ID c1348 standard; DNA; FUN; 666 BP. AC c1348; FH Key Location/Qualifiers FH FT misc_feature complement(1..6535) FT /note="region of high similar to c212 S. pombe chromosome FT 1(telomeric)" FT LTR complement(997..1215) FT /note="218 (-1) 37 254 Tf2-type LTR" FT LTR complement(1296..1591) FT /note="464 (-1) 56 349 Tf2-type LTR" FT LTR complement(2756..3054) FT /note="176 (-1) 2 299 Tf2-type LTR" FT LTR 4835..5191 FT /note="524 (+1) 1 354 Tf1-type LTR" FT CDS join(5451..5940,5999..6318) FT /colour=12 FT /gene="SPAC1348.01" FT /label=SPAC1348.01 FT /note="SPAC1348.01, len:269" FT /product="hypothetical protein; duplicated telomeric FT region; contains 4 predicted transmembrane helices; FT possibly S. pombe specific; has late log phase cDNA; FT highly similar to S. pombe SPAC212.01c; highly similar to FT S. pombe SPAC1348.07" FT /fasta_file="fasta/c1348.tab.seq.00473.out" FT misc_feature 5941..5946 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 5982..5998 FT /colour=6 FT /note="ctaataatttaaaatag, splice branch and acceptor" FT CDS 7980..9014 FT /colour=12 FT /gene="SPAC1348.02" FT /label=SPAC1348.02 FT /note="SPAC1348.02, len:344," FT /product="hypothetical protein; contains 5 predicted FT transmembrane helices; low similarity to membrane FT transporter; highly similar to SPBPB2B2.19C SPAC750.05C FT SPAC977.01; possibly S. pombe specific; low similar to S. FT cerevisiae YHL017W is possibly spurious" FT /fasta_file="fasta/c1348.tab.seq.00474.out" FT misc_feature 8062..12662 FT /note="region of high similarity to SPAC977 S. pombe FT chromosome 1 (telomeric)" FT CDS 10569..11009 FT /colour=12 FT /gene="SPAC1348.03" FT /label=SPAC1348.03 FT /note="SPAC1348.03, len:145" FT /product="hypothetical protein; duplicated telomeric FT region; possibly S. pombe specific; highly similar to S. FT pombe SPAC750.04C SPAC977.02" FT /fasta_file="fasta/c1348.tab.seq.00475.out" FT CDS 12176..12613 FT /colour=7 FT /gene="SPAC1348.04" FT /label=SPAC1348.04 FT /note="SPAC1348.04, len:161" FT /product="putative sterol methyltransferase; duplicated in FT S. pombe see SPAC750.03C and SPAC977.03; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c1348.tab.seq.00049.out" FT CDS 13572..15029 FT /colour=7 FT /gene="SPAC1348.05" FT /label=SPAC1348.05 FT /note="SPAC1348.05, len:485, FT SIMILARITY:Schizosaccharomyces pombe, Q9USN4, putative FT membrane transporter, (462 aa), fasta scores: opt: 878, FT E():0, (32.6% identity in 429 aa)" FT /product="putative membrane transporter; contains PfamB_83" FT /fasta_file="fasta/c1348.tab.seq.00477.out" FT misc_feature 14527..29514 FT /note="region of similar to SPAC977 S. pombe chromosome FT 1(telomeric)" FT CDS complement(15981..16592) FT /colour=10 FT /gene="SPAC1348.06c" FT /label=SPAC1348.06c FT /note="SPAC1348.06c, len:203, SIMILARITY:Saccharomyces FT cerevisiae, Q08910, chromosome xv reading frame orf FT yor387c., (206 aa), fasta scores: opt: 786, E():0, (55.5% FT identity in 200 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YOR387C" FT /fasta_file="fasta/c1348.tab.seq.00478.out" FT CDS join(19641..20058,20109..20383) FT /colour=12 FT /gene="SPAC1348.07" FT /label=SPAC1348.07 FT /note="SPAC1348.07, len:230" FT /product="hypothetical protein; duplicated at S. pombe FT telomeres; possibly S. pombe specific; contains 3 FT predicted transmembrane helices; highly similar to S. FT pombe SPAC212.01c; highly similar to S. pombe SPAC1348.01" FT /fasta_file="fasta/c1348.tab.seq.00479.out" FT misc_feature 20059..20064 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 20092..20108 FT /colour=6 FT /note="ctaataatttaaaatag, splice branch and acceptor" FT CDS complement(22279..23529) FT /colour=12 FT /gene="SPAC1348.08c" FT /label=SPAC1348.08c FT /note="SPAC1348.08c, len:416, FT SIMILARITY:Schizosaccharomyces pombe, YAH2_SCHPO, FT hypothetical 62.9 kD protein c8a4.02c in chromosome i., FT (609 aa), fasta scores: opt: 1354, E():0, (56.3% identity FT in 378 aa)" FT /product="hypothetical threonine-rich protein; similar to FT SPAC1F8.06, and SPAC8A4.02C; possibly S. pombe specific; FT predicted N-terminal signal sequence" FT /fasta_file="fasta/c1348.tab.seq.00480.out" FT misc_feature 24880..25365 FT /note="Match to PF00106 adh_short, short chain FT dehydrogenase Score 87.89" FT CDS 24916..25626 FT /colour=7 FT /gene="SPAC1348.09" FT /label=SPAC1348.09 FT /note="SPAC1348.09, len:236, SIMILARITY:Burkholderia FT cepacia, Q51641, insect-type dehydrogenase., (249 aa), FT fasta scores: opt: 371, E():7.3e-17, (32.1% identity in FT 221 aa)" FT /product="putative short chain dehydrogenase" FT /fasta_file="fasta/c1348.tab.seq.00481.out" FT CDS complement(join(26287..26355,26420..28372)) FT /colour=7 FT /gene="SPAC1348.10c" FT /label=SPAC1348.10c FT /note="SPAC1348.10c, len:673, FT SIMILARITY:Schizosaccharomyces pombe, O13857, putative FT lysophospholipase , (624 