c, len:591, SIMILARITY:Saccharomyces FT cerevisiae, SYKC_YEAST, lysyl-tRNA synthetase, cytoplasmic, FT (590 aa), fasta scores: opt: 2601, E():0, (65.0% FT identity in 586 aa)" FT /product="lysyl-tRNA synthetase, cytoplasmic" FT /fasta_file="fasta/c17G9.tab.seq.03045.out" FT misc_feature complement(2092495..2093556) FT /note="Match to PF00152 tRNA-synt_2, tRNA synthetases FT class II (D, K and N) Score 648.83" FT CDS complement(2094700..2096727) FT /colour=7 FT /gene="SPBC17G9.04c" FT /label=SPBC17G9.04c FT /note="SPBC17G9.04c, len:675, SIMILARITY:Saccharomyces FT cerevisiae, NU85_YEAST, nucleoporin nup85, (744 aa), fasta FT scores: opt: 183, E():7.8e-05, (20.7% identity in 639 aa)" FT /product="putative nuclear pore protein; similar to S. FT cerevisiae NUP85" FT /fasta_file="fasta/c17G9.tab.seq.03046.out" FT CDS 2098633..2099931 FT /colour=7 FT /gene="cyp6" FT /gene="SPBC17G9.05" FT /label=cyp7 FT /note="SPBC17G9.05, len:432, SIMILARITY:Drosophila FT melanogaster, AAD34736, hypothetical 75.5 kD protein., FT (653 aa), fasta scores: opt: 1226, E():0, (46.0% identity FT in 459 aa)" FT /product="cyclophilin-6; peptidyl-prolyl cis-trans FT isomerase; contains RNA-binding region; CRIP family; P. FT tetraurelia ortholog is involved in cell morphogenesis; no FT apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c17G9.tab.seq.03047.out" FT misc_feature 2098639..2098731 FT /note="Match to PF00160 pro_isomerase, Peptidyl-prolyl cis- FT trans isomerase Score 33.35" FT misc_feature 2099368..2099583 FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 74.99" FT CDS complement(2100087..2101091) FT /colour=7 FT /gene="SPBC17G9.06c" FT /label=SPBC17G9.06c FT /note="SPBC17G9.06c, len:334, SIMILARITY:Escherichia coli., FT Q47317, plasmid iuca, iucb and iucc genes., (315 aa), FT fasta scores: opt: 645, E():0, (37.5% identity in 275 aa)" FT /product="putative acetyltransferase; Pfam-B:PB012167; FT similar to bacterial siderophore bioynthesis protein which FT is involved in iron uptake; no apparent S. cerevisiae FT ortholog" FT /fasta_file="fasta/c17G9.tab.seq.03048.out" FT CDS join(2101530..2101598,2101680..2102015) FT /colour=2 FT /gene="rps24-2" FT /gene="SPBC17G9.07" FT /label=rps24-2 FT /note="SPBC17G9.07, len:134" FT /product="40S ribosomal protein S24" FT /fasta_file="fasta/c17G9.tab.seq.03049.out" FT misc_feature 2101599..2101604 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT intron 2101599..2101679 FT /colour=2 FT /note="confirmed intron" FT misc_feature 2101663..2101679 FT /colour=6 FT /note="ctaacggaaatttatag, splice branch and acceptor" FT misc_feature 2101680..2101928 FT /note="Match to PF01282 Ribosomal_S24e, Ribosomal protein FT S24e Score 130.59" FT CDS complement(join(2102344..2102831,2102876..2104502, FT 2104554..2104697,2104822..2105004,2105049..2105182, FT 2105239..2105275)) FT /colour=2 FT /gene="csx2" FT /gene="SPBC17G9.08c" FT /label=csx2 FT /note="SPBC17G9.08c, len:870" FT /product="csx2 protein; putative ADP-ribosylation factor FT (ARF) GTPase activating protein (GAP) with effector FT functions" FT /fasta_file="fasta/c17G9.tab.seq.03050.out" FT misc_feature complement(join(2102602..2102831,2102876..2102975)) FT /note="Match to PF01412 ArfGap, putative GTP-ase FT activating required for Arf Score 123.46" FT misc_feature complement(2102832..2102844) FT /colour=6 FT /note="ctaacaagaacag, splice branch and acceptor" FT misc_feature complement(2102870..2102875) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(2103162..2103422) FT /note="Match to PF00169 PH, PH domain Score 33.01" FT misc_feature complement(2104503..2104514) FT /colour=6 FT /note="ctaaatatgcag, splice branch and acceptor" FT misc_feature complement(2104548..2104553) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(2104698..2104713) FT /colour=6 FT /note="ctaacttttgattcag, splice branch and acceptor" FT misc_feature complement(2104816..2104821) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(2105005..2105019) FT /colour=6 FT /note="ctaacacatcttcag, splice branch and acceptor" FT misc_feature complement(2105043..2105048) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(2105183..2105197) FT /colour=6 FT /note="ctaactctgctaaag, splice branch and acceptor" FT misc_feature complement(2105233..2105238) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS 2108311..2109651 FT /colour=2 FT /gene="tif213" FT /gene="SPBC17G9.09" FT /label=tif213 FT /note="SPBC17G9.09, len:446" FT /product="eukaryotic translation initiation factor 2 gamma FT subunit" FT /fasta_file="fasta/c17G9.tab.seq.03051.out" FT misc_feature 2108377..2109567 FT /note="Match to PF00009 GTP_EFTU, Elongation factor Tu FT family Score 172.41" FT CDS 2110324..2110848 FT /colour=2 FT /gene="rpl11-2" FT /gene="SPBC17G9.10" FT /label=rpl11 FT /note="SPBC17G9.10, len:174" FT /product="60S ribosomal protein L11" FT /fasta_file="fasta/c17G9.tab.seq.03052.out" FT misc_feature 2110342..2110503 FT /note="Match to PF00281 Ribosomal_L5, Ribosomal protein L5 FT Score 90.75" FT misc_feature 2110513..2110812 FT /note="Match to PF00673 Ribosomal_L5_C, ribosomal L5P FT family C-terminus Score 218.76" FT CDS complement(2111473..2115030) FT /EC_number="6.4.1.1" FT /colour=2 FT /gene="pyr1" FT /gene="SPBC17G9.11c" FT /label=pyr1 FT /note="SPBC17G9.11c, len:1185, SIMILARITY:Aspergillus FT terreus., O93918, pyruvate carboxylase., (1193 aa), fasta FT scores: opt: 5531, E():0, (68.5% identity in 1173 aa)" FT /product="pyruvate carboxylase" FT /fasta_file="fasta/c17G9.tab.seq.03053.out" FT misc_feature complement(2111485..2111682) FT /note="Match to PF00364 biotin_lipoyl, Biotin-requiring FT enzymes Score 86.03" FT misc_feature complement(2112451..2113230) FT /note="Match to PF00682 HMGL-like, HMGL-like Score 222.60" FT misc_feature complement(2113591..2114928) FT /note="Match to PF00289 CPSase_L_chain, Carbamoyl- FT phosphate synthase (CPSase) Score 666.34" FT CDS complement(2115799..2116623) FT /colour=10 FT /gene="SPBC17G9.12c" FT /label=SPBC17G9.12c FT /note="SPBC17G9.12c, len:274, LOW SIMILARITY:Archaeoglobus FT fulgidus., O28142, phosphoserine phosphatase, (344 aa), FT fasta scores: opt: 113, E():0.86, (22.1% identity in 253 FT aa)" FT /product="putative serine phosphoprotein; similar to S. FT cerevisiae YCR015C" FT /fasta_file="fasta/c17G9.tab.seq.03054.out" FT CDS complement(2117183..2118136) FT /colour=8 FT /gene="SPBC17G9.13c" FT /label=SPBC17G9.13c FT /note="SPBC17G9.13c, len:317" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c17G9.tab.seq.03055.out" FT misc_feature 2119770..2120009 FT /note="nominal overlap with cosmid SPBC1815, EM:AL050301 FT S. pombe chromosome 2" FT misc_feature complement(2119770..2120009) FT /note="nominal overlap with cosmid SPBC17G9, EM:AL109846 FT S. pombe chromosome 2" FT repeat_region 2120587..2120626 FT /label={taacc}8 FT /note="(taacc)8" FT CDS 2121836..2123155 FT /EC_number="4.2.1.11" FT /colour=2 FT /gene="eno1" FT /gene="SPBC1815.01" FT /label=eno1 FT /note="SPBC1815.01, len:439" FT /product="enolase" FT /fasta_file="fasta/c1815.tab.seq.03832.out" FT misc_feature 2124160..2124448 FT /note="nominal overlap with cosmid SPBC14C8, EM:AL022305 FT S. pombe chromosome 2" FT misc_feature 2124160..2124448 FT /note="nominal overlap with cosmid SPBC1815, AL050301 FT S.pombe chromosome 2" FT CDS 2126153..2127436 FT /colour=7 FT /gene="SPBC14C8.02" FT /label=SPBC14C8.02 FT /note="SPBC14C8.02, len:427, SIMILARITY:Saccharomyces FT cerevisiae, IM44_YEAST, mitochondrial import inner FT membrane translocase subunit tim44, (431 aa), fasta FT scores: opt: 893, E():0, (43.0% identity in 430 aa)" FT /product="putative mitochondrial import inner membrane FT translocase subunit" FT /fasta_file="fasta/c14C8.tab.seq.02794.out" FT misc_feature 2126420..2126443 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS 2128331..2129611 FT /colour=7 FT /gene="SPBC14C8.03" FT /label=SPBC14C8.03 FT /note="SPBC14C8.03, len:426, SIMILARITY:Arabidopsis FT thalian a, G3212871, putative translation initiation FT factor., (431 aa), fasta scores: opt: 1697, E():0, (59.4% FT identity in 416 aa)" FT /product="putative methionine metallopeptidase" FT /fasta_file="fasta/c14C8.tab.seq.02795.out" FT misc_feature 2128673..2129386 FT /colour=9 FT /note="Pfam match to entry PF00557 pep_M24, FT metallopeptidas e family M24" FT misc_feature 2128910..2128960 FT /colour=8 FT /note="PS01202 Methionine aminopeptidase subfamily 2 FT signat ure" FT CDS join(2130735..2130761,2130824..2130961,2131411..2131604, FT 2131685..2132195) FT /colour=7 FT /gene="SPBC14C8.04" FT /label=SPBC14C8.04 FT /note="SPBC14C8.04, len:289, predicted transit peptide 1- FT 43 aa, SIMILARITY:Saccharomyces cerevisiae, ILV6_YEAST, FT acetolactate synthase small subunit , (309 aa), fasta FT scores: opt: 591, E():8.8e-32, (47.0% identity in 285 aa)" FT /product="Putative acetolactate synthase small subunit; FT similar to S. cerevisiae ILV6" FT /fasta_file="fasta/c14C8.tab.seq.02796.out" FT misc_feature 2130762..2130767 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 2130802..2130823 FT /colour=6 FT /note="ctaactaaacaaatcatattag, splice branch and acceptor" FT misc_feature 2130962..2130967 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2131397..2131410 FT /colour=6 FT /note="ctaacggttattag, splice branch and acceptor" FT misc_feature join(2131456..2131604,2131685..2131754) FT /note="Match to PF00557 ACT, metallopeptidase family M24 FT Score 44.63" FT misc_feature 2131605..2131610 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2131670..2131684 FT /colour=6 FT /note="ttaacatttttttag, splice branch and acceptor" FT CDS complement(2132619..2133971) FT /colour=2 FT /gene="meu17" FT /gene="SPBC14C8.05c" FT /label=meu17 FT /note="SPBC14C8.05c, len:450, SIMILARITY:Aspergillus FT shirou sami, AMYG_ASPSH, glucoamylase , (639 aa), fasta s FT cores: opt: 797, E():0, (39.5% identity in 446 aa)" FT /product="glucoamylase ; similar to S. cerevisiae SGA1 FT Glucoamylase (glucan-alpha-1,4-glucosidase), sporulation- FT specific; meiotic expression upregulated" FT /fasta_file="fasta/c14C8.tab.seq.02797.out" FT misc_feature complement(2132763..2133884) FT /colour=9 FT /note="Pfam match to entry PF00723 glycosyl_hydr10, FT Glycosy l hydrolases family 15" FT CDS join(2135037..2135109,2135157..2136217) FT /colour=2 FT /gene="sop2" FT /gene="SPBC14C8.06" FT /label=sop2 FT /note="SPBC14C8.06, len:377" FT /product=" ARP2/3 actin-organizing complex; involved in FT actin assembly and function; required for movement of F- FT actin patches; null lethal" FT /fasta_file="fasta/c14C8.tab.seq.02798.out" FT misc_feature 2135110..2135115 FT /colour=6 FT /note="gtacag, splice donor sequence" FT intron 2135110..2135156 FT /note="confirmed intron: intron confirmed by ESTs" FT misc_feature 2135139..2135156 FT /colour=6 FT /note="ttaacaaatttgatatag, splice branch and acceptor" FT misc_feature 2135219..2135332 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 42.11" FT CDS complement(2136739..2138472) FT /colour=2 FT /gene="cdc18" FT /gene="SPBC14C8.07c" FT /label=cdc18 FT /note="SPBC14C8.07c, len:577" FT /product="replication initiation factor; MCM loader; cell FT division control protein; couples cell cycle signals to FT DNA replication machinery; similar to S. cerevisiae CDC6" FT /fasta_file="fasta/c14C8.tab.seq.02799.out" FT misc_feature complement(2137009..2137893) FT /colour=9 FT /note="Pfam match to entry PF00004 AAA, ATPases associated FT with various cellular activities (AAA), score 80.40, E- FT value 3.6e-20" FT misc_feature complement(2137855..2137878) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS complement(2140029..2140577) FT /colour=9 FT /gene="SPBC14C8.08c" FT /label=SPBC14C8.08c FT /note="SPBC14C8.08c, (May not be coding as overlaps with FT SP BC14C8.09c), len:183aa" FT /product="very hypothetical protein" FT /fasta_file="fasta/c14C8.tab.seq.02800.out" FT CDS complement(2140487..2140921) FT /colour=10 FT /gene="SPBC14C8.09c" FT /label=SPBC14C8.09c FT /note="SPBC14C8.09c, len:144, (overlaps with SPBC14C8.08c FT b ut no splicing apparent), SIMILARITY:Saccharomyces FT cerevisi ae, YCR59C, YCU9_YEAST, hypothetical 29.0 kD FT protein in pwp 2-sup61 intergenic region, (258 aa), fasta FT scores: opt: 215 , E():7.9e-16, (33.0% identity in 106 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YCR059C" FT /fasta_file="fasta/c14C8.tab.seq.02801.out" FT CDS 2141362..2141892 FT /colour=7 FT /gene="SPBC14C8.10" FT /label=SPBC14C8.10 FT /note="SPBC14C8.10, len:176, SIMILARITY:Saccharomyces FT cerev isiae, RM24_YEAST, mitochondrial 60s ribosomal FT protein l24 , (258 aa), fasta scores: opt: 254, E():1e-16, FT (41 .8% identity in 110 aa)" FT /product="mitochondrial ribosomal protein L28(L24)" FT /fasta_file="fasta/c14C8.tab.seq.02802.out" FT misc_feature 2141443..2141628 FT /colour=9 FT /note="Pfam match to entry PF00830 Ribosomal_L28, FT Ribosomal L28 family" FT misc_feature 2142811 FT /note="true extent of overlap with cosmid SPBC15C4" FT CDS complement(2143249..2143659) FT /colour=8 FT /gene="SPBC14C8.11c" FT /label=SPBC14C8.11c FT /note="SPBC14C8.11c, len:136aa" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c14C8.tab.seq.02803.out" FT CDS join(2144371..2144440,2144500..2144701,2144750..2144855) FT /EC_number="2.7.7.6" FT /colour=2 FT /gene="rpb8" FT /gene="SPBC14C8.12" FT /label=rpb8 FT /note="SPBC14C8.12, len:125" FT /product="DNA-directed RNA polymerases I, II, and III 14.5 FT kD subunit" FT /fasta_file="fasta/c14C8.tab.seq.02804.out" FT misc_feature 2144441..2144446 FT /colour=6 FT /note="gtttgt, splice donor sequence" FT intron 2144441..2144499 FT /note="confirmed intron: intron confirmed by ESTs" FT misc_feature 2144486..2144499 FT /colour=6 FT /note="ctaaccttacccag, splice branch and acceptor" FT misc_feature 2144702..2144707 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT intron 2144702..2144749 FT /note="confirmed intron: intron confirmed by ESTs" FT misc_feature 2144733..2144749 FT /colour=6 FT /note="ttattaacctaattacaaag, splice branch and acceptor" FT CDS 2145987..2146742 FT /colour=9 FT /gene="SPBC14C8.13" FT /label=SPBC14C8.13 FT /note="SPBC14C8.13, (possibly not coding or truncated as FT ov erlaps SPBC14C8.14), len:251aa" FT /product="very hypothetical protein" FT /fasta_file="fasta/c14C8.tab.seq.02805.out" FT CDS complement(join(2146639..2149320,2149390..2149587)) FT /colour=2 FT /gene="pol5" FT /gene="SPBC14C8.14c" FT /label=pol5 FT /note="SPBC14C8.14c, len:959" FT /product="DNA polymerase V" FT /fasta_file="fasta/c14C8.tab.seq.02806.out" FT conflict 2147493..2147495 FT /citation=[1] FT /colour=4 FT /note="single A residue discrepancy was removed in FT accordan ce with the sequence in the overlap with cosmid FT c15C4 which caused a frame-shift error in c14C8.14c, the FT original sequ ence in this region was CAAG" FT misc_feature complement(2147755..2147781) FT /colour=8 FT /note="PS00116 DNA polymerase family B signature" FT misc_feature complement(2149321..2149335) FT /colour=6 FT /note="ctaaccaagaactag, splice branch and acceptor" FT intron complement(2149321..2149389) FT /colour=2 FT /note="confirmed intron" FT misc_feature 2149374 FT /note="G -> T discrepancy with cosmid c15C4" FT misc_feature 2149376 FT /note="T -> G discrepancy with cosmid c15C4" FT misc_feature complement(2149384..2149389) FT /colour=6 FT /note="gtatat, splice donor sequence" FT CDS join(2150827..2150861,2150916..2151032,2151088..2152141, FT 2152205..2152381) FT /colour=7 FT /gene="SPBC14C8.15" FT /label=SPBC14C8.15 FT /note="SPBC14C8.15, len:460, FT SIMILARITY:Schizosaccharomyces pombe, O14052, putative FT triglyceride lipase-cholesterol es terase, (452 aa), fasta FT scores: opt: 1107, E():0, (39.2% id entity in 424 aa)" FT /product="putative triglyceride lipase-cholesterol esteras FT e" FT /fasta_file="fasta/c14C8.tab.seq.02807.out" FT misc_feature 2150862..2150867 FT /colour=6 FT /note="gttagt, splice donor sequence" FT misc_feature 2150899..2150915 FT /colour=6 FT /note="ctaacatttgtttttag, splice branch and acceptor" FT misc_feature 2151033..2151038 FT /colour=6 FT /note="gtgagt, splice donor sequence" FT misc_feature 2151069..2151087 FT /colour=6 FT /note="ctaacctcggggtttgcag, splice branch and acceptor" FT misc_feature 2151283..2152104 FT /colour=9 FT /note="Pfam match to entry PF00561 abhydrolase, alpha/beta FT hydrolase fold" FT misc_feature 2152142..2152147 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2152185..2152204 FT /colour=6 FT /note="ctaacaagttaaaattaaag, splice branch and acceptor" FT CDS complement(2152763..2153710) FT /colour=10 FT /gene="SPBC14C8.16c" FT /label=SPBC14C8.16c FT /note="SPBC14C8.16c, len:315" FT /product="hypothetical protein; similar to S. cerevisiae FT YGR165W; possibly involved in mitochondrial translation " FT /fasta_file="fasta/c14C8.tab.seq.02808.out" FT CDS complement(join(2154682..2156207,2156255..2156309)) FT /colour=7 FT /gene="SPBC14C8.17c" FT /label=SPBC14C8.17c FT /note="SPBC14C8.17c, len:526, SIMILARITY:Saccharomyces FT cerevisiae, YLR055C, SPT8_YEAST, transcription factor spt8, FT (60 2 aa), fasta scores: opt: 484, E():0, (37.3% FT identity in 55 0 aa)" FT /product="putative transcriptional activator; putative FT SAGA complex (Spt-Ada-Gcn5-Acetyltransferase); putative FT ADA complex; WD repeat protein; similar to S. cerevisiae FT SPT8" FT /fasta_file="fasta/c14C8.tab.seq.02809.out" FT misc_feature complement(2155483..2155599) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 42.87" FT misc_feature complement(2156208..2156223) FT /colour=6 FT /note="ctgacttcaaatctag, splice branch and acceptor" FT misc_feature complement(2156249..2156254) FT /colour=6 FT /note="gttagt, splice donor sequence" FT misc_feature 2156310..2158210 FT /note="nominal overlap with cosmid SPBC15C4, EM:AL023290 FT S. pombe chromosome 2" FT misc_feature complement(2157314..2157328) FT /colour=6 FT /note="ttaacaatttaatag, splice branch and acceptor" FT misc_feature complement(2157385..2157390) FT /colour=6 FT /note="gtaatt, splice donor sequence" FT misc_feature complement(2157590..2157605) FT /colour=6 FT /note="ctaattgattgtatag, splice branch and acceptor" FT misc_feature complement(2157635..2157640) FT /colour=6 FT /note="gttcgt, splice donor sequence" FT misc_feature complement(2157787..2157799) FT /colour=6 FT /note="ctaacttcatcag, splice branch and acceptor" FT misc_feature complement(2157844..2157849) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature complement(2157994..2158010) FT /colour=6 FT /note="ttaattttttaatttag, splice branch and acceptor" FT misc_feature complement(2158061..2158066) FT /colour=6 FT /note="gtaagg, splice donor sequence" FT misc_feature 2156310..2158210 FT /note="nominal overlap with cosmid SPBC14C8, EM:AL022305 FT S. pombe chromosome 2" FT misc_feature complement(2157314..2157328) FT /colour=6 FT /note="ttaacaatttaatag, splice branch and acceptor" FT misc_feature complement(2157385..2157390) FT /colour=6 FT /note="gtaatt, splice donor sequence" FT misc_feature complement(2157590..2157605) FT /colour=6 FT /note="ctaattgattgtatag, splice branch and acceptor" FT misc_feature complement(2157635..2157640) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(2157787..2157799) FT /colour=6 FT /note="ctaacttcatcag, splice branch and acceptor" FT misc_feature complement(2157844..2157849) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature complement(2157994..2158010) FT /colour=6 FT /note="ttaattttttaatttag, splice branch and acceptor" FT misc_feature complement(2158061..2158066) FT /colour=6 FT /note="gtaagg, splice donor sequence" FT CDS join(2159270..2159494,2159539..2159847,2159961..2160943, FT 2161036..2161303) FT /colour=7 FT /gene="SPBC15C4.02" FT /label=SPBC15C4.02 FT /note="SPBC15C4.02, len:594, SIMILARITY:Saccharomyces FT cerevisiae, YLR253W, YL53_YEAST, hypothetical 65.9 kD FT protein, (569 aa), fasta scores: opt: 1440, E():0, (44.5% FT identity in 499 aa)" FT /product="ABC1 domain protein; possibly involved in FT electron transfer; yeast ABC1 supresses cytochrome b FT translation defect; E. coli homolog is required for FT ubiquinone producution" FT /fasta_file="fasta/c15C4.tab.seq.03088.out" FT misc_feature 2159495..2159500 FT /colour=6 FT /note="gtattt, splice donor sequence" FT misc_feature 2159528..2159538 FT /colour=6 FT /note="ctaattttaag, splice branch and acceptor" FT misc_feature 2159848..2159853 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2159942..2159960 FT /colour=6 FT /note="ctaatgtataattatttag, splice branch and acceptor" FT misc_feature 2160944..2160949 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2161022..2161035 FT /colour=6 FT /note="ttaactgacaacag, splice branch and acceptor" FT misc_feature 2161515..2162717 FT /colour=9 FT /note="Pfam match to entry PF00996 GDI, GDP dissociation FT in hibitor" FT CDS join(2161515..2161582,2161632..2162943) FT /colour=7 FT /gene="SPBC15C4.03" FT /label=SPBC15C4.03 FT /note="SPBC15C4.03, len:459, SIMILARITY:Saccharomyces FT cerevisiae, YOR370C, Q06761, mrs6 protein., (594 aa), FT fasta scor es: opt: 287, E():1.5e-30, (31.2% identity in FT 430 aa)" FT /product="putative RAB geranylgeranyl-transferase escort FT protein (REP), GDP dissociation inhibitor" FT /fasta_file="fasta/c15C4.tab.seq.03089.out" FT misc_feature 2161583..2161588 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2161611..2161631 FT /colour=6 FT /note="ctgactgtttgaattatttag, splice branch and acceptor" FT CDS complement(2163430..2165058) FT /colour=7 FT /gene="SPBC15C4.04c" FT /label=SPBC15C4.04c FT /note="SPBC15C4.04c, len:542, SIMILARITY:Neurospora crassa, FT AAP2_NEUCR, amino acid permease., (551 aa), fasta FT scores: opt : 1647, E():0, (49.8% identity in 484 aa)" FT /product="APC amino acid transporter" FT /fasta_file="fasta/c15C4.tab.seq.03090.out" FT misc_feature complement(2163496..2164845) FT /colour=9 FT /note="Pfam match to entry PF00324 aa_permeases, Amino FT acid permease" FT misc_feature complement(2164693..2164788) FT /colour=8 FT /note="PS00218 Amino acid permeases signature" FT CDS 2167322..2171608 FT /colour=7 FT /gene="SPBC15C4.05" FT /label=SPBC15C4.05 FT /note="SPBC15C4.05, len:1428, SIMILARITY:Arabidopsis FT thaliana, O49345, putative RNA helicase a, 5' partial, FT (1114 aa), fasta scores: opt: 761, E():0, (31.9% identity FT in 786 aa)" FT /product="putative ATP-dependent RNA helicase" FT /fasta_file="fasta/c15C4.tab.seq.03091.out" FT misc_feature 2169281..2169304 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 2170091..2170390 FT /colour=9 FT /note="Pfam match to entry helicase_C PF00271, Helicases FT co nserved C-terminal domain" FT misc_feature complement(2172386..2172514) FT /colour=9 FT /note="Pfam match to entry zf-C3HC4 PF00097, zinc finger, FT C 3HC4 type (RING finger)" FT misc_feature 2172424..2174005 FT /note="nominal overlap with cosmid SPBC21H7, EM:AL023286 FT S. pombe chromosome 2" FT misc_feature 2172424..2174005 FT /note="nominal overlap with cosmid SPBC15C4, EM:AL023290 FT S. pombe chromosome 2" FT CDS 2175801..2176448 FT /colour=7 FT /gene="SPBC21H7.02" FT /label=SPBC21H7.02 FT /note="SPBC21H7.02, len:215, SIMILARITY:Saccharomyces FT cerev isiae, YDR167W, T2D8_YEAST, transcription initiation FT factor tfiid 23 kD subunit, (206 aa), fasta scores: opt: FT 288, E() :8.8e-24, (37.7% identity in 207 aa)" FT /product="putative transcription initiation factor TFIID FT subunit; TAF(II) complex (TBP-associated protein complex); FT putative SAGA complex ; possibly involved in chromatin FT architecture; transcriptional activator; similar to S. FT cerevisiae TAF25" FT /fasta_file="fasta/c21H7.tab.seq.03130.out" FT CDS complement(2177243..2178634) FT /EC_number="3.1.3.2" FT /colour=7 FT /gene="SPBC21H7.03c" FT /label=SPBC21H7.03c FT /note="SPBC21H7.03c, len:463, FT SIMILARITY:Schizosaccharomyce s pombe, PPA2_SCHPO, FT thiamine-repressible acid phosphatase , (463 aa), fasta FT scores: opt: 2427, E():0, (74.5% identity in 463 aa)" FT /product="thiamine-repressible acid phosphatase" FT /fasta_file="fasta/c21H7.tab.seq.03131.out" FT misc_feature complement(2177468..2178448) FT /colour=9 FT /note="Pfam match to entry acid_phosphat PF00328, FT Histidine acid phosphatases" FT misc_feature complement(2177585..2177635) FT /colour=8 FT /note="PS00778 Histidine acid