aa), fasta scores: opt: 3142, FT E():0, (74.7% identity in 598 aa)" FT /product="putative lysophospholipase" FT /fasta_file="fasta/c1348.tab.seq.00482.out" FT misc_feature complement(26356..26371) FT /colour=6 FT /note="ctaacttttgttctag, splice branch and acceptor" FT intron complement(26356..26419) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(26414..26419) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(26423..28234) FT /note="Match to PF01735 PLA2_B, Lysophospholipase FT catalytic domain Score 1033.69" FT CDS 33231..34820 FT /colour=4 FT /gene="SPAC1348.11" FT /label=SPAC1348.11 FT /note="SPAC1348.11, len:514, FT SIMILARITY:Schizosaccharomyces pombe, YAO5_SCHPO, FT hypothetical 61.1 kD protein c11d3.05 in chromosome i., FT (546 aa), fasta scores: opt: 2344, E():0, (68.5% identity FT in 546 aa)" FT /product="predicted transmembrane transporter pseudogene" FT /pseudo FT /fasta_file="fasta/c1348.tab.seq.00483.out" FT misc_feature join(33231..33564,33606..34291,34295..34768, FT 34770..34820) FT /fasta_file="fasta/c1348.tab.seq.00046.out" FT /note="SPAC1348.11 pseudo gene" FT CDS 35223..36658 FT /colour=4 FT /gene="SPAC1348.12" FT /label=SPAC1348.12 FT /note="SPAC1348.12, len:475, SIMILARITY:Saccharomyces FT cerevisiae, Q08904, chromosome xv reading frame orf FT yor380w., (546 aa), fasta scores: opt: 663, E():0, (31.9% FT identity in 480 aa)" FT /product="zinc finger protein; pseudo" FT /pseudo FT /fasta_file="fasta/c1348.tab.seq.00484.out" FT misc_feature join(35223..35663,35667..35924,35924..36172,36176..36586, FT 36590..36658) FT /fasta_file="fasta/c1348.tab.seq.00047.out" FT /note="SPAC1348.12 pseudogene" FT misc_feature 35244..35345 FT /note="Match to PF00172 Zn_clus, fungal Zn(2)-Cys(6) FT binuclear cluster domain Score 46.12" FT CDS 36901..37263 FT /colour=4 FT /gene="SPAC1348.13" FT /label=SPAC1348.13 FT /note="SPAC1348.13, len:119, SIMILARITY:Agrocybe aegerita., FT O47565, coi i2 protein., (265 aa), fasta scores: opt: FT 381, E():2.4e-20, (49.6% identity in 121 aa)" FT /product="similar to fragment of cox1 intron protein; FT pseudogene" FT /pseudo FT /fasta_file="fasta/c1348.tab.seq.00485.out" FT misc_feature join(36901..37185,37189..37263) FT /fasta_file="fasta/c1348.tab.seq.00048.out" FT /note="SPAC1348.13 pseudogene" FT CDS complement(38587..40143) FT /colour=7 FT /gene="SPAP8B6.01c" FT /gene="SPAC1348.14" FT /product="putative glucose transporter; ght7?" FT /fasta_file="fasta/pB8B6.tab.seq.00020.out" FT misc_feature 38440..39186 FT /note="nominal overlap with SPAC1348 S. pombe chromosome 1" FT CDS complement(44810..46831) FT /product="putative SSS urea transporter; similar to S. FT pombe SPAC869.03C (paralog); similar to S. pombe FT SPBC23G7.13C (paralog); similar to S. cerevisiae DUR3" FT /fasta_file="fasta/pB8B6.tab.seq.00019.out" FT /colour=7 FT /gene="SPAP8B6.02c" FT CDS 47428..49071 FT /colour=7 FT /fasta_file="fasta/pB8B6.tab.seq.00018.out" FT /product="putative acetamidase; similar to S. cerevisiae FT AMD2" FT /EC_number="3.5.1.4" FT /gene="SPAP8B6.03" FT CDS complement(join(49143..50910,50953..51062,51113..51181)) FT /product="zinc finger protein; fungal binuclear cluster FT domain; suppresses a defect in the onset of anaphase of FT fission yeast slp1 mutant (PMID: 11058086)" FT /fasta_file="fasta/pB8B6.tab.seq.00033.out" FT /colour=2 FT /gene="grt1" FT /gene="SPAP8B6.04c" FT misc_feature complement(50911..50923) FT /note="ttaatataaatag, splice branch and acceptor" FT /colour=6 FT misc_feature complement(50947..50952) FT /note="gtatac, splice donor sequence" FT /colour=6 FT misc_feature complement(51063..51074) FT /note="ttaacaattaag, splice branch and acceptor" FT /colour=6 FT misc_feature complement(51107..51112) FT /note="gtgagt, splice donor sequence" FT /colour=6 FT intron complement(53418..53455) FT /colour=7 FT /note="Intron predicted by HMM_intron, Score=16.78" FT /score=1.678 FT misc_feature complement(54135..56795) FT /note="duplicated region in SPAC977 S. pombe chromosome 1" FT CDS complement(54497..55567) FT /product="putative L-asparaginase; similar to S. pombe FT SPAC977.12 (paralog); similar to S. pombe SPAC186.03 FT (paralog); similar to S. cerevisiae ASP3" FT /colour=7 FT /fasta_file="fasta/pB8B6.tab.seq.00016.out" FT /EC_number="3.5.1.1" FT /gene="SPAP8B6.05c" FT intron complement(55695..55810) FT /colour=7 FT /note="Intron predicted by HMM_intron, Score=7.60" FT /score=0.76 FT CDS complement(55850..56785) FT /colour=10 FT /fasta_file="fasta/pB8B6.tab.seq.00015.out" FT /product="hypothetical protein; duplicated in S. pombe; FT identical to S. pombe SPAC8F11.09C; similar to S. FT cerevisiae YOR390W; predicted transmembrane" FT /gene="SPAP8B6.06c" FT misc_feature complement(56925..57077) FT /note="duplicated region in SPAC977 S. pombe chromosome 1" FT LTR complement(57151..57483) FT /note="261 (+1) 34 358 Tf1-type LTR" FT