phosphatases active site FT sign ature" FT misc_feature complement(2178413..2178457) FT /colour=8 FT /note="PS00616 Histidine acid phosphatases FT phosphohistidine signature" FT CDS 2179413..2181542 FT /colour=7 FT /gene="SPBC21H7.04" FT /label=SPBC21H7.04 FT /note="SPBC21H7.04, len:709, SIMILARITY:Saccharomyces FT cerev isiae, YKR024C, DBP7_YEAST, putative ATP-dependent FT RNA heli case dbp7, (742 aa), fasta scores: opt: 438, FT E():0, (39.0% identity in 767 aa)" FT /product="putative ATP-dependent RNA helicase" FT /fasta_file="fasta/c21H7.tab.seq.03132.out" FT misc_feature 2179842..2180630 FT /colour=9 FT /note="Pfam match to entry DEAD PF00270, DEAD and DEAH FT boxh elicases" FT misc_feature 2179965..2179988 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 2180778..2181035 FT /colour=9 FT /note="Pfam match to entry helicase_C PF00271, Helicases FT co nserved C-terminal domain" FT misc_feature 2180793..2180816 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 2181156..2181179 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 2181441..2181464 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT rRNA complement(2181970..2182088) FT /note="SPA Yeast (S.pombe) 5S ribosomal RNA." FT CDS join(2182813..2183755,2183798..2183914,2183958..2184161, FT 2184209..2184693) FT /colour=2 FT /gene="sfc6" FT /gene="SPBC21H7.05" FT /label=sfc6 FT /note="SPBC21H7.05, len:582, SIMILARITY:Saccharomyces FT cerevisiae, Q06339, chromosome iv cosmid 9476., (672 aa), FT fasta scores: opt: 387, E():2.8e-16, (24.4% identity in FT 624 aa)" FT /note="homology to terminator-associated binding sinubut FT TFC6" FT /product="RNA polymerase III transcription factor TFIIIC FT subunit; WD repeat protein (4); similar to S. cerevisiae FT SFC6" FT /fasta_file="fasta/c21H7.tab.seq.03133.out" FT misc_feature 2183756..2183761 FT /colour=6 FT /note="gtatta, splice donor sequence" FT misc_feature 2183764..2183892 FT /colour=9 FT /note="Pfam match to entry PF00400 WD40, WD domain, G-beta FT repeat, score 7.00, E-value 6.6" FT misc_feature 2183784..2183797 FT /colour=6 FT /note="ctaacatgaactag, splice branch and acceptor" FT misc_feature 2183915..2183920 FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature 2183943..2183957 FT /colour=6 FT /note="ctaattaagtataag, splice branch and acceptor" FT misc_feature 2184162..2184167 FT /colour=6 FT /note="gtacga, splice donor sequence" FT misc_feature 2184166..2184282 FT /colour=9 FT /note="Pfam match to entry PF00400 WD40, WD domain, G-beta FT repeat, score 15.60, E-value 0.48" FT misc_feature 2184194..2184208 FT /colour=6 FT /note="ctaacttaatatcag, splice branch and acceptor" FT CDS complement(join(2184901..2185472,2185599..2185629)) FT /colour=10 FT /gene="SPBC21H7.06c" FT /label=SPBC21H7.06c FT /note="SPBC21H7.06c, len:200, LOW SIMILARITY to N-term FT of:Saccharomyces cerevisiae, YOL032w, Q08202, chromosome FT xv reading frame orf yol032w., (246 aa), fasta scores: FT opt: 188, E():6.8e-13, (27. 0% identity in 244 aa)" FT /product="conserved protein" FT /fasta_file="fasta/c21H7.tab.seq.03134.out" FT misc_feature complement(2185473..2185488) FT /colour=6 FT /note="ctaatacacaatctag, splice branch and acceptor" FT misc_feature complement(2185593..2185598) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS complement(2187265..2187915) FT /EC_number="4.2.1.19" FT /colour=2 FT /gene="his5" FT /gene="SPBC21H7.07c" FT /label=his5 FT /note="SPBC21H7.07c, len:216" FT /product="imidazoleglycerol-phosphate dehydratase; similar FT to S. cerevisiae HIS3" FT /fasta_file="fasta/c21H7.tab.seq.03135.out" FT misc_feature complement(2187322..2187756) FT /colour=9 FT /note="Pfam match to entry IGPD PF00475, Imidazoleglycerol- FT phosphate dehydratase" FT misc_feature complement(2187343..2187381) FT /colour=8 FT /note="PS00955 Imidazoleglycerol-phosphate dehydratase FT sign ature 2" FT misc_feature complement(2187625..2187666) FT /colour=8 FT /note="PS00954 Imidazoleglycerol-phosphate dehydratase FT sign ature 1" FT misc_feature 2189285..2189848 FT /colour=9 FT /note="Pfam match to entry adh_short PF00106, FT Alcohol/other dehydrogenases, short chain type" FT misc_feature 2189596..2189601 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2189630..2189646 FT /colour=6 FT /note="ctaactgcttaatttag, splice branch and acceptor" FT misc_feature complement(2189714..2190172) FT /note="nominal overlap with cosmid SPBC16H5. EM:AL022104 FT S. pombe chromosome 2" FT misc_feature 2189778..2189783 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2189816..2189831 FT /colour=6 FT /note="ctaacgtgattaacag, splice branch and acceptor" FT CDS complement(join(2190172..2191873,2191917..2193029, FT 2193110..2193375)) FT /colour=10 FT /gene="SPBC16H5.13" FT /label=SPBC16H5.13 FT /note="SPBC16H5.13, len:1026, low similar to WD repeat FT proteins" FT /product="hypothetical protein; contains 3 WD-repeat FT domains" FT /fasta_file="fasta/c16H5.tab.seq.00046.out" FT misc_feature 2189714..2190172 FT /note="nominal overlap with cosmid SPBC21H7, EM:AL023286 FT S.pombe chromosome 2" FT misc_feature 2189778..2189783 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2189816..2189831 FT /colour=6 FT /note="ctaacgtgattaacag, splice branch and acceptor" FT misc_feature complement(2191003..2191112) FT /note="Blast N hit to SPAC18B11 Z50728 S.pombe chromosome FT I, putative conserved domain" FT misc_feature complement(2191874..2191890) FT /colour=6 FT /note="ttaatcgacttttatag, splice branch and acceptor" FT misc_feature complement(2191911..2191916) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(2193030..2193044) FT /colour=6 FT /note="ctaacattttctcag, splice branch and acceptor" FT misc_feature complement(2193104..2193109) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(2193160..2193192) FT /colour=8 FT /note="PS00133 zinc carboxypeptidases, zinc binding FT region2 signature" FT CDS join(2195002..2195011,2195209..2195320,2195380..2197306) FT /colour=8 FT /gene="SPBC16H5.12c" FT /label=SPBC16H5.12c FT /note="putative alteRNAtive N-terminal splicing, but no FT consensus branch" FT /note="SPBC16H5.12c, len:682, SIMILARITY:Caenorhabditis FT elegans., Q20694, glutamic-rich., (474 aa), fasta scores: FT opt: 145, E():0.15, (26.3% identity in 186 aa)" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c16H5.tab.seq.02882.out" FT misc_feature 2195012..2195017 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 2195190..2195208 FT /colour=6 FT /note="ctaataactatcccttcag, splice branch and acceptor" FT misc_feature 2195321..2195326 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2195365..2195379 FT /colour=6 FT /note="ctaaccttttttcag, splice branch and acceptor" FT CDS join(2197814..2198063,2198113..2199611,2199658..2199846) FT /colour=2 FT /gene="skb1" FT /gene="SPBC16H5.11c" FT /label=skb1 FT /note="SPBC16H5.11c, len:645" FT /product="shk1p kinase-binding protein; regulation of cell FT morphogenesis; regulation of mitosis; protein FT methyltransferase" FT /fasta_file="fasta/c16H5.tab.seq.02883.out" FT misc_feature 2198064..2198069 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2198094..2198112 FT /colour=6 FT /note="ttaaccaattttactatag, splice branch and acceptor" FT misc_feature 2199612..2199617 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2199644..2199657 FT /colour=6 FT /note="ctaatatttcctag, splice branch and acceptor" FT CDS 2200362..2202569 FT /colour=2 FT /gene="prp43" FT /gene="SPBC16H5.10c" FT /label=prp43 FT /note="SPBC16H5.10c, len:735, SIMILARITY:Saccharomyces FT cerevisiae, PR43_YEAST, pre-mRNA splicing factor RNA FT helicase prp43, (767 aa), fasta scores: opt: 3351, E():0, FT (69.8% identity in 731 aa)" FT /product="putative pre-mRNA splicing factor; RNA helicase; FT similar to S. cerevisiae PRP43" FT /fasta_file="fasta/c16H5.tab.seq.02884.out" FT misc_feature 2201319..2201597 FT /note="Match to PF00271 helicase_C, Helicases conserved C- FT terminal domain Score 22.18" FT CDS join(2203165..2203962,2204009..2204107,2204161..2204314, FT 2204359..2204426) FT /colour=7 FT /gene="SPBC16H5.09c" FT /label=SPBC16H5.09c FT /note="SPBC16H5.09c, len:372, FT SIMILARITY:Schizosaccharomyces pombe, O60160, 2-alpha- FT mannosyltransferase., (390 aa), fasta scores: opt: 1179, FT E():0, (45.7% identity in 385 aa)" FT /product="putative mannosyltransferase" FT /fasta_file="fasta/c16H5.tab.seq.02885.out" FT misc_feature 2203963..2203968 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2203995..2204008 FT /colour=6 FT /note="ctaactattgcaag, splice branch and acceptor" FT misc_feature 2204108..2204113 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 2204145..2204160 FT /colour=6 FT /note="ctaaaacaatttttag, splice branch and acceptor" FT misc_feature 2204315..2204320 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2204344..2204358 FT /colour=6 FT /note="ctgacaatttattag, splice branch and acceptor" FT CDS join(2204976..2205011,2205124..2206944) FT /colour=7 FT /gene="SPBC16H5.08c" FT /label=SPBC16H5.08c FT /note="SPBC16H5.08c, len:618, SIMILARITY:Saccharomyces FT cerevisiae, YEM6_YEAST, putative ATP-dependent transporter FT yer036c., (610 aa), fasta scores: opt: 2181, E():0, (54.3% FT identity in 611 aa)" FT /product="non transporter with ABC binding cassette" FT /fasta_file="fasta/c16H5.tab.seq.02886.out" FT misc_feature 2205012..2205017 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2205109..2205123 FT /colour=6 FT /note="ctaacaaatgtttag, splice branch and acceptor" FT misc_feature 2205388..2205957 FT /note="Match to PF00005 ABC_tran, ABC transporter Score FT 119.15" FT misc_feature 2206339..2206839 FT /note="Match to PF00005 ABC_tran, ABC transporter Score FT 114.56" FT CDS join(2207616..2207756,2208049..2208876) FT /EC_number="3.1.3.16" FT /colour=2 FT /gene="ppa2" FT /gene="SPBC16H5.07c" FT /label=ppa2 FT /note="SPBC16H5.07c, len:322" FT /product="major serine/threonine protein phosphatase pp2a- FT 2 catalytic subunit(ec 3.1.3.16)." FT /fasta_file="fasta/c16H5.tab.seq.02887.out" FT misc_feature 2207682..2207765 FT /note="Match to PF00149 STphosphatase, Ser/Thr protein FT phosphatase Score 23.07" FT misc_feature 2207757..2207762 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2208032..2208048 FT /colour=6 FT /note="ctaaccattttttctag, splice branch and acceptor" FT misc_feature 2208049..2208828 FT /note="Match to PF00149 STphosphatase, Ser/Thr protein FT phosphatase Score 641.77" FT CDS complement(2209971..2210657) FT /EC_number="1.10.2.2" FT /colour=2 FT /gene="rip1" FT /gene="SPBC16H5.06" FT /label=rip1 FT /note="SPBC16H5.06, len:228" FT /product="ubiquinol-cytochrome c reductase iron-sulpher FT subunit" FT /fasta_file="fasta/c16H5.tab.seq.02888.out" FT misc_feature complement(2210019..2210387) FT /note="Match to PF00355 Rieske, Rieske [2Fe-2S] domain FT Score 265.04" FT CDS complement(2211402..2211902) FT /colour=8 FT /gene="SPBC16H5.15" FT /label=SPBC16H5.15 FT /note="SPBC16H5.15 len:166" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c16H5.tab.seq.02889.out" FT CDS join(2212177..2212182,2212223..2212251,2212294..2212398, FT 2212489..2213740) FT /EC_number="5.2.1.8" FT /colour=2 FT /gene="cyp7" FT /gene="SPBC16H5.05c" FT /label=cyp7 FT /note="SPBC16H5.05c, len:463, SIMILARITY:Arabidopsis FT thaliana, O82646, hypothetical 57.1 kD protein, (510 aa), FT fasta scores: opt: 711, E():6.4e-33, (37.9% identity in FT 354 aa)" FT /product="cyclophilin-7; peptidyl-prolyl cis-trans FT isomerase; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c16H5.tab.seq.02890.out" FT misc_feature 2212183..2212188 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2212211..2212222 FT /colour=6 FT /note="ctaatctctcag, splice branch and acceptor" FT misc_feature 2212252..2212257 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2212282..2212293 FT /colour=6 FT /note="ctaacattatag, splice branch and acceptor" FT misc_feature join(2212322..2212398,2212489..2212852) FT /note="Match to PF00160 pro_isomerase, Cyclophilin type FT peptidyl-prolyl cis-trans isomerase Score 116.95" FT misc_feature 2212399..2212404 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2212475..2212488 FT /colour=6 FT /note="ctaattaaatacag, splice branch and acceptor" FT CDS complement(join(2213992..2214423,2214537..2214638, FT 2214686..2214724)) FT /colour=7 FT /gene="SPBC16H5.04" FT /label=SPBC16H5.04 FT /note="SPBC16H5.04, len:190, SIMILARITY:Saccharomyces FT cerevisiae, PH88_YEAST, inorganic phosphate transporter FT pho88., (188 aa), fasta scores: opt: 444, E():3e-24, FT (41.4% identity in 181 aa)" FT /product="putative regulator of inorganic phosphate FT transport; yeast pho88 homolog" FT /fasta_file="fasta/c16H5.tab.seq.02891.out" FT misc_feature complement(2214424..2214439) FT /colour=6 FT /note="ttaataaaatgggtag, splice branch and acceptor" FT misc_feature complement(2214531..2214536) FT /colour=6 FT /note="gtgaat, splice donor sequence" FT misc_feature complement(2214639..2214650) FT /colour=6 FT /note="ttaacatgatag, splice branch and acceptor" FT misc_feature complement(2214680..2214685) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT CDS join(2215630..2215710,2215752..2215832,2215923..2216981, FT 2217023..2217688) FT /colour=2 FT /gene="uba2" FT /gene="SPBC16H5.03c" FT /label=uba2 FT /note="SPBC16H5.03c, len:628, SIMILARITY:Saccharomyces FT cerevisiae, UBA2_YEAST, ubiquitin-activating enzyme e1- FT like, (636 aa), fasta scores: opt: 1238, E():0, (39.4% FT identity in 637 aa)" FT /product="ubiquitin-activating enzyme e1-like" FT /fasta_file="fasta/c16H5.tab.seq.02892.out" FT misc_feature 2215711..2215716 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2215737..2215751 FT /colour=6 FT /note="ttaacaattggtcag, splice branch and acceptor" FT misc_feature join(2215752..2215832,2215923..2216243) FT /note="Match to PF00899 ThiF_family, ThiF family Score FT 142.73" FT misc_feature 2215833..2215838 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2215905..2215922 FT /colour=6 FT /note="ttaactcttatactgtag, splice branch and acceptor" FT misc_feature 2216982..2216987 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2217010..2217022 FT /colour=6 FT /note="ctaacaatttaag, splice branch and acceptor" FT CDS complement(2218065..2220893) FT /EC_number="2.7.1.11" FT /colour=2 FT /gene="pfk1" FT /gene="SPBC16H5.02" FT /label=pfk1 FT /note="SPBC16H5.02, len:942, SIMILARITY:Saccharomyces FT cerevisiae, K6P2_YEAST, 6-phosphofructokinase beta subunit, FT (959 aa), fasta scores: opt: 2944, E():0, (48.9% FT identity in 963 aa)" FT /product="6-phosphofructokinase beta subunit; similar to FT S. cerevisiae PFK2" FT /fasta_file="fasta/c16H5.tab.seq.02893.out" FT misc_feature complement(2218278..2218400) FT /note="Match to PF00365 PFK, Phosphofructokinase Score FT 36.99" FT misc_feature complement(2218551..2218760) FT /note="Match to PF00365 PFK, Phosphofructokinase Score FT 28.43" FT misc_feature complement(2218929..2219111) FT /note="Match to PF00365 PFK, Phosphofructokinase Score FT 28.67" FT misc_feature complement(2219376..2220311) FT /note="Match to PF00365 PFK, Phosphofructokinase Score FT 628.61" FT misc_feature 2220894..2224781 FT /note="gene free region" FT misc_feature 2222899..2225373 FT /note="nominal overlap with cosmid SPBC12D12, EM:AL035085 FT S.pombe chromosome 2" FT misc_feature complement(2222899..2225373) FT /note="nominal overlap with cosmid SPBC16H5, EM:AL022104 FT S. pombe chromosome 2" FT misc_feature 2225519..2225557 FT /colour=8 FT /note="PS00018 EF-hand calcium-binding domain" FT CDS complement(2226357..2226839) FT /colour=2 FT /gene="cdm1" FT /gene="SPBC12D12.02c" FT /label=cdm1 FT /note="SPBC12D12.02c, len:160" FT /product="DNA polymerase delta subunit; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c12D12.tab.seq.00019.out" FT CDS join(2228035..2228065,2228114..2228161,2228200..2228285, FT 2228530..2230035) FT /colour=2 FT /gene="cct1" FT /gene="SPBC12D12.03" FT /label=cct1 FT /note="SPBC12D12.03, len:556, SIMILARITY:Saccharomyces FT cerevisiae, TCPA_YEAST, t-complex protein 1, alpha subunit, FT (559 aa), fasta scores: opt: 2750, E():0, (76.5% FT identity in 554 aa)" FT /product="t-complex protein 1, alpha subunit" FT /fasta_file="fasta/c12D12.tab.seq.03409.out" FT misc_feature 2228066..2228071 FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature 2228100..2228113 FT /colour=6 FT /note="ttaacatgttgtag, splice branch and acceptor" FT misc_feature 2228162..2228167 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2228188..2228199 FT /colour=6 FT /note="ttaacattttag, splice branch and acceptor" FT misc_feature join(2228217..2228285,2228530..2229996) FT /note="Match to PF00118 cpn60_TCP1, TCP-1/cpn60 chaperonin FT family Score 548.86" FT misc_feature 2228232..2228270 FT /colour=8 FT /note="PS00750 Chaperonins TCP-1 signature 1" FT misc_feature 2228286..2228291 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2228516..2228529 FT /colour=6 FT /note="ctaacttgtattag, splice branch and acceptor" FT misc_feature 2228539..2228589 FT /colour=8 FT /note="PS00751 Chaperonins TCP-1 signature 2" FT misc_feature 2228623..2228649 FT /colour=8 FT /note="PS00995 Chaperonins TCP-1 signature 3" FT CDS complement(2230386..2233436) FT /colour=2 FT /gene="pck2" FT /gene="sts6" FT /gene="pkc1" FT /gene="SPBC12D12.04c" FT /label=pck2 FT /note="SPBC12D12.04c, len:1016" FT /product="serine/threonine protein kinase; protein kinase FT c-like 2; subcellular localization of GFP fusion- cell FT periphary and septum" FT /fasta_file="fasta/c12D12.tab.seq.03410.out" FT misc_feature complement(2230413..2230610) FT /colour=9 FT /note="Pfam match to entry PF00433 pkinase_C, protein FT kinas e C terminal domain" FT misc_feature complement(2230416..2230610) FT /note="Match to PF00433 pkinase_C, protein kinase C FT terminal domain Score 134.96" FT misc_feature complement(2230611..2231390) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 276.30" FT misc_feature complement(2230989..2231027) FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT misc_feature complement(2231301..2231372) FT /colour=8 FT /note="PS00107 protein kinases ATP-binding region FT signature" FT misc_feature complement(2231868..2232017) FT /note="Match to PF00130 DAG_PE-bind, Phorbol FT esters/diacylglycerol binding domain (C1 domain) Score FT 83.43" FT misc_feature complement(2232078..2232221) FT /note="Match to PF00130 DAG_PE-bind, Phorbol FT esters/diacylglycerol binding domain (C1 domain) Score FT 88.72" FT CDS join(2234143..2234173,2234293..2234343,2234384..2234496, FT 2234539..2234654,2234703..2234815,2234876..2235075) FT /colour=7 FT /gene="SPAC12D12.09" FT /label=SPAC12D12.09 FT /note="SPAC12D12.09, len:207, SIMILARITY:Homo sapiens, FT Q9Y6I6, mad2-like protein., (211 aa), fasta scores: opt: FT 204, E():3.3e-07, (28.8% identity in 146 aa)" FT /product="mad2-like protein; putative mitotic checkpoint" FT /fasta_file="fasta/c12D12.tab.seq.03411.out" FT misc_feature 2234174..2234179 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2234281..2234292 FT /colour=6 FT /note="cttacaattcag, splice branch and acceptor" FT misc_feature 2234344..2234349 FT /colour=6 FT /note="gtattc, splice donor sequence" FT misc_feature 2234368..2234383 FT /colour=6 FT /note="ttaactctcatattag, splice branch and acceptor" FT misc_feature 2234497..2234502 FT /colour=6 FT /note="gtattc, splice donor sequence" FT misc_feature 2234523..2234538 FT /colour=6 FT /note="ctaactgctcgtctag, splice branch and acceptor" FT misc_feature 2234655..2234660 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 2234688..2234702 FT /colour=6 FT /note="ttaacaatattgtag, splice branch and acceptor" FT misc_feature 2234816..2234821 FT /colour=6 FT /note="gtatta, splice donor sequence" FT misc_feature 2234857..2234875 FT /colour=6 FT /note="ctaataatactgaaattag, splice branch and acceptor" FT misc_feature complement(2235057..2235062) FT /colour=6 FT /note="gtatat, splice donor sequence" FT CDS complement(join(2235268..2236386,2236424..2236585)) FT /colour=7 FT /gene="SPBC12D12.05c" FT /label=SPBC12D12.05c FT /note="final exon possibly incorrect; overlaps opposite FT strand prediction" FT /note="SPBC12D12.05c, len:426, SIMILARITY:Arabidopsis FT thaliana, CAB39683, putative mitochondrial carrier FT protein., (325 aa), fasta scores: opt: 476, E():1.6e-23, FT (28.0% identity in 296 aa)" FT /product="MC transporter of unknown specificity; graves FT disease carrier protein homolog" FT /fasta_file="fasta/c12D12.tab.seq.03412.out" FT misc_feature complement(2235280..2236158) FT /note="Match to PF00153 mito_carr, Mitochondrial carrier FT proteins Score 219.32" FT misc_feature complement(2235778..2235807) FT /colour=8 FT /note="PS00215 Mitochondrial energy transfer proteins FT signa ture" FT misc_feature complement(2236387..2236397) FT /colour=6 FT /note="ttaaccattag, splice branch and acceptor" FT misc_feature complement(2236418..2236423) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS join(2236767..2236798,2237211..2237290,2237369..2237735, FT 2237800..2238007) FT /colour=7 FT /gene="SPBC12D12.06" FT /label=SPBC12D12.06 FT /note="SPBC12D12.06, len:228, SIMILARITY:Saccharomyces FT cerevisiae, UME3_YEAST, RNA polymerase ii holoenzyme FT cyclin-like subunit., (323 aa), fasta scores: opt: 397, FT E():8.3e-21, (38.7% identity in 163 aa)" FT /product="Cyclin C homolog; putative component of RNA FT polymerase holoenzyme complex and Kornberg's mediator FT (SRB) subcomplex" FT /fasta_file="fasta/c12D12.tab.seq.03413.out" FT misc_feature 2236799..2236804 FT /colour=6 FT /note="gtaagg, splice donor sequence" FT misc_feature 2237199..2237210 FT /colour=6 FT /note="ctgaccttacag, splice branch and acceptor" FT misc_feature 2237291..2237296 FT /colour=6 FT /note="gtatat, splice donor sequence" FT misc_feature 2237354..2237368 FT /colour=6 FT /note="ctgatacaattctag, splice branch and acceptor" FT misc_feature 2237736..2237741 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2237781..2237799 FT /colour=6 FT /note="ctaacgatcgaggaaatag, splice branch and acceptor" FT CDS complement(join(2238583..2238850,2238933..2239030)) FT /colour=7 FT /gene="SPBC12D12.07c" FT /label=SPBC12D12.07c FT /note="SPBC12D12.07c, len:121, SIMILARITY:Saccharomyces FT cerevisiae, TRX2_YEAST, thioredoxin ii, (102 aa), fasta FT scores: opt: 326, E():1.2e-16, (42.4% identity in 99 aa)" FT /product="putative thioredoxin" FT /fasta_file="fasta/c12D12.tab.seq.03414.out" FT misc_feature complement(2238592..2238870) FT /note="Match to PF00085 thiored, Thioredoxin Score 89.27" FT misc_feature complement(2238778..2238834) FT /colour=8 FT /note="PS00194 Thioredoxin family active site" FT misc_feature complement(2238851..2238864) FT /colour=6 FT /note="ctaattgctactag, splice branch and acceptor" FT misc_feature complement(2238927..2238932) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT tRNA 2239891..2239962 FT /note="tRNA Pro anticodon AGG, Cove score 48.70" FT misc_feature complement(2240233..2240898) FT /note="nominal overlap with cosmid SPBC24C6, EM:AL031786 FT S. pombe chromosome 2" FT misc_feature complement(join(2240459..2240537,2240588..2240700)) FT /note="Match to PF00240 ubiquitin, Ubiquitin family Score FT 99.22" FT misc_feature complement(2240538..2240555) FT /colour=6 FT /note="ctaacaaacatcacgtag, splice branch and acceptor" FT misc_feature complement(2240582..2240587) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature complement(2240628..2240855) FT /colour=9 FT /note="Pfam match to entry PF00240 ubiquitin, Ubiquitin FT fam ily" FT misc_feature complement(2240701..2240716) FT /colour=6 FT /note="ctaaccaaaatataag, splice branch and acceptor" FT misc_feature complement(2240766..2240771) FT /colour=6 FT /note="gttcgt, splice donor sequence" FT misc_feature complement(2240790..2240806) FT /colour=6 FT /note="ctaatatataatcatag, splice branch and acceptor" FT misc_feature complement(2240832..2240837) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 2240233..2240898 FT /note="nominal overlap with cosmid SPBC12D12, EM:AL035085 FT S. pombe chromosome 2" FT misc_feature complement(join(2240459..2240537,2240588..2240700)) FT /note="Match to PF00240 ubiquitin, Ubiquitin family Score FT 99.22" FT misc_feature complement(2240538..2240555) FT /note="ctaacaaacatcacgtag, splice branch and acceptor" FT misc_feature complement(2240582..2240587) FT /note="gtaagc, splice donor sequence" FT misc_feature complement(2240701..2240716) FT /note="ctaaccaaaatataag, splice branch and acceptor" FT misc_feature complement(2240766..2240771) FT /note="gttcgt, splice donor sequence" FT misc_feature complement(2240790..2240806) FT /note="ctaatatataatcatag, splice branch and acceptor" FT misc_feature complement(2240832..2240837) FT /note="gtaaga, splice donor sequence" FT CDS join(2240982..2241016,2241146..2242931) FT /colour=7 FT /gene="SPBC24C6.02" FT /label=SPBC24C6.02 FT /note="SPBC24C6.02, len:606, SIMILARITY:Saccharomyces FT cerevisiae, SPB4_YEAST, ATP-dependent rRNA helicase spb4., FT (606 aa), fasta scores: opt: 1257, E():0, (38.1% identity FT in 580 aa)" FT /product="putative ATP-dependent RNA helicase" FT /fasta_file="fasta/c24C6.tab.seq.02944.out" FT misc_feature 2241017..2241022 FT /note="gtaagt, splice donor sequence" FT intron 2241017..2241145 FT /colour=2 FT /note="confirmed intron" FT misc_feature 2241132..2241145 FT /note="ctaacataaactag, splice branch and acceptor" FT misc_feature 2241180..2241866 FT /note="Pfam match to entry DEAD PF00270, DEAD and DEAH box FT helicases" FT misc_feature 2241243..2241266 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 2241921..2242172 FT /note="Pfam match to entry helicase_C PF00271, Helicases FT co nserved C-terminal domain" FT rRNA 2243304..2243450 FT /note="5s rRNA gene" FT CDS 2243623..2244900 FT /colour=7 FT /gene="SPBC24C6.03" FT /label=SPBC24C6.03 FT /note="SPBC24C6.03, len:425, SIMILARITY:Homo sapiens, FT CAB55948, hypothetical 45.7 kD protein, (409 aa), fasta FT scores: opt: 1084, E():0, (41.8% identity in 404 aa)" FT /product="putative prolyl-tRNA synthetase, cytoplasmic" FT /fasta_file="fasta/c24C6.tab.seq.02945.out" FT misc_feature 2243671..2244840 FT /colour=9 FT /note="Pfam match to entry PF00587 tRNA-synt_2b, tRNA FT synthetases class II (G, H, P and S), score -20.80, E- FT value 0.014" FT misc_feature 2244052..2244114 FT /note="PS00179 Aminoacyl-transfer RNA synthetases class-II FT signature 1" FT CDS 2245855..2247501 FT /colour=7 FT /gene="SPBC24C6.04" FT /label=SPBC24C6.04 FT /note="SPBC24C6.04, len:548, SIMILARITY:Agaricus bisporus, FT PUT2_AGABI, delta-1-pyrroline-5-carboxylate dehydrogenase , FT (546 aa), fasta scores: opt: 2044, E():0, (54.5% FT identity in 547 aa)" FT /product="putative delta-1-pyrroline-5-carboxylate FT dehydrogenase" FT /fasta_file="fasta/c24C6.tab.seq.02946.out" FT misc_feature 2246002..2247462 FT /note="Pfam match to entry aldedh PF00171, Aldehyde FT dehydro genases" FT misc_feature 2246743..2246766 FT /note="PS00687 Aldehyde dehydrogenases glutamic acid FT active site" FT misc_feature 2246827..2246862 FT /note="PS00070 Aldehyde dehydrogenases cysteine active FT site" FT CDS join(2248105..2248135,2248180..2249015) FT /colour=2 FT /gene="sec28" FT /gene="SPBC24C6.05" FT /label=sec28 FT /note="SPBC24C6.05, len:288, SIMILARITY:Bos taurus, FT COPE_BO VIN, coatomer epsilon subunit, (307 aa), fasta FT scores: opt: 230, E():2.7e-08, (25.0% identity in 296 aa)" FT /product="putative coatomer epsilon subunit" FT /fasta_file="fasta/c24C6.tab.seq.02947.out" FT misc_feature 2248136..2248141 FT /note="gtaaga, splice donor sequence" FT misc_feature 2248166..2248179 FT /note="ctaatatttgatag, splice branch and acceptor" FT CDS 2250937..2252160 FT /colour=2 FT /gene="gpa1" FT /gene="SPBC24C6.06" FT /label=gpa1 FT /note="SPBC24C6.06, len:407" FT /product="guanine nucleotide-binding protein alpha-1 FT subunit; required for mating and sporulation; similar to FT S. cerevisiae GPA1" FT /fasta_file="fasta/c24C6.tab.seq.02948.out" FT misc_feature 2251162..2252157 FT /note="Pfam match to entry G-alpha PF00503, G-protein FT alpha subunit" FT misc_feature 2251174..2251260 FT /note="PS00107 protein kinases ATP-binding region FT signature" FT misc_feature 2251177..2251200 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS 2252869..2253591 FT /colour=2 FT /gene="cdc14" FT /gene="SPBC24C6.07" FT /label=cdc14 FT /note="SPBC24C6.07, len:240" FT /product="cell division control protein; involved in FT septum formation; essential; no apparent orthologs" FT /fasta_file="fasta/c24C6.tab.seq.00051.out" FT intron complement(2253680..2253778) FT /colour=7 FT /note="putative intron which would give small N-terminal FT exon" FT CDS complement(2253773..2254876) FT /colour=8 FT /gene="SPBC24C6.08c" FT /label=SPBC24C6.08c FT /note="SPBC24C6.08c, len:367" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c24C6.tab.seq.02950.out" FT CDS complement(2255861..2258338) FT /EC_number="4.1.2.9" FT /colour=7 FT /gene="SPBC24C6.09c" FT /label=SPBC24C6.09c FT /note="SPBC24C6.09c, len:825, SIMILARITY:Synechocystis sp., FT P74690, hypothetical 92.4 kD protein., (821 aa), fasta FT scores: opt: 1195, E():0, (39.0% identity in 777 aa)" FT /product="similar to transketolase; Pfam-B_53149; Pfam- FT B_17168; high similar to Synechocystis Sp SW:P74690; FT putative phosphotransacetylase; bacterial enzyme splits FT fructose-6-P and/or xylulose-5-P with the aid of inorganic FT phosphate into either acetyl-P and erythrose-4-P and/or FT acetyl-P and glyeraldehyde-3-P; no apparent S. cerevisiae FT ortholog" FT /fasta_file="fasta/c24C6.tab.seq.02951.out" FT misc_feature complement(2258339..2262409) FT /note="low complexity gene-free region" FT LTR complement(2260544..2260896) FT /note="Tf1 type LTR" FT CDS complement(join(2262410..2263389,2263510..2263599, FT 2263695..2263749)) FT /colour=10 FT /gene="SPBC24C6.10c" FT /label=SPBC24C6.10c FT /note="SPBC24C6.10c, len:313, SIMILARITY:Saccharomyces FT cerevisiae, Q12342, orf ydl146w., (491 aa), fasta scores: FT opt: 294, E():1.7e-13, (25.9% identity in 417 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YDL146W" FT /fasta_file="fasta/c24C6.tab.seq.02952.out" FT misc_feature complement(2263390..2263410) FT /colour=6 FT /note="ctaacaaaataaattcaatag, splice branch and acceptor" FT misc_feature complement(2263504..2263509) FT /colour=6 FT /note="gtaatg, splice donor sequence" FT misc_feature complement(2263600..2263616) FT /colour=6 FT /note="ctaacatttggtgacag, splice branch and acceptor" FT misc_feature complement(2263689..2263694) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature join(2264303..2264334,2264405..2264784,2264829..2264848) FT /note="Match to PF01125 G10, G10 protein Score 269.92" FT CDS join(2264303..2264334,2264405..2264784,2264829..2264857) FT /colour=7 FT /gene="SPBC24C6.11" FT /label=SPBC24C6.11 FT /note="SPBC24C6.11, len:146, SIMILARITY:Drosophila FT melanogaster, O97454, l(1)10bb., (144 aa), fasta scores: FT opt: 641, E():0, (60.4% identity in 144 aa)" FT /product="G10 protein; similar to S. cerevisiae BUD31" FT /fasta_file="fasta/c24C6.tab.seq.02953.out" FT misc_feature 2264335..2264340 FT /note="gtatgt, splice donor sequence" FT misc_feature 2264391..2264404 FT /note="ctaattagctatag, splice branch and acceptor" FT misc_feature 2264785..2264790 FT /note="gtaagt, splice donor sequence" FT misc_feature 2264816..2264828 FT /note="ctaatgaaaatag, splice branch and acceptor" FT misc_feature complement(2265308..2265958) FT /note="Match to PF00488 MutS_C, DNA mismatch repair FT proteins, mutS family Score 436.23" FT misc_feature complement(2266073..2266159) FT /note="Match to PF00488 MutS_C, DNA mismatch repair FT proteins, mutS family Score 31.38" FT misc_feature complement(2266258..2266361) FT /note="nominal overlap with cosmid SPBC19G7, EM:AL021839 FT S.pombe chromosome 2" FT misc_feature 2266258..2266361 FT /note="nominal overlap with cosmid SPBC24C6, EM:AL031786 FT S. pombe chromosome 2" FT misc_feature complement(2267891..2267907) FT /colour=6 FT /note="ctaacactgttttctag, splice branch and acceptor" FT misc_feature complement(2267979..2267984) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(2268068..2268084) FT /colour=6 FT /note="ctaatattttaaaacag, splice branch and acceptor" FT misc_feature complement(2268105..2268110) FT /colour=6 FT /note="gtttgt, splice donor sequence" FT CDS join(2268883..2269056,2269104..2269410,2269497..2269711) FT /colour=7 FT /gene="SPBC19G7.02" FT /label=SPBC19G7.02 FT /note="SPBC19G7.02, len:231, SIMILARITY:Aquifex aeolicus., FT O67538, aminodeoxychorismate lyase., (245 aa), fasta FT scores: opt: 241, E():2.1e-09, (26.6% identity in 207 aa)" FT /product="putative branched chain amino acid FT aminotranferase" FT /fasta_file="fasta/c19G7.tab.seq.02747.out" FT misc_feature 2269057..2269062 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2269086..2269103 FT /colour=6 FT /note="ttgatctaaacataatag, splice branch and acceptor" FT misc_feature 2269411..2269416 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2269479..2269496 FT /colour=6 FT /note="ttaacctcctttatacag, splice branch and acceptor" FT CDS complement(join(2269677..2269694,2269818..2269946, FT 2269996..2270034)) FT /colour=2 FT /gene="rps30-2" FT /gene="SPBC19G7.03c" FT /gene="ysprs30" FT /label=rps30-2 FT /note="SPBC19G7.03c, len:61" FT /product="40S ribosomal protein S30" FT /fasta_file="fasta/c19G7.tab.seq.02748.out" FT intron complement(2269695..2269817) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(2269947..2269961) FT /colour=6 FT /note="ttaacattttgtcag, splice branch and acceptor" FT intron complement(2269947..2269995) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(2269990..2269995) FT /colour=6 FT /note="gtgtgt, splice donor sequence" FT promoter complement(2270102..2270109) FT /colour=4 FT /note="Homol D box" FT CDS join(2270192..2270253,2270296..2270943,2270987..2271365) FT /colour=10 FT /gene="SPBC19G7.04" FT /label=SPBC19G7.04 FT /note="SPBC19G7.04, len:231, SIMILARITY:C. elegans, Q23462, FT COSMID ZK328, (467 aa), fasta scores, opt: 269, ,E(): FT 5.7e-10, (26.8% identity in 370 aa overlap)" FT /product="conserved protein; putative transcriptional FT regulator; may contain HMG box" FT /fasta_file="fasta/c19G7.tab.seq.02749.out" FT misc_feature 2270254..2270259 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 2270282..2270295 FT /colour=6 FT /note="ataacaatatttag, splice branch and acceptor sequence" FT /note="NON CONSENSUS BRANCH SITE" FT misc_feature 2270944..2270949 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 2270974..2270986 FT /colour=6 FT /note="ctaacctattaag, splice branch and acceptor" FT CDS complement(2271653..2276842) FT /EC_number="2.4.1.34" FT /colour=2 FT /gene="cps1" FT /gene="drc1" FT /gene="bgs1" FT /gene="SPBC19G7.05c" FT /label=cps1 FT /note="SPBC19G7.05c, len:1729" FT /product="putative division septum; 1,3-beta-glucan FT synthase subunit; cell wall synthesis" FT /fasta_file="fasta/c19G7.tab.seq.02750.out" FT CDS join(2280028..2280078,2280146..2280292,2280444..2280527, FT 2280663..2281691) FT /colour=7 FT /gene="SPBC19G7.06" FT /label=SPBC19G7.06 FT /note="SPBC19G7.06, len:436, SIMILARITY:Halocynthia FT roretzi, Q25126, as-mef2., (337 aa), fasta scores: opt: FT 241, E():9.6e-07, (27.2% identity in 298 aa)" FT /product="MAD box transcription factor" FT /fasta_file="fasta/c19G7.tab.seq.02751.out" FT misc_feature 2280079..2280084 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2280130..2280145 FT /colour=6 FT /note="ctaacgtaccatttag, splice branch and acceptor" FT misc_feature 2280146..2280289 FT /note="Match to PF00319 SRF-TF, SRF-type transcription FT factor (DNA-binding and dimerisation domain) Score 72.99" FT misc_feature 2280293..2280298 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2280425..2280443 FT /colour=6 FT /note="ttaacatacacctctttag, splice branch and acceptor" FT misc_feature 2280528..2280533 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2280652..2280662 FT /colour=6 FT /note="ctaaagataag, splice branch and acceptor" FT CDS complement(join(2281794..2283602,2283685..2283939)) FT /colour=10 FT /gene="SPBC19G7.07c" FT /label=SPBC19G7.07c FT /note="SPBC19G7.07c, len:687aa, low similarity eg. to FT YG3M_YEAST, P48237, hypothetical protein (864aa), fast a FT scores opt:202, E():1.6e-06, (21.0% identity in 624 aa ov FT erlap)" FT /product="hypothetical protein; similar to S. cerevisiae FT YGR150C; contains 2 PPR domains" FT /fasta_file="fasta/c19G7.tab.seq.02752.out" FT misc_feature complement(2283603..2283617) FT /colour=6 FT /note="ctaacgttagcatag, splice branch and acceptor" FT misc_feature complement(2283679..2283684) FT /colour=6 FT /note="gtaaaa, splice donor sequence" FT CDS complement(2284878..2286329) FT /colour=8 FT /gene="SPBC19G7.08c" FT /label=SPBC19G7.08c FT /note="SPBC19G7.08c, len:483aa" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c19G7.tab.seq.02753.out" FT CDS 2287716..2289422 FT /colour=2 FT /gene="ulp1" FT /gene="SPBC19G7.09" FT /label=ulp1 FT /note="SPBC19G7.09, len:568, SIMILARITY:(restricted to c- FT term)Caenorhabditis elegans., YRW3_CAEEL, hypothetical FT 75.7 kD protein t10f2.3 in chromosome iii., (662 aa), FT fasta scores: opt: 509, E():6.1e-24, (27.6% identity in FT 478 aa)" FT /product="Pmt3 (SUMO)-specific protease (PMID: 11884512); FT deconjugating enzyme; component of the SUMO modification FT process (PMID: 11884512); not essential for cell viability FT (PMID: 11884512); required for normal nuclear morphology FT (PMID: 11884512); possibly required for normal cell cycle FT progression (PMID: 11884512); subcellular localization FT nuclear periphery -S and G2 phases (PMID: 11884512); FT subcellular localization nuclear -anaphase (PMID: FT 11884512)" FT /fasta_file="fasta/c19G7.tab.seq.02754.out" FT intron 2287814..2287927 FT /colour=7 FT /note="Intron predicted by HMM_intron, Score=7.99 - FT pputative inframe splice" FT CDS complement(join(2289663..2289759,2289845..2290015, FT 2290054..2291842,2291950..2292050,2292106..2292182)) FT /colour=7 FT /gene="SPBC19G7.10c" FT /label=SPBC19G7.10c FT /note="SPBC19G7.10c, len:744, SIMILARITY:Saccharomyces FT cerevisiae, PAT1_YEAST, topoisomerase ii-associated FT protein pat1., (797 aa), fasta scores: opt: 299, E():2e-09, FT (27.5% identity in 799 aa)" FT /product="topoisomerase associated yeast pat1 homolog" FT /fasta_file="fasta/c19G7.tab.seq.02755.out" FT misc_feature complement(2289760..2289778) FT /colour=6 FT /note="ttgataacatcattactag, splice branch and acceptor" FT misc_feature complement(2289839..2289844) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(2290016..2290027) FT /colour=6 FT /note="ctaactatttag, splice branch and acceptor" FT misc_feature complement(2290048..2290053) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(2291843..2291855) FT /colour=6 FT /note="ctcacaattctag, splice branch and accepto r" FT misc_feature complement(2291944..2291949) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(2292051..2292067) FT /colour=6 FT /note="ctcacaagtatatttag, splice branch and acceptor" FT misc_feature complement(2292100..2292105) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS complement(2292671..2293099) FT /colour=9 FT /gene="SPBC19G7.11c" FT /label=SPBC19G7.11c FT /note="SPBC19G7.11c, questionable ORF see also FT SPBC19G7.11c ; len:142aa" FT /product="very hypothetical protein" FT /fasta_file="fasta/c19G7.tab.seq.02756.out" FT CDS complement(2292757..2293218) FT /colour=8 FT /gene="SPBC19G7.12c" FT /label=SPBC19G7.12c FT /note="SPBC19G7.12c, unknown (questionable ORF), see also FT S PBC19G7.10c, len:153aa" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c19G7.tab.seq.02757.out" FT CDS 2294773..2296230 FT /colour=7 FT /gene="SPBC19G7.13" FT /label=SPBC19G7.13 FT /note="SPBC19G7.13, len:485, SIMILARITY:Saccharomyces FT cerevisiae, TBF1_YEAST, tbf1 protein, (562 aa), fasta FT scores: opt: 342, E():7.7e-15, (30.0% identity in 454 aa)" FT /product="Myb family DNA-binding protein; putative FT telomere length regulator" FT /fasta_file="fasta/c19G7.tab.seq.02758.out" FT misc_feature 2295994..2296020 FT /colour=8 FT /note="PS00037 Myb DNA-binding domain repeat signature 1" FT CDS complement(join(2296339..2297046,2297087..2297159, FT 2297209..2297663)) FT /colour=8 FT /gene="SPBC19G7.14c" FT /label=SPBC19G7.14c FT /note="SPBC19G7.14c, len:411, SIMILARITY:Dictyostelium FT discoideum, MYSJ_DICDI, myosin ij heavy chain., (2245 aa), FT fasta scores: opt: 124, E():2.3, (21.8% identity in 262 FT aa)" FT /product="hypothetical protein; sequence orphan; predicted FT coiled-coil region" FT /fasta_file="fasta/c19G7.tab.seq.02759.out" FT misc_feature complement(2297047..2297059) FT /colour=6 FT /note="ctaattattgtag, splice branch and acceptor" FT misc_feature complement(2297081..2297086) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(2297160..2297173) FT /colour=6 FT /note="ctaacaaattcaag, splice branch and acceptor" FT misc_feature complement(2297203..2297208) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT CDS join(2298634..2298649,2298694..2299889) FT /colour=7 FT /gene="SPBC19G7.15" FT /label=SPBC19G7.15 FT /note="SPBC19G7.15, len:403, SIMILARITY:Saccharomyces FT cerevisiae, NU57_YEAST, nucleoporin nup57, (541 aa), fasta FT scores: opt: 547, E():2.8e-22, (28.2% identity in 394 aa)" FT /product="putative nuclear pore protein" FT /fasta_file="fasta/c19G7.tab.seq.02760.out" FT misc_feature 2298650..2298655 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 2298681..2298693 FT /colour=6 FT /note="ctaacgactgtag, splice branch and acceptor" FT misc_feature 2298864..2298887 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT LTR 2300760..2301107 FT /colour=4 FT /note="tf2 type ltr" FT CDS 2301262..2302548 FT /colour=10 FT /gene="SPBC19G7.16" FT /label=SPBC19G7.16 FT /note="SPBC19G7.16, len:428, SIMILARITY:Saccharomyces FT cerevisiae, Q06505, chromosome xvi cosmid 9659., (410 aa), FT fasta scores: opt: 627, E():6.8e-29, (32.8% identity in FT 390 aa)" FT /product="conserved protein; predicted coiled-coil region" FT /fasta_file="fasta/c19G7.tab.seq.02761.out" FT misc_feature 2303074..2303079 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2303108..2303124 FT /colour=6 FT /note="ctaatgtccttatttag, splice branch and acceptor" FT misc_feature 2303193..2303198 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 2303248..2303261 FT /colour=6 FT /note="ctgatatatcgtag, splice branch and acceptor" FT misc_feature 2303375..2303380 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2303406..2303418 FT /colour=6 FT /note="ctaatcaaaaaag, splice branch and acceptor" FT misc_feature 2303452..2303457 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2303612..2303626 FT /colour=6 FT /note="ctaattaactttcag, splice branch and acceptor" FT misc_feature 2303761..2303766 FT /colour=6 FT /note="gttcgg, splice donor sequence" FT misc_feature 2303790..2303806 FT /colour=6 FT /note="ctaacgtctcttaatag, splice branch and acceptor" FT misc_feature 2303864..2303984 FT /note="nominal overlap with SPBC19G7 S. pombe chromosome 2" FT CDS 2306038..2307099 FT /colour=10 FT /gene="SPBC36B7.02" FT /label=SPBC36B7.02 FT /note="SPBC36B7.02, len:354, FT SIMILARITY:Schizosaccharomyces pombe, YC9B_SCHPO, FT hypothetical 43.0 kDa protein c584.11c in chromosome iii., FT (380 aa), fasta scores: opt: 199, E():6.2e-06, (21.9% FT identity in 338 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YDR346C; similar to SPCC584.11 (paralog); low similarity FT to NIFD/NIFK/NIFE/NIFN family" FT /fasta_file="fasta/c36B7.tab.seq.00021.out" FT CDS join(2307692..2307806,2307857..2307947,2308008..2309637) FT /colour=7 FT /gene="SPBC36B7.03" FT /label=SPBC36B7.03 FT /note="SPBC36B7.03, len:612, SIMILARITY:Saccharomyces FT cerevisiae, NPL1_YEAST, npl1 protein, (663 aa), fasta FT scores: opt: 699, E():0, (27.0% identity in 673 aa)" FT /product="putative component of ER protein-translocation FT subcomplex; DNAJ domain protein" FT /fasta_file="fasta/c36B7.tab.seq.04315.out" FT misc_feature 2307807..2307812 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2307837..2307856 FT /colour=6 FT /note="ctaatatggtgaatttttag, splice branch and acceptor" FT misc_feature 2307948..2307953 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 2307989..2308007 FT /colour=6 FT /note="ttaatttttattattatag, splice branch and acceptor" FT misc_feature 2308093..2308305 FT /note="Match to PF00226 DnaJ, DnaJ domain Score 69.44" FT CDS 2310266..2311465 FT /colour=10 FT /gene="SPBC36B7.04" FT /label=SPBC36B7.04 FT /note="SPBC36B7.04, len:400, SIMILARITY:Saccharomyces FT cerevisiae, YMI0_YEAST, hypothetical 48.1 kDa protein in FT tub1-cpr3 intergenic region., (423 aa), fasta scores: opt: FT 1303, E():0, (50.5% identity in 400 aa)" FT /product=" weak similarity to Azospirillum brasilense FT nifR3 protein; similar to S. cerevisiae YML080W; UPF0034 FT family" FT /fasta_file="fasta/c36B7.tab.seq.04316.out" FT misc_feature 2310326..2311213 FT /note="Match to PF01207 UPF0034, Uncharacterized protein FT family UPF0034 Score 248.68" FT CDS complement(2311857..2312696) FT /colour=7 FT /gene="SPBC36B7.05c" FT /label=SPBC36B7.05c FT /note="SPBC36B7.05c, len:280, SIMILARITY:Saccharomyces FT cerevisiae, Q06651, similar to proteins involved in FT vacuolar function: s.cerevisiae vac1p., (286 aa), fasta FT scores: opt: 370, E():3e-17, (26.9% identity in 260 aa)" FT /product="putative Phosphatidylinositol(3)-phosphate FT binding protein; contains FYVE zinc finger" FT /fasta_file="fasta/c36B7.tab.seq.04317.out" FT misc_feature complement(2312328..2312627) FT /note="Match to PF01363 FYVE, FYVE zinc finger Score 77.36" FT CDS complement(join(2313150..2313525,2313569..2313702)) FT /colour=8 FT /gene="SPBC36B7.06c" FT /label=SPBC36B7.06c FT /note="SPBC36B7.06c, len:170" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c36B7.tab.seq.04318.out" FT misc_feature complement(2313526..2313542) FT /colour=6 FT /note="ttgacccaacaattcag, splice branch and acceptor" FT misc_feature complement(2313563..2313568) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT CDS join(2314273..2314301,2314393..2315041) FT /colour=2 FT /gene="tlg1" FT /gene="SPBC36B7.07" FT /label=tlg1 FT /note="SPBC36B7.07, len:226, SIMILARITY:Saccharomyces FT cerevisiae, Q03322, d8035.11p., (224 aa), fasta scores: FT opt: 349, E():1.4e-14, (30.0% identity in 230 aa)" FT /product="putative syntaxin (t-SNARE)" FT /fasta_file="fasta/c36B7.tab.seq.04319.out" FT misc_feature 2314302..2314307 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2314371..2314392 FT /colour=6 FT /note="ctgacatttattcgaaatatag, splice branch and acceptor" FT CDS complement(join(2315174..2315208,2315302..2315817, FT 2315887..2315997,2316088..2316160)) FT /colour=7 FT /gene="SPBC36B7.08c" FT /label=SPBC36B7.08c FT /note="SPBC36B7.08c, len:245, SIMILARITY:Arabidopsis FT thaliana, AAF27100, f6a14.10 protein., (255 aa), fasta FT scores: opt: 287, E():1.9e-09, (30.2% identity in 242 aa)" FT /product="putative chromatin decondensation protein FT (template activating factor); nuclosome assembly factor; FT similar to Human oncoprotein SET (TAF1beta)" FT /fasta_file="fasta/c36B7.tab.seq.04320.out" FT misc_feature complement(2315209..2315226) FT /colour=6 FT /note="ctaacacaaaaatcgcag, splice branch and acceptor" FT intron complement(2315209..2315301) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(2315296..2315301) FT /colour=6 FT /note="gtacga, splice donor sequence" FT misc_feature complement(2315818..2315835) FT /colour=6 FT /note="ctaattaagttatttcag, splice branch and acceptor" FT intron complement(2315818..2315886) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(2315881..2315886) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(2315998..2316017) FT /colour=6 FT /note="ctaatgtatcttggtgctag, splice branch and acceptor" FT misc_feature complement(2316082..2316087) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2317391..2317396 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 2317422..2317439 FT /colour=6 FT /note="ctaacaatggtatcttag, splice branch and acceptor" FT misc_feature 2318172..2318843 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 47.56" FT misc_feature 2318988..2319176 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 61.80" FT misc_feature 2319492..2319893 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 145.05" FT misc_feature 2319786..2320032 FT /note="nominal overlap SPBC36B7 S. pombe chromosome 2" FT misc_feature 2319789..2320070 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 45.60" FT CDS join(2322352..2322836,2322874..2323993) FT /colour=7 FT /gene="SPBP18G5.02" FT /label=SPBP18G5.02 FT /note="SPBP18G5.02, len:542, SIMILARITY:Neurospora crassa., FT Q9P713, putative pel1, (499 aa), fasta scores: opt: 679, FT E():0, (38.9% identity in 499 aa)" FT /product="putative Phosphatidylglycerophosphate synthase; FT the first enzyme of the cardiolipin biosynthetic pathway" FT /fasta_file="fasta/p18G5.tab.seq.04342.out" FT misc_feature 2322837..2322842 FT /colour=6 FT /note="gtaaag, splice donor sequence" FT misc_feature 2322863..2322873 FT /colour=6 FT /note="ctaacgaatag, splice branch and acceptor" FT CDS join(2324180..2324302,2324345..2325514) FT /colour=8 FT /gene="SPBP18G5.03" FT /label=SPBP18G5.03 FT /note="SPBP18G5.03, len:431, FT SIMILARITY:Schizosaccharomyces pombe, O94294, leucine-rich FT repeat protein - weak similarity to adenylate cyclase., FT (886 aa), fasta scores: opt: 147, E():0.25, (20.0% FT identity in 410 aa)" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/p18G5.tab.seq.04343.out" FT misc_feature 2324303..2324308 FT /colour=6 FT /note="gtacgc, splice donor sequence" FT misc_feature 2324333..2324344 FT /colour=6 FT /note="ctaattcaatag, splice branch and acceptor" FT misc_feature 2325687..2325885 FT /note="nominal overlap with SPBC29C10 S. pombe chromosome FT 2" FT misc_feature complement(join(2326124..2326220,2326352..2326470)) FT /note="Match to PF01247 Ribosomal_L35Ae, Ribosomal protein FT L35Ae Score 105.44" FT misc_feature complement(2326221..2326235) FT /colour=6 FT /note="ctaattacgttttag, splice branch and acceptor" FT intron complement(2326221..2326351) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(2326346..2326351) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2326373..2326473 FT /note="nominal overlap with cosmid SPBC1921 AL122033 FT S.pombe chromosome II" FT misc_feature complement(2326375..2326539) FT /note="Match to PF01247 Ribosomal_L35Ae, Ribosomal protein FT L35Ae Score 51.68" FT misc_feature complement(2326381..2326539) FT /colour=9 FT /note="Pfam match to entry PF01247 Ribosomal_L35Ae, FT Ribosomal protein L35Ae," FT CDS join(2327431..2327533,2327584..2328701) FT /colour=8 FT /gene="SPBC1921.02" FT /label=SPBC1921.02 FT /note="SPBC1921.02, len:406" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c1921.tab.seq.04049.out" FT misc_feature 2327534..2327539 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2327569..2327583 FT /colour=6 FT /note="cttacaacattctag, splice branch and acceptor" FT CDS complement(2328903..2330693) FT /colour=2 FT /gene="mex67" FT /gene="SPBC1921.03c" FT /label=mex67 FT /note="SPBC1921.03c, len:596" FT /product="mRNA export factor; subcellular localization of FT GFP fusion- putative nucleolus and nucleus" FT /fasta_file="fasta/c1921.tab.seq.04050.out" FT CDS complement(2331650..2332003) FT /colour=9 FT /gene="SPBC1921.04c" FT /label=SPBC1921.04c FT /note="SPBC1921.04c, len:117" FT /product="very hypothetical protein" FT /fasta_file="fasta/c1921.tab.seq.04051.out" FT CDS 2334106..2336754 FT /colour=2 FT /gene="ape1" FT /gene="SPBC1921.05" FT /label=ape1 FT /note="SPBC1921.05, len:882, SIMILARITY:Saccharomyces FT cerevisiae, APE2_YEAST, aminopeptidase ii, (844 aa), fasta FT scores: opt: 1925, E():0, (49.1% identity in 856 aa)" FT /product="aminopeptidase I" FT /fasta_file="fasta/c1921.tab.seq.04052.out" FT misc_feature 2334163..2335320 FT /note="Match to PF01433 Peptidase_M1, Peptidase family M1 FT Score 626.52" FT CDS complement(2337765..2338901) FT /colour=8 FT /gene="SPBC1921.06c" FT /label=SPBC1921.06c FT /note="SPBC1921.06c, len:378" FT /product="hypothetical protein; sequence orphan; contains FT predicted N-terminal signal sequence" FT /fasta_file="fasta/c1921.tab.seq.04053.out" FT misc_feature complement(2340014..2340197) FT /note="nominal overlap with cosmid SPBC21D10, EM:AL031536 FT S. pombe chromosome 2" FT misc_feature complement(2340031..2340045) FT /colour=6 FT /note="ttaacaaaaccatag, splice branch and acceptor" FT misc_feature complement(2340126..2340131) FT /colour=6 FT /note="gtgagt, splice donor sequence" FT misc_feature 2340014..2340197 FT /note="nominal overlap with cosmid SPBC1921, EM:AL122033 FT S. pombe chromosome 2" FT misc_feature complement(2340031..2340045) FT /colour=6 FT /note="ttaacaaaaccatag, splice branch and acceptor" FT misc_feature complement(2340126..2340131) FT /colour=6 FT /note="gtgagt, splice donor sequence" FT CDS complement(join(2341389..2341457,2341526..2342857)) FT /colour=2 FT /gene="hob1" FT /gene="SPBC21D10.12" FT /label=hob1 FT /note="SPBC21D10.12, len:465, SIMILARITY:Saccharomyces FT cerevisiae, R167_YEAST, reduced viability upon starvation FT protein 167., (482 aa), fasta scores: opt: 1078, E():0, FT (46.4% identity in 489 aa)" FT /product="cell cycle regulation protein; SH3 domain FT protein" FT /fasta_file="fasta/c21D10.tab.seq.03248.out" FT misc_feature complement(join(2341392..2341457,2341526..2341624)) FT /note="Match to PF00018 SH3, Src homology domain 3 Score FT 55.71" FT misc_feature complement(2341458..2341473) FT /colour=6 FT /note="ctaatatatattttag, splice branch and acceptor" FT misc_feature complement(2341520..2341525) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS 2343368..2344864 FT /colour=7 FT /gene="SPBC21D10.11c" FT /label=SPBC21D10.11c FT /note="SPBC21D10.11c, len:497, SIMILARITY:Candida albicans, FT SPL1_CANAL, tRNA splicing protein spl1., (488 aa), fasta FT scores: opt: 2027, E():0, (70.8% identity in 428 aa)" FT /product="putative cysteine desulpherase; mitochondrial; FT catalyses the removal of cysteine to produce alanine; FT probably supplies inorganic sulpher for iron sulpher FT clusters" FT /fasta_file="fasta/c21D10.tab.seq.03249.out" FT misc_feature 2343707..2344753 FT /note="Match to PF00266 aminotran_5, Aminotransferases FT class-V Score 436.32" FT CDS complement(2345173..2346072) FT /colour=7 FT /gene="SPBC21D10.10" FT /label=SPBC21D10.10 FT /note="SPBC21D10.10, len:298, FT SIMILARITY:Schizosaccharomyces pombe, CAB40169, putative FT transcription factor , yeast bdf1-like., (578 aa), fasta FT scores: opt: 212, E():0.00013, (24.5% identity in 269 aa)" FT /product="bromodomain protein" FT /fasta_file="fasta/c21D10.tab.seq.03250.out" FT misc_feature complement(2345278..2345448) FT /note="Match to PF00439 bromodomain, Bromodomain Score FT 31.30" FT LTR 2346570..2346935 FT /colour=4 FT /note="tf2 type LTR" FT CDS join(2347166..2347194,2347384..2352187) FT /colour=10 FT /gene="SPBC21D10.09c" FT /label=SPBC21D10.09c FT /note="SPBC21D10.09c, len:1609, SIMILARITY:Saccharomyces FT cerevisiae, YM81_YEAST, hypothetical 180.2 kD protein, FT (1562 aa), fasta scores: opt: 753, E():0, (23.5% identity FT in 1661 aa)" FT /product="zinc finger protein; zf-C3HC4 type (RING finger)" FT /fasta_file="fasta/c21D10.tab.seq.03251.out" FT misc_feature 2347195..2347200 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2347369..2347383 FT /colour=6 FT /note="ctaatctctttatag, splice branch and acceptor" FT misc_feature 2352026..2352163 FT /note="Match to PF00097 zf-C3HC4, zinc finger, C3HC4 type FT (RING finger) Score 34.30" FT CDS join(2352741..2352826,2352877..2353624) FT /colour=8 FT /gene="SPBC21D10.08c" FT /label=SPBC21D10.08c FT /note="SPBC21D10.08c, len:276, SIMILARITY:Borrelia FT burgdorferi, O50665, hypothetical 27.2 kD protein., (236 FT aa), fasta scores: opt: 110, E():2.1, (26.3% identity in FT 160 aa)" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c21D10.tab.seq.03252.out" FT misc_feature 2352827..2352832 FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature 2352864..2352876 FT /colour=6 FT /note="ctaacctgcaaag, splice branch and acceptor" FT CDS complement(join(2353709..2353879,2353938..2354081)) FT /colour=10 FT /gene="SPBC21D10.07" FT /label=SPBC21D10.07 FT /note="SPBC21D10.07, len:104" FT /product="hypothetical protein; similar to S. cerevisiae FT YBL059C-A" FT /fasta_file="fasta/c21D10.tab.seq.03253.out" FT misc_feature complement(2353880..2353901) FT /colour=6 FT /note="ttaacgaaattatgaaataaag, splice branch and acceptor" FT misc_feature complement(2353932..2353937) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(2354464..2354768) FT /note="identity to dbj|AU012621|AU012621 FT Schizosaccharomyce s pombe cDNA, clone spc07050 but no FT gene predicted in this region - putative RNA" FT tRNA complement(2354902..2354973) FT /note="tRNA Met anticodon CAT" FT CDS 2356235..2359081 FT /colour=12 FT /gene="SPBC21D10.06c" FT /label=SPBC21D10.06c FT /note="SPBC21D10.06c, len:947, FT SIMILARITY:Schizosaccharomyces pombe, CAB38695, FT hypothetical 129.5 kD protein., (1283 aa), fasta scores: FT opt: 699, E():1.6e-26, (28.7% identity in 857 aa)" FT /product="hypothetical protein; serine/threonine-rich FT protein; sequence orphan; predicted N-terminal signal FT sequence; low similar to glucoamylases and other cell FT surface glycoproteins; possibly S. pombe specific" FT /fasta_file="fasta/c21D10.tab.seq.03254.out" FT CDS join(2359721..2359835,2359879..2359985,2360055..2360149, FT 2360245..2361733) FT /colour=7 FT /gene="SPBC21D10.05c" FT /label=SPBC21D10.05c FT /note="SPBC21D10.05c, len:600, FT SIMILARITY:Schizosaccharomyces pombe, CAB57339, putative FT GTPase activating protein., (320 aa), fasta scores: opt: FT 365, E():3.3e-12, (29.3% identity in 304 aa)" FT /product="putative GTPase activating protein" FT /fasta_file="fasta/c21D10.tab.seq.03255.out" FT misc_feature join(2359754..2359835,2359879..2359985,2360055..2360149, FT 2360245..2360299) FT /note="Match to PF01412 ArfGap, putative GTP-ase FT activating required for Arf Score 109.90" FT misc_feature 2359836..2359841 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2359867..2359878 FT /colour=6 FT /note="ctgactgtttag, splice branch and acceptor" FT misc_feature 2359986..2359991 FT /colour=6 FT /note="gtaatt, splice donor sequence" FT misc_feature 2360042..2360054 FT /colour=6 FT /note="ctaacgagtatag, splice branch and acceptor" FT misc_feature 2360150..2360155 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2360223..2360244 FT /colour=6 FT /note="ttaacgagttttttctatttag, splice branch and acceptor" FT misc_feature 2360396..2360518 FT /note="Match to PF00627 UBA, UBA-domain Score 28.58" FT misc_feature complement(2363299..2363451) FT /note="5s RNA" FT misc_feature complement(2365955..2365958) FT /note="True end of overlap with SPBC12C2 Z54140 S.pombe FT chr omosome II cosmid c12C2" FT misc_feature complement(2365955..2375130) FT /note="nominal overlap with cosmid SPBC12C2, EM:Z54140 S. FT pombe chromosome 2" FT misc_feature 2367336..2367401 FT /colour=8 FT /note="PS00934 Glyoxalase I signature 1" FT misc_feature 2367348..2367755 FT /note="Match to PF00903 Glyoxalase, Glyoxalase Score FT 302.20" FT misc_feature 2367573..2367626 FT /colour=8 FT /note="PS00935 Glyoxalase I signature 2" FT misc_feature 2367801..2367863 FT /colour=8 FT /note="PS00934 Glyoxalase I signature 1" FT misc_feature 2367813..2368199 FT /note="Match to PF00903 Glyoxalase, Glyoxalase Score FT 301.26" FT misc_feature 2368017..2368070 FT /colour=8 FT /note="PS00935 Glyoxalase I signature 2" FT misc_feature complement(2369135..2369536) FT /note="Match to PF01380 SIS, SIS domain Score 139.50" FT misc_feature complement(2369651..2370052) FT /note="Match to PF01380 SIS, SIS domain Score 161.02" FT misc_feature complement(join(2370581..2371110,2371310..2371379)) FT /note="Match to PF00310 GATase_2, Glutamine FT amidotransferases class-II Score 347.63" FT misc_feature complement(2371105..2371119) FT /colour=6 FT /note="ctaattcaggtttag, splice branch and acceptor" FT misc_feature complement(2371304..2371309) FT /colour=6 FT /note="gtaaat, splice donor sequence" FT misc_feature complement(2371381..2371395) FT /colour=6 FT /note="ctaatacgaagctag, splice branch and acceptor" FT misc_feature complement(2371443..2371448) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature 2372781..2372786 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2372902..2372917 FT /colour=6 FT /note="ctaattatttgattag, splice branch and acceptor" FT misc_feature complement(2365955..2375130) FT /note="nominal overlap with cosmid SPBC21D10, EM:AL031536 FT S. pombe chromosome 2" FT