LTR complement(57604..57821) FT /note="179 (+1) 1 215 Tf1-type LTR" FT CDS complement(1732691..1733677) FT /colour=2 FT /gene="swi6" FT /gene="SPAC824.10c" FT /gene="SPAC664.01c" FT /label=swi6 FT /note="SPAC824.10c, len:328" FT /product="determines mating-type donor choice; required FT for transcriptional silencing at the mating type loci; FT required for chromosome segregation; chromodomain protein; FT binds centromeric flanking sequence; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c824.tab.seq.00384.out" FT /fasta_file="fasta/c664.tab.seq.00016.out" FT /note="SPAC664.01c, len:328" FT CDS complement(join(281402..282013,282068..282428, FT 282621..282634)) FT /colour=7 FT /gene="SPAC806.09c" FT /label=SPAC806.09c FT /note="putative incorrect N-terminal" FT /note="SPAC806.09c, len:316, SIMILARITY:Saccharomyces FT italicus, AAB87766, v-snare bypass mutant., (347 aa), FT fasta scores: opt: 590, E():0, (46.3% identity in 307 aa)" FT /product="SUR4 family protein; putative fatty acid FT elongation protein" FT /fasta_file="fasta/c806.tab.seq.00727.out" FT /gene="SPAC1639.01c" FT /label=SPAC1639.01c FT /note="SPAC1639.01c, len:328, SIMILARITY:Saccharomyces FT italicus, AAB87766, v-snare bypass mutant., (347 aa), FT fasta scores: opt: 905, E():0, (49.2% identity in 309 aa)" FT /fasta_file="fasta/c1639.tab.seq.00716.out" FT CDS 228560..228907 FT /colour=9 FT /gene="SPAC13G6.13" FT /gene="SPAC24B11.02" FT /label=SPAC13G6.13 FT /note="SPAC13G6.13, len:115aa" FT /product="very hypothetical protein; low G+C" FT /fasta_file="fasta/c13G6.tab.seq.00470.out" FT /label=SPAC24B11.02 FT /note="SPAC24B11.02, len:115" FT /product="very hypothetical protein" FT /fasta_file="fasta/c24B11.tab.seq.00785.out" FT CDS complement(join(375515..375727,375790..375920, FT 375983..376115,376220..376294)) FT /colour=10 FT /gene="SPAC12G12.02" FT /gene="SPAC630.01c" FT /label=SPAC12G12.02 FT /note="SPAC12G12.02, len:183, SIMILARITY:Saccharomyces FT cerevisiae, YG5P_YEAST, hypothetical 17.9 kD protein in FT yta7-taf145 intergenic region., (152 aa), fasta scores: FT opt: 227, E():1.6e-07, (33.6% identity in 143 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YGR272C" FT /fasta_file="fasta/c12G12.tab.seq.00564.out" FT /label=SPAC630.01c FT /note="SPAC630.01c, len:183, SIMILARITY:Saccharomyces FT cerevisiae, YG5P_YEAST, hypothetical 17.9 kD protein in FT yta7-taf145 intergenic region., (152 aa), fasta scores: FT opt: 284, E():4.7e-11, (36.6% identity in 131 aa)" FT /fasta_file="fasta/c630.tab.seq.01055.out" FT CDS 229911..230543 FT /colour=2 FT /gene="aps1" FT /gene="SPAC13G6.14" FT /gene="SPAC24B11.03" FT /label=aps1 FT /note="SPAC13G6.14, len:210aa" FT /product="diadenosine 5',5'''-p1,p6-hexaphosphate FT hydrolase; dual function MutT hydrolase; involved in FT inositol polyphosphate hydrolysis" FT /fasta_file="fasta/c13G6.tab.seq.00471.out" FT /note="SPAC24B11.03, len:210" FT /fasta_file="fasta/c24B11.tab.seq.00786.out" FT CDS complement(232163..232654) FT /colour=7 FT /gene="SPAC13G6.15c" FT /gene="SPAC24B11.04c" FT /label=SPAC13G6.15c FT /note="SPAC13G6.15c, len:163aa" FT /product="putative calcineurin-binding protein; Pfam- FT B_8791" FT /fasta_file="fasta/c13G6.tab.seq.00472.out" FT /label=SPAC24B11.04c FT /note="SPAC24B11.04c, len:163" FT /fasta_file="fasta/c24B11.tab.seq.00787.out" FT CDS complement(join(3471364..3471472,3471601..3471725, FT 3471804..3471874,3471925..3471964)) FT /colour=7 FT /gene="SPAC3H5.02" FT /gene="SPAC3A11.13" FT /label=SPAC3H5.02 FT /note="SPAC3H5.02, len:114aa; similarity: to YLR200W, FT KE2_Y EAST, P52553, protein yke2; nuclear, (114aa), fasta FT scores, opt:283, E():2.7e-20, (42.0% identity in 112 aa FT overlap)" FT /product="putative GIM complex; prefoldin subunit 6" FT /fasta_file="fasta/c3H5.tab.seq.01912.out" FT /label=SPAC3A11.13 FT /note="SPAC3A11.13, len:114, SIMILARITY:Saccharomyces FT cerevisiae, KE2_YEAST, protein yke2., (114 aa), fasta FT scores: opt: 283, E():2.2e-11, (42.0% identity in 112 aa)" FT /fasta_file="fasta/c3A11.tab.seq.01138.out" FT CDS join(260221..260357,260419..260475,260506..260812) FT /colour=8 FT /gene="SPAC24B11.14" FT /gene="SPAC806.10" FT /note="SPAC24B11.14, len:166" FT /note="added 3-9-99" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c24B11.tab.seq.00796.out" FT /note="SPAC806.10, len:166" FT /fasta_file="fasta/c806.tab.seq.00718.out" FT CDS 2703657..2704496 FT /colour=7 FT /gene="SPAC4F8.02c" FT /gene="SPAC644.02" FT /label=SPAC4F8.02c FT /note="SPAC4F8.02c, len:279, SIMILARITY:Saccharomyces FT cerevisiae, RM40_YEAST, mitochondrial 60s ribosomal FT protein l40, (297 aa), fasta scores: opt: 142, E():0.033, FT (24.2% identity in 277 aa)" FT /product="mitochondrial ribosomal protein L40 (L24); FT similar to S. cerevisiae MRPL40" FT /fasta_file="fasta/c4F8.tab.seq.00043.out" FT /label=SPAC644.02 FT /note="SPAC644.02, len:279, LOW