misc_feature 2367348..2367755 FT /note="Match to PF00903 Glyoxalase, Glyoxalase Score FT 302.20" FT misc_feature 2367813..2368199 FT /note="Match to PF00903 Glyoxalase, Glyoxalase Score FT 301.26" FT misc_feature 2367960..2367989 FT /colour=8 FT /note="PS00934 Glyoxalase I signature 1" FT misc_feature complement(2369135..2369536) FT /note="Match to PF01380 SIS, SIS domain Score 139.50" FT misc_feature complement(2369651..2370052) FT /note="Match to PF01380 SIS, SIS domain Score 161.02" FT misc_feature complement(join(2370581..2371110,2371310..2371379)) FT /note="Match to PF00310 GATase_2, Glutamine FT amidotransferases class-II Score 347.63" FT misc_feature complement(2371105..2371119) FT /colour=6 FT /note="ctaattcaggtttag, splice branch and acceptor" FT misc_feature complement(2371304..2371309) FT /colour=6 FT /note="gtaaat, splice donor sequence" FT misc_feature complement(2371381..2371395) FT /colour=6 FT /note="ctaatacgaagctag, splice branch and acceptor" FT misc_feature complement(2371443..2371448) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature 2372781..2372786 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2372902..2372917 FT /colour=6 FT /note="ctaattatttgattag, splice branch and acceptor" FT CDS 2378314..2379288 FT /colour=10 FT /gene="SPBC12C2.09c" FT /label=SPBC12C2.09c FT /note="SPBC12C2.09c, len:323, SIMILARITY:Saccharomyces FT cerevisiae, Q12442, chromosome xv reading frame orf FT yol002c., (327 aa), fasta scores: opt: 776, E():0, (40.1% FT identity in 289 aa)" FT /product="conserved protein; similar to S. cerevisiae FT YOL002C" FT /fasta_file="fasta/c12C2.tab.seq.03224.out" FT CDS complement(join(2379618..2381824,2381956..2382094)) FT /colour=7 FT /gene="SPBC12C2.08" FT /label=SPBC12C2.08 FT /note="SPBC12C2.08, len:780, SIMILARITY:Saccharomyces FT cerevisiae, DNM1_YEAST, dynamin-related protein dnm1., FT (757 aa), fasta scores: opt: 2127, E():0, (50.1% identity FT in 790 aa)" FT /product="dynamin family; contains dynamin GTPase effector FT domain; morphology and cortical localization of FT mitochondria; similar to S. cerevisiae DNM1" FT /fasta_file="fasta/c12C2.tab.seq.03225.out" FT misc_feature complement(2380344..2381216) FT /note="Match to PF01031 dynamin_2, Dynamin central region FT Score 528.42" FT misc_feature complement(2381217..2381630) FT /note="Match to PF00350 dynamin, Dynamin family Score FT 255.11" FT misc_feature complement(join(2381736..2381824,2381956..2382091)) FT /note="Match to PF00350 dynamin, Dynamin family Score FT 98.23" FT misc_feature complement(2381781..2381810) FT /colour=8 FT /note="PS00410 Dynamin family sinature" FT misc_feature complement(2381825..2381844) FT /colour=6 FT /note="ttaactcattcgtattttag, splice branch and acceptor" FT misc_feature complement(2381950..2381955) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(2381975..2381998) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS 2383799..2384695 FT /EC_number="2.5.1.16" FT /colour=7 FT /gene="SPBC12C2.07c" FT /label=SPBC12C2.07c FT /note="SPBC12C2.07c, len:297, SIMILARITY:Neurospora FT crassa., BAA81738, spermidine synthase., (291 aa), fasta FT scores: opt: 1508, E():0, (74.2% identity in 291 aa)" FT /product="spermidine synthase" FT /fasta_file="fasta/c12C2.tab.seq.03226.out" FT misc_feature 2384579..2384605 FT /colour=8 FT /note="PS00037 Myb DNA-binding domain repeat signature 1" FT CDS complement(2384946..2386457) FT /colour=7 FT /gene="SPBC12C2.06" FT /label=SPBC12C2.06 FT /note="SPBC12C2.06, len:502, SIMILARITY:Saccharomyces FT cerevisiae, DBP5_YEAST, putative ATP-dependent RNA FT helicase dbp5, (482 aa), fasta scores: opt: 1805, E():0, FT (57.3% identity in 468 aa)" FT /product="putative ATP-dependent cytosolic RNA helicase, FT required for poly(A+) RNA export; similar to S. cerevisiae FT DBP5" FT /fasta_file="fasta/c12C2.tab.seq.03227.out" FT misc_feature complement(2385099..2385362) FT /note="Match to PF00271 helicase_C, Helicases conserved C- FT terminal domain Score 120.57" FT misc_feature complement(2385474..2386079) FT /note="Match to PF00270 DEAD, DEAD/DEAH box helicase Score FT 187.56" FT misc_feature complement(2385657..2385683) FT /colour=8 FT /note="PS00039 DEAD-box subfamily ATP-dependent helicases FT s ignature" FT CDS join(2386772..2386810,2386855..2386881,2386936..2386999, FT 2387051..2387171,2387250..2388286,2388333..2388689, FT 2388733..2388997,2389066..2389084) FT /colour=10 FT /gene="SPBC12C2.05c" FT /label=SPBC12C2.05c FT /note="SPBC12C2.05c, len:641, SIMILARITY:Saccharomyces FT cerevisiae, YHR4_YEAST, hypothetical 71.2 kD protein, (633 FT aa), fasta scores: opt: 830, E():0, (29.4% identity in 654 FT aa)" FT /product="hypothetical protein; contains DAG binding FT domain; similar to S. cerevisiae BZZ1" FT /fasta_file="fasta/c12C2.tab.seq.03228.out" FT misc_feature 2386811..2386816 FT /colour=6 FT /note="gtaagg, splice donor sequence" FT misc_feature 2386841..2386854 FT /colour=6 FT /note="ctaatatataaaag, splice branch and acceptor" FT misc_feature 2386882..2386887 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 2386917..2386935 FT /colour=6 FT /note="ttaacacattgtaacaaag, splice branch and acceptor" FT misc_feature join(2386921..2386999,2387051..2387171,2387250..2387331) FT /note="Match to PF00611 FCH, Fes/CIP4 homology domain FT Score 87.74" FT misc_feature 2387000..2387005 FT /colour=6 FT /note="gtaaat, splice donor sequence" FT misc_feature 2387035..2387050 FT /colour=6 FT /note="ctaactttgttgctag, splice branch and acceptor" FT misc_feature 2387172..2387177 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2387238..2387249 FT /colour=6 FT /note="ctaattttatag, splice branch and acceptor" FT misc_feature join(2388190..2388286,2388333..2388385) FT /note="Match to PF00130 DAG_PE-bind, Phorbol FT esters/diacylglycerol binding domain (C1 domain) Score FT 75.93" FT misc_feature 2388287..2388292 FT /colour=6 FT /note="gtacga, splice donor sequence" FT misc_feature 2388315..2388332 FT /colour=6 FT /note="ctaacaaaacacgtgtag, splice branch and acceptor" FT misc_feature join(2388605..2388689,2388733..2388806) FT /note="Match to PF00018 SH3, Src homology domain 3 Score FT 26.25" FT misc_feature 2388690..2388695 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2388716..2388732 FT /colour=6 FT /note="ctaatagatcaatatag, splice branch and acceptor" FT misc_feature 2388849..2388995 FT /note="Match to PF00018 SH3, Src homology domain 3 Score FT 68.78" FT misc_feature 2388998..2389003 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2389050..2389065 FT /colour=6 FT /note="ctaacatatgtcttag, splice branch and acceptor" FT misc_feature complement(2389255) FT /note="Extra A nucleotide - discrepancy between c12C2 FT seque nce and overlap with c17F3" FT CDS complement(2389660..2390814) FT /colour=12 FT /gene="SPBC12C2.04" FT /label=SPBC12C2.04 FT /note="SPBC12C2.04, len:383, FT SIMILARITY:Schizosaccharomyces pombe, YEAH_SCHPO, FT hypothetical kD protein, (405 aa), fasta scores: opt: 1561, FT E():0, (58.5% identity in 378 aa)" FT /product="hypotheical protein; possibly S. pombe specific; FT similar to S. pombe SPAC2E11.17" FT /fasta_file="fasta/c12C2.tab.seq.00029.out" FT CDS complement(2392320..2392655) FT /colour=9 FT /gene="SPBC12C2.14c" FT /label=SPBC12C2.14c FT /note="SPBC12C2.14c, len: 111" FT /product="very hypothetical protein" FT /fasta_file="fasta/c12C2.tab.seq.03230.out" FT CDS 2394229..2395944 FT /colour=7 FT /gene="SPBC12C2.03c" FT /label=SPBC12C2.03c FT /note="SPBC12C2.03c, len:570, SIMILARITY:Arabidopsis FT thaliana, Q39036, nadph-ferrihemoprotein reductase., (712 FT aa), fasta scores: opt: 414, E():2.8e-18, (26.8% identity FT in 447 aa)" FT /product="putative FAD binding oxidoreductase" FT /fasta_file="fasta/c12C2.tab.seq.03231.out" FT misc_feature 2394625..2395305 FT /note="Match to PF00667 FAD_binding, FAD binding domain FT Score 348.28" FT misc_feature join(2395408..2395555,2395610..2395797) FT /note="Match to PF00175 oxidored_fad, Oxidoreductase FT FAD/NAD-binding domain Score 29.00" FT CDS 2396738..2400667 FT /colour=2 FT /gene="ste16" FT /gene="SPBC12C2.02c" FT /label=ste16 FT /note="SPBC12C2.02c, len:1308" FT /product="required for sexual differentiation and meiosis" FT /fasta_file="fasta/c12C2.tab.seq.03232.out" FT misc_feature 2400044..2400067 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A" FT misc_feature complement(2401088..2402103) FT /note="nominal overlap with cosmid SPBC17F3, EM:AL031263 FT S. pombe chromosome 2" FT misc_feature complement(2401088..2402103) FT /note="nominal overlap with cosmid SPBC12C2, EM:Z54140 S. FT pombe chromosome 2" FT CDS complement(join(2402845..2404236,2404302..2404788, FT 2404840..2404919)) FT /colour=2 FT /gene="nak1" FT /gene="SPBC17F3.02" FT /label=nak1 FT /note="SPBC17F3.02, len:652" FT /product="serine/threonine protein kinase" FT /fasta_file="fasta/c17F3.tab.seq.03112.out" FT misc_feature complement(2404012..2404236) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 57.47" FT misc_feature complement(2404237..2404250) FT /colour=6 FT /note="ttaacaaagtttag, splice branch and acceptor" FT misc_feature complement(2404296..2404301) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(join(2404311..2404788,2404840..2404892)) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 180.03" FT misc_feature complement(2404789..2404802) FT /colour=6 FT /note="ctaacattctaaag, splice branch and acceptor" FT misc_feature complement(2404834..2404839) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 2407607..2408068 FT /note="Match to PF00620 RhoGAP, RhoGAP domain Score 81.86" FT misc_feature 2408291..2408387 FT /note="nominal overlap with cosmid SPBC557, EM:AL132869 S. FT pombe chromosome 2" FT misc_feature complement(2408291..2408387) FT /note="nominal overlap with cosmid SPBC17F3, EM:AL031263 FT S. pombe chromosome 2" FT CDS complement(2408924..2409535) FT /colour=8 FT /gene="SPBC557.02c" FT /label=SPBC557.02c FT /note="SPBC557.02c, len:203, LOW SIMILARITY:Dictyostelium FT discoideum, Q94471, orfveg109, (239 aa), fasta scores: FT opt: 140, E():0.12, (26.8% identity in 205 aa)" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c557.tab.seq.04072.out" FT CDS complement(join(2409633..2410646,2410822..2411427)) FT /colour=2 FT /gene="pim1" FT /gene="dcd1" FT /gene="ptr2" FT /gene="SPBC557.03c" FT /label=pim1 FT /note="SPBC557.03c, len:539" FT /product="pim1 GTPase protein" FT /fasta_file="fasta/c557.tab.seq.04073.out" FT misc_feature complement(2409855..2410001) FT /note="Match to PF00415 RCC1, Regulator of chromosome FT condensation (RCC1) Score 34.71" FT misc_feature complement(2410005..2410193) FT /note="Match to PF00415 RCC1, Regulator of chromosome FT condensation (RCC1) Score 28.67" FT misc_feature complement(2410371..2410520) FT /note="Match to PF00415 RCC1, Regulator of chromosome FT condensation (RCC1) Score 24.41" FT misc_feature complement(2410647..2410658) FT /colour=6 FT /note="ctaacatactag, splice branch and acceptor" FT misc_feature complement(2410816..2410821) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(2410855..2411052) FT /note="Match to PF00415 RCC1, Regulator of chromosome FT condensation (RCC1) Score 33.61" FT CDS join(2412647..2412746,2412819..2412952,2412992..2415376) FT /colour=7 FT /gene="SPBC557.04" FT /label=SPBC557.04 FT /note="SPBC557.04, len:872, SIMILARITY:Schizosaccharomyces FT pombe, CAB54861, putative serine/threonine-protein kinase., FT (650 aa), fasta scores: opt: 1160, E():0, (37.7% FT identity in 607 aa)" FT /product="putative serine/threonine protein kinase" FT /fasta_file="fasta/c557.tab.seq.04074.out" FT misc_feature 2412747..2412752 FT /colour=6 FT /note="gtataa, splice donor sequence" FT misc_feature 2412802..2412818 FT /colour=6 FT /note="ctaacatttttcattag, splice branch and acceptor" FT misc_feature 2412953..2412958 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2412980..2412991 FT /colour=6 FT /note="ctaacttattag, splice branch and acceptor" FT misc_feature 2413010..2413648 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 116.89" FT CDS join(2415823..2416337,2416380..2416952,2416996..2417209) FT /colour=8 FT /gene="SPBC557