SIMILARITY:Saccharomyces FT cerevisiae, RM40_YEAST, mitochondrial 60s ribosomal FT protein l40, (297 aa), fasta scores: opt: 142, E():0.045, FT (24.2% identity in 277 aa)" FT /product="putative mitochondrial ribosomal protein L40 FT (L24); similar to S. cerevisiae MRPL40" FT /fasta_file="fasta/c644.tab.seq.02121.out" FT CDS join(1007385..1007433,1007480..1007533,1007581..1007682, FT 1007725..1007865,1008009..1008313) FT /colour=2 FT /gene="meu13" FT /gene="SPAC222.15" FT /gene="SPAC821.01" FT /label=meu13 FT /note="SPAC222.15, len:216, SIMILARITY:Mus musculus, FT O35047, proteasome(prosome, macropain) 26s subunit, atpase FT 3, interacting protein(tbpip)., (217 aa), fasta scores: FT opt: 236, E():7.7e-07, (26.9% identity in 197 aa)" FT /note="originally annotated as a pseudogene because the FT third intron has a GAG acceptor, in 2 independently FT sequenced cosmids. But has Meiosis specific transcript FT disruption of which causes defect in meiosis. Personal FT communication Yasushi Hiraoka" FT /product="meiosis specific transcript; similar to S. FT cerevisiae HOP2; possibly required for pairing of FT homologous chromosomes in meiosis; meiotic expression FT upregulated ; mutant displays decreased recombination" FT /fasta_file="fasta/c222.tab.seq.00043.out" FT /product="meiosis specific transcript; similar to S. FT cerevisiae HOP2; possibly required for pairing of FT homologous chromosomes in meiosis; meiotic expression FT upregulated; mutant displays decreased recombination" FT /fasta_file="fasta/c821.tab.seq.00246.out" FT CDS 1579809..1580174 FT /colour=8 FT /fasta_file="fasta/c57A7.tab.seq.00038.out" FT /gene="SPAC57A7.02c" FT /gene="SPAC167.06c" FT /label=SPAC57A7.02c FT /note="SPAC57A7.02c, len:121" FT /product="hypothetical protein" FT /label=SPAC167.06c FT /note="SPAC167.06c, len:121" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c167.tab.seq.00127.out" FT CDS complement(join(2883467..2883473,2883526..2883596)) FT /colour=2 FT /gene="rpl41-2" FT /gene="SPAC3F10.18c" FT /gene="SPAC8F11.01c" FT /note="SPAC31F10.18c, len:25" FT /product="60S ribosomal protein L41" FT /fasta_file="fasta/c3F10.tab.seq.00613.out" FT /label=rpl41-2 FT /note="SPAC8F11.01c, len:25" FT /fasta_file="fasta/c8F11.tab.seq.01110.out" FT CDS complement(join(3657522..3657751,3657800..3658420, FT 3658461..3658563)) FT /colour=10 FT /gene="SPAC17G6.19c" FT /label=SPAC17G6.19c FT /note="SPAC17G6.19c, len:317, SIMILARITY:Caenorhabditis FT elegans., Q21746, similar to tpr domain repeats. ncbi gi: FT 1109816., (337 aa), fasta scores: opt: 505, E():3.2e-22, FT (30.8% identity in 321 aa)" FT /product="conserved protein; similar to S. cerevisiae FT SGT2; TPR domain repeats protein" FT /fasta_file="fasta/c17G6.tab.seq.01008.out" FT /gene="SPAC1142.02c" FT /label=SPAC1142.02c FT /note="SPAC1142.02c, len:317, SIMILARITY:Caenorhabditis FT elegans., Q21746, similar to tpr domain repeats. ncbi gi: FT 1109816., (337 aa), fasta scores: opt: 505, E():4.2e-22, FT (30.8% identity in 321 aa)" FT /fasta_file="fasta/c1142.tab.seq.02099.out" FT misc_feature 61144..61242 FT /note="Repeated region in SPAC1952 AL109820 S.pombe FT chromosome I cosmid c1952." FT misc_feature 61248..61350 FT /note="Repeated region from SPAC1952 AL109820 S.pombe FT chromosome I cosmid c1952." FT misc_feature 61410..61527 FT /note="Repeated region from SPAC1952 AL109820 S.pombe FT chromosome I cosmid c1952." FT misc_feature 61704..61948 FT /note="Repeated region from SPAC1952 AL109820 S.pombe FT chromosome I cosmid c1952." FT CDS 61906..62346 FT /colour=12 FT /gene="SPAC977.02" FT /label=SPAC977.02 FT /note="SPAC977.02, len:146" FT /product="hypothetical protein; overlaps a region FT duplicated in c1952 which has no ORF; possibly S. pombe FT specific; telomeric duplication" FT /fasta_file="fasta/c977.tab.seq.00281.out" FT misc_feature 61912..62026 FT /note="Repeated region from SPAC1952 AL109820 S.pombe FT chromosome I cosmid c1952." FT LTR complement(62539..62733) FT /note="Tf2-type LTR" FT CDS 63511..63948 FT /colour=10 FT /gene="SPAC977.03" FT /label=SPAC977.03 FT /note="SPAC977.03, len:145, LOW SIMILARITY:Mycobacterium FT tuberculosis., P71805, hypothetical 22.8 kD protein., (212 FT aa), fasta scores: opt: 241, E():4.6e-10, (37.6% identity FT in 109 aa)" FT /product="putative methyltransferase; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c977.tab.seq.00070.out" FT CDS 63974..64492 FT /colour=4 FT /gene="SPAC977.04" FT /label=SPAC977.04 FT /note="SPAC977.04, len:172, SIMILARITY to c-term FT of:Candida albicans, O93992, hypothetical membrane FT protein., (510 aa), fasta scores: opt: 345, E():5.8e-17, FT (38.5% identity in 148 aa)" FT /note="5' end of gene missing. Full length gene found in FT cosmid c1348 13572 - 15029. Possible deletion between FT SPAC977.03 and SPAC977.04 (maybe as telomeric)" FT /product="putative membrane transporter possibly pseudo" FT /pseudo FT /fasta_file="fasta/c977.tab.seq.00283.out" FT CDS complement(65444..66058) FT /colour=10 FT /gene="SPAC977.05c" FT /label=SPAC977.05c FT /note="SPAC977.05c, len:249, SIMILARITY:Saccharomyces FT cerevisiae, Q08910, chromosome xv reading frame orf FT yor387c., (206 aa), fasta scores: opt: 788, E():0, (54.1% FT identity in 205 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YOR387C; predicted N-terminal signal sequence" FT /fasta_file="fasta/c977.tab.seq.00284.out" FT CDS join(69107..69524,69575..69726) FT /colour=12 FT /gene="SPAC977.06" FT /label=SPAC977.06 FT /note="SPAC977.06, len:189" FT /product="hypothetical protein; possibly S. pombe FT specific; similar to S. pombe SPAC1348.07, SPAC1348.01, FT SPAC750.06, and SPAC212.01" FT /fasta_file="fasta/c977.tab.seq.00285.out" FT misc_feature 69525..69530 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 69558..69574 FT /colour=6 FT /note="ctaataatttaaaatag, splice branch and acceptor" FT misc_feature complement(70880..71095) FT /fasta_file="fasta/c977.tab.seq.00053.out" FT /note="putative pseudo" FT CDS complement(71733..72983) FT /colour=12 FT /gene="SPAC977.07c" FT /label=SPAC977.07c FT /note="SPAC977.07c, len:416, FT SIMILARITY:Schizosaccharomyces pombe, YAH2_SCHPO, FT hypothetical 62.9 kD protein c8a4.02c in chromosome i., FT (609 aa), fasta scores: opt: 1354, E():0, (56.3% identity FT in 378 aa)" FT /product="hypothetical serine-threonine repeat protein; FT possibly S. pombe specific; predicted N-terminal signal FT sequence" FT /fasta_file="fasta/c977.tab.seq.00286.out" FT CDS 74380..75090 FT /colour=7 FT /gene="SPAC977.08" FT /label=SPAC977.08 FT /note="SPAC977.08, len:236, SIMILARITY:Burkholderia FT cepacia, Q51641, insect-type dehydrogenase., (249 aa), FT fasta scores: opt: 371, E():6.4e-17, (32.1% identity in FT 221 aa)" FT /product="putative short chain dehydrogenase" FT /fasta_file="fasta/c977.tab.seq.00287.out" FT CDS complement(join(75751..75819,75884..77836)) FT /colour=7 FT /gene="SPAC977.09c" FT /label=SPAC977.09c FT /note="SPAC977.09c, len:673, FT SIMILARITY:Schizosaccharomyces pombe, O13857, putative FT lysophospholipase , (624 aa), fasta scores: opt: 3142, FT E():0, (74.7% identity in 598 aa)" FT /product="putative lysophospholipase" FT /fasta_file="fasta/c977.tab.seq.00288.out" FT misc_feature complement(75820..75835) FT /colour=6 FT /note="ctaacttttgttctag, splice branch and acceptor" FT misc_feature complement(75878..75883) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(75887..77698) FT /note="Match to PF01735 PLA2_B, Lysophospholipase FT catalytic domain Score 1033.69" FT CDS join(81793..81916,81994..83276) FT /colour=2 FT /gene="sod2" FT /gene="SPAC977.10" FT /label=sod2 FT /note="SPAC977.10, len:468" FT /product="CPA1 sodium ion/proton antiporter" FT /fasta_file="fasta/c977.tab.seq.00289.out" FT misc_feature 81917..81922 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 81977..81993 FT /colour=6 FT /note="ctaatactagtgtgtag, splice branch and acceptor" FT LTR 84175..84530 FT /note="Tf1-type LTR" FT misc_feature 84940..87590 FT /note="region duplicated in pB8B6 S. pombe chromosome 1" FT CDS 84950..85885 FT /colour=10 FT /gene="SPAC977.11" FT /label=SPAC977.11 FT /note="SPAC977.11, len:311, SIMILARITY:Saccharomyces FT cerevisiae, Q08913, chromosome xv reading frame orf FT yor390w., (375 aa), fasta scores: opt: 153, E():0.0032, FT (30.4% identity in 355 aa)" FT /product="hypothetical protein; duplicated in S. pombe; FT identical to S. pombe SPAPB8B6.??; similar to S. FT cerevisiae YOR390W; predicted transmembrane" FT /fasta_file="fasta/c977.tab.seq.00072.out" FT CDS 86168..87238 FT /colour=7 FT /gene="SPAC977.12" FT /label=SPAC977.12 FT /note="SPAC977.12, len:356, SIMILARITY:Schizosaccharomyces FT pombe, P87015, l-asparaginase ., (360 aa), fasta scores: FT opt: 1521, E():0, (73.6% identity in 314 aa)" FT /product="putative L-asparaginase" FT /fasta_file="fasta/c977.tab.seq.00073.out" FT misc_feature 86303..87199 FT /note="Match to PF00710 Asparaginase, Asparaginase Score FT 350.53" FT CDS complement(87953..88781) FT /colour=4 FT /gene="SPAC977.13c" FT /label=SPAC977.13c FT /note="SPAC977.13c, len:276, SIMILARITY:Synechocystis s, FT P7359, hypothetical 32.9 kD protein., (295 aa), fasta FT scores: opt: 280, E(): 3.1e-12, (25.8% identity in 275 aa)" FT /product="putative hydrolase pseudogene" FT /pseudo FT /fasta_file="fasta/c977.tab.seq.00292.out" FT misc_feature complement(join(87953..88255,88483..88641,88644..88781)) FT /note="putative pseudogene" FT /note="regions with homology to hydrolase" FT intron 3471039..3471163 FT /colour=2 FT /note="confirmed intron" FT intron complement(3471473..3471600) FT /colour=2 FT /note="confirmed intron" FT intron complement(3471726..3471803) FT /colour=2 FT /note="confirmed intron" FT tRNA complement(2832438..2832535) FT /note="tRNA Leu anticodon TAA, Cove score 44.02" FT intron complement(2832482..2832497) FT /note="intron tRNA Leu anticodon TAA" FT tRNA 3472732..3472821 FT /note="tRNA Arg anticodon CCG, Cove score 40.63" FT intron complement(2883474..2883525) FT /colour=2 FT /note="confirmed intron" FT repeat_region 89112..89162 FT /label={ttattttaagttttgtc}3 FT /note="(ttattttaagttttgtc)3" FT misc_feature complement(89280..90468) FT /note="region duplicated in SPAC750 S. pombe chromosome FT 1; appears to be pseudo in c750 as CDS has no initiator FT methionine" FT CDS complement(89391..90446) FT /colour=7 FT /gene="SPAC977.14c" FT /label=SPAC977.14c FT /note="SPAC977.14c, len:351, SIMILARITY:Saccharomyces FT cerevisiae, Q02895, lpg20p., (342 aa), fasta scores: opt: FT 1168, E():0, (52.7% identity in 334 aa)" FT /product="putative oxidoreductase" FT /fasta_file="fasta/c977.tab.seq.00071.out" FT CDS 92665..93408 FT /colour=7 FT /gene="SPAC977.15" FT /label=SPAC977.15 FT /note="SPAC977.15, len:247, SIMILARITY:Schizosaccharomyces FT pombe, YB4E_SCHPO, hypothetical 27.4 kD protein c30d10.14 FT in chromosome ii., (249 aa), fasta scores: opt: 935, E():0, FT (53.5% identity in 245 aa)" FT /product="putative hydrolase" FT /fasta_file="fasta/c977.tab.seq.00294.out" FT CDS complement(94580..96355) FT /EC_number="2.7.1.29" FT /colour=2 FT /gene="dak2" FT /gene="SPAC977.16c" FT /label=dak2 FT /note="SPAC977.16c, len:591" FT /product="dihydroxyacetone kinase" FT /fasta_file="fasta/c977.tab.seq.00295.out" FT CDS 96819..98615 FT /colour=7 FT /gene="SPAC977.17" FT /label=SPAC977.17 FT /note="SPAC977.17, len:598, SIMILARITY:Saccharomyces FT cerevisiae, YFF4_YEAST, hypothetical 70.5 kD protein in FT agp3-dak3 intergenic region., (646 aa), fasta scores: opt: FT 1869, E():0, (52.1% identity in 560 aa)" FT /product="MIP water channel" FT /fasta_file="fasta/c977.tab.seq.00296.out" FT misc_feature 97743..98462 FT /note="Match to PF00230 MIP, Major intrinsic protein Score FT 204.02" FT misc_feature 100152..100254 FT /note="nominal overlap with PCR product SPAPJ695, FT EM:AL132983 S. pombe chromosome 1" FT misc_feature 100152..100254 FT /note="nominal overlap with cosmid SPAC977, EM:AL137130 S. FT pombe chromosome 1" FT misc_RNA 102020..102090 FT /note="Small duplicated region as identified by FT independent cDNAs AU009231 cDNA, clone and spc04643 FT AU009540, clone spc05042, also shows 78/95 FT (82%)conservation between SPAC4F8 Z98530 S.pombe FT chromosome I cosmid c4F8, and 84/95 (88%) conservation FT between MISPLSUR X06597 Fission yeast mtDNA for LSU rRNA FT gene" FT LTR complement(103385..103653) FT /note="TF2 type LTR fragment" FT LTR 103621..103958 FT /note="TF2 type LTR fragment" FT CDS complement(107254..107607) FT /colour=12 FT /gene="SPAPJ695.01c" FT /label=SPAPJ695.01c FT /note="SPAPJ695.01c, len:117, FT SIMILARITY:Schizosaccharomyces pombe, CAB42063, FT hypothetical 12.8 kD protein., (113 aa), fasta scores: FT opt: 506, E():7.7e-29, (67.3% identity in 113 aa)" FT /product="hypothetical protein; possibly S. pombe FT specific; similar to S. pombe SPCC569.02 and SPCP20C8.02; FT predicted N-terminal signal sequence" FT /fasta_file="fasta/pJ695.tab.seq.00305.out" FT misc_RNA 109219..109304 FT /note="Small duplicated region as marked by 2 independent FT cDNAs AU010317 clone spc05710 and AU007551 clone spc02188, FT also hits 4376 4461 MISPCG X54421 S. pombe complete FT mitochondrial genome and MISPRNS X15738 Fission yeast FT mitDNA for small ribosomal RNA" FT LTR complement(109356..109444) FT /note="fragment" FT misc_feature 110458..110561 FT /note="nominal overlap with cosmid SPAC1F8, EM:Z81312 S. FT pombe chromosome 1" FT misc_feature 110458..110561 FT /note="nominal overlap with PCR product pJ695, EM:AL132983 FT S. pombe chromosome 1" FT CDS 112612..114279 FT /colour=2 FT /gene="ght3" FT /gene="SPAC1F8.01" FT /label=ght3 FT /note="SPAC1F8.01, len:555" FT /product="MFS glucose transporter" FT /fasta_file="fasta/c1F8.tab.seq.00762.out" FT misc_feature 112636..114012 FT /note="Match to PF00083 sugar_tr, Sugar (and other) FT transporter Score 437.58" FT misc_feature 112966..113043 FT /colour=8 FT /note="PS00217 Sugar transport proteins signature 2" FT misc_feature 113563..113616 FT /colour=8 FT /note="PS00216 Sugar transport proteins signature 1" FT CDS complement(115274..115954) FT /colour=8 FT /gene="SPAC1F8.02c" FT /label=SPAC1F8.02c FT /note="SPAC1F8.02c, unknown, len: 226" FT /product="hypothetical protein; sequence orphan; contains FT predicted N-terminal signal sequence" FT /fasta_file="fasta/c1F8.tab.seq.00763.out" FT CDS complement(118043..119935) FT /colour=7 FT /gene="SPAC1F8.03c" FT /label=SPAC1F8.03c FT /note="SPAC1F8.03c, len:630, FT SIMILARITY:Schizosaccharomyces pombe, O94607, putative FT major facilitator family protein., (597 aa), fasta scores: FT opt: 752, E():0, (27.4% identity in 580 aa)" FT /product="MFS transporter of unknown specificity" FT /fasta_file="fasta/c1F8.tab.seq.00764.out" FT CDS complement(122156..123547) FT /colour=7 FT /gene="SPAC1F8.04c" FT /label=SPAC1F8.04c FT /note="SPAC1F8.04c, len:463, SIMILARITY:Pseudomonas sp., FT ATZA_PSESD, atrazine chlorohydrolase, (474 aa), fasta FT scores: opt: 730, E():0, (30.5% identity in 476 aa)" FT /product="putative chlorohydrolase/deaminase; putative FT guanine deaminase" FT /fasta_file="fasta/c1F8.tab.seq.00765.out" FT CDS 125676..126224 FT /colour=2 FT /gene="isp3" FT /gene="meu4" FT /gene="SPAC1F8.05" FT /label=isp3 FT /note="SPAC1F8.05, len:182 PROEIN CODING EVIDENCE. FT STRANGEPLOT AND COMP. RNA?" FT /product="sexual differentiation process protein; meiotic FT expression upregulated; no apparent orthologs" FT /fasta_file="fasta/c1F8.tab.seq.00018.out" FT misc_RNA 128420..128527 FT /colour=3 FT /note="mRNA from AU012843 101 208 but not associated with FT a CDS" FT CDS 129687..130844 FT /colour=12 FT /gene="SPAC1F8.06" FT /label=SPAC1F8.06 FT /note="SPAC1F8.06, len:385, SIMILARITY to C-term FT :Schizosaccharomyces pombe, YAH2_SCHPO, hypothetical 62.9 FT kD protein c8a4.02c in chromosome i., (609 aa), fasta FT scores: opt: 1080, E():0, (47.2% identity in 379 aa)" FT /product="hypothetical serine-rich protein; similar to S. FT pombe SPAC8A4.02C and SPAC977.07C; putative cell surface FT protein; possibly S. pombe specific; predicted N-terminal FT signal sequence" FT /fasta_file="fasta/c1F8.tab.seq.00767.out" FT CDS complement(131436..133220) FT /EC_number="4.1.1.1" FT /colour=7 FT /gene="SPAC1F8.07c" FT /label=SPAC1F8.07c FT /note="SPAC1F8.07c, len:594, SIMILARITY:Neurospora crassa., FT DCPY_NEUCR, pyruvate decarboxylase, (570 aa), fasta FT scores: opt: 2196, E():0, (56.9% identity in 559 aa)" FT /product="putative pyruvate decarboxylase" FT /fasta_file="fasta/c1F8.tab.seq.00768.out" FT misc_feature complement(131604..133166) FT /note="Match to PF00205 TPP_enzymes, Thiamine FT pyrophosphate enzymes Score 572.17" FT misc_feature complement(131877..131936) FT /colour=8 FT /note="PS00187 Thiamine pyrophosphate enzymes signature" FT CDS 133617..133979 FT /colour=8 FT /gene="SPAC1F8.08" FT /label=SPAC1F8.08 FT /note="SPAC1F8.08, len:121" FT /product="hypothetical protein; possible transmembrane" FT /fasta_file="fasta/c1F8.tab.seq.00019.out" FT misc_feature 136832..136837 FT /note="nominal overlap with cosmid SPAC11D3, EM:Z68166 S. FT pombe chromosome I" FT misc_feature 136832..136837 FT /note="nominal overlap with cosmid SPAC1F8 EM:Z81312 FT S.pombe chromosome 1" FT CDS complement(138584..138823) FT /colour=10 FT /gene="SPAC11D3.01c" FT /label=SPAC11D3.01c FT /note="SPAC11D3.01c, len:79, SIMILARITY:Neurospora crassa., FT CON6_NEUCR, conidiation-specific protein 6., (93 aa), FT fasta scores: opt: 173, E():9.9e-06, (52.9% identity in 87 FT aa)" FT /product=" similar to neurospora conidiation specific FT protein; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c11D3.tab.seq.01584.out" FT CDS complement(139505..139957) FT /colour=7 FT /gene="SPAC11D3.02c" FT /label=SPAC11D3.02c FT /note="SPAC11D3.02c, len:150, SIMILARITY:Escherichia coli., FT ELAA_ECOLI, elaa protein., (153 aa), fasta scores: opt: FT 288, E():1.2e-13, (38.2% identity in 144 aa)" FT /product="ELLA family protein; putative acetyl FT transferase; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c11D3.tab.seq.01585.out" FT misc_feature complement(139568..139915) FT /note="Match to PF00583 Acetyltransf, Acetyltransferase FT (GNAT) family Score 94.95" FT CDS complement(140681..141589) FT /colour=10 FT /gene="SPAC11D3.03c" FT /label=SPAC11D3.03c FT /note="SPAC11D3.03c, len:302" FT /product="conserved protein; similar to CG10208; no FT apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c11D3.tab.seq.01586.out" FT CDS complement(142593..142985) FT /colour=8 FT /gene="SPAC11D3.04c" FT /label=SPAC11D3.04c FT /note="SPAC11D3.04c, len:130" FT /product="hypothetical protein; sequence orphan; has FT expression on microarray" FT /fasta_file="fasta/c11D3.tab.seq.01587.out" FT CDS 143756..145396 FT /colour=7 FT /gene="SPAC11D3.05" FT /label=SPAC11D3.05 FT /note="SPAC11D3.05, len:546, FT SIMILARITY:Schizosaccharomyces pombe, O59738, major FT facilitator family protein., (541 aa), fasta scores: opt: FT 2464, E():0, (65.9% identity in 548 aa)" FT /product="MFS drug efflux transporter of unknown FT specificity" FT /fasta_file="fasta/c11D3.tab.seq.01588.out" FT CDS 146369..147736 FT /colour=7 FT /gene="SPAC11D3.06" FT /label=SPAC11D3.06 FT /note="SPAC11D3.06, len:455, SIMILARITY:Saccharomyces FT cerevisiae, YD38_YEAST, hypothetical 77.8 kD protein. (695 FT aa), fasta scores: opt: 965, E():0, (36.5% identity in 433 FT aa)" FT /product="MATE family transporter of unknown specificity" FT /fasta_file="fasta/c11D3.tab.seq.01589.out" FT CDS complement(join(147871..149503,149606..149784)) FT /colour=7 FT /gene="SPAC11D3.07c" FT /label=SPAC11D3.07c FT /note="SPAC11D3.07c, len:603, FT SIMILARITY:Schizosaccharomyces pombe, O94573, putative FT transcriptional regulator, zinc finger, binuclear FT clusterdomain containing., (595 aa), fasta scores: opt: FT 1180, E():0, (35.1% identity in 619 aa)" FT /product="putative transcriptional regulator; zinc finger FT protein; fungal binuclear cluster domain" FT /fasta_file="fasta/c11D3.tab.seq.01590.out" FT misc_feature complement(149683..149769) FT /colour=8 FT /note="PS00463 fungal Zn(2)-Cys(6) binuclear cluster FT domain" FT CDS complement(150232..151884) FT /colour=7 FT /gene="SPAC11D3.08c" FT /label=SPAC11D3.08c FT /note="SPAC11D3.08c, len:550, SIMILARITY:Saccharomyces FT cerevisiae, UGA4_YEAST, gaba-specific permease, (571 aa), FT fasta scores: opt: 1009, E():0, (32.8% identity in 524 aa)" FT /product="APC amino acid transporter" FT /fasta_file="fasta/c11D3.tab.seq.01591.out" FT CDS 152521..153705 FT /EC_number="3.5.3.11" FT /colour=7 FT /gene="SPAC11D3.09" FT /label=SPAC11D3.09 FT /note="SPAC11D3.09, len:394, FT SIMILARITY:Schizosaccharomyces pombe, O42887, arginase FT family protein., (413 aa), fasta scores: opt: 815, E():0, FT (50.4% identity in 389 aa)" FT /product="arginase family protein; putative agmatinase; no FT apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c11D3.tab.seq.01592.out" FT misc_feature 152755..152826 FT /note="Match to PF00491 arginase, Arginase family Score FT 34.60" FT misc_feature 153052..153159 FT /note="Match to PF00491 arginase, Arginase family Score FT 20.36" FT misc_feature 153334..153582 FT /note="Match to PF00491 arginase, Arginase family Score FT 94.68" FT CDS 155258..156562 FT /colour=7 FT /gene="SPAC11D3.10" FT /label=SPAC11D3.10 FT /note="SPAC11D3.10, len:434, FT SIMILARITY:Schizosaccharomyces pombe, O74542, nifs homolog, FT putative aminotransferase., (396 aa), fasta scores: opt: FT 1603, E():0, (58.5% identity in 390 aa)" FT /product="nifS homolog, putative aminotransferase" FT /fasta_file="fasta/c11D3.tab.seq.01593.out" FT CDS complement(join(156841..157704,157704..158735, FT 158779..158803,158848..158861)) FT /colour=4 FT /gene="SPAC11D3.11c" FT /gene="SPAC11D3.12c" FT /label=SPAC11D3.11c FT /note="SPAC11D3.11c, len:644, FT SIMILARITY:Schizosaccharomyces pombe, O74915, putative FT transcriptional activator, zinc finger containing., (684 FT aa), fasta scores: opt: 1914, E():0, (46.9% identity in FT 616 aa)" FT /product="putative transcriptional activator; zinc finger FT protein" FT /pseudo FT /fasta_file="fasta/c11D3.tab.seq.01594.out" FT misc_feature 157701..157811 FT /note="PCR verified framshift in 972h-" FT misc_feature complement(158667..158744) FT /note="Match to PF00172 Zn_clus, fungal Zn(2)-Cys(6) FT binuclear cluster domain Score 38.71" FT misc_feature complement(158736..158751) FT /colour=2 FT /note=" putative splice branch and acceptor sequence, FT ctaac tacaattaaag" FT misc_feature complement(158773..158778) FT /colour=2 FT /note=" putative splice donor sequence, gtattc" FT misc_feature complement(158804..158820) FT /colour=2 FT /note=" putative splice branch and acceptor sequence, FT tacta accaatatctag" FT misc_feature complement(158842..158847) FT /colour=2 FT /note=" putative splice donor sequence, gtaagg" FT CDS 160005..160673 FT /colour=10 FT /gene="SPAC11D3.13" FT /label=SPAC11D3.13 FT /note="SPAC11D3.13, len:222, FT SIMILARITY:Schizosaccharomyces pombe, O43084, hypothetical FT 28.5 kD protein., (261 aa), fasta scores: opt: 617, FT E():9.2e-33, (50.8% identity in 181 aa)" FT /product="conserved protein; contains ThiJ domain" FT /fasta_file="fasta/c11D3.tab.seq.01595.out" FT CDS complement(160995..164777) FT /colour=7 FT /gene="SPAC11D3.14c" FT /label=SPAC11D3.14c FT /note="SPAC11D3.14, len:1260, SIMILARITY:Rattus norvegicus, FT OPLA_RAT, 5-oxoprolinase, (1288 aa), fasta scores: opt: FT 4011, E():0, (50.6% identity in 1272 aa)" FT /product="putative oxoprolinase" FT /fasta_file="fasta/c11D3.tab.seq.01596.out" FT misc_feature 165254 FT /note="true left end of c5H10" FT CDS 166007..169960 FT /colour=7 FT /gene="SPAC11D3.15" FT /label=SPAC11D3.15 FT /note="SPAC11D3.15, len:1317, SIMILARITY:Saccharomyces FT cerevisiae, YKV5_YEAST, hypothetical 140.4 kD protein in FT ura1-doa1 intergenic region., (1286 aa), fasta scores: FT opt: 4764, E():0, (57.3% identity in 1296 aa)" FT /product="putative oxoprolinase" FT /fasta_file="fasta/c11D3.tab.seq.01597.out" FT CDS complement(170481..170876) FT /colour=8 FT /gene="SPAC11D3.16c" FT /label=SPAC11D3.16c FT /note="SPAC11D3.16c, len:131" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c11D3.tab.seq.01598.out" FT CDS 172351..174108 FT /colour=7 FT /gene="SPAC11D3.17" FT /label=SPAC11D3.17 FT /note="SPAC11D3.17, len:585, SIMILARITY:Drosophila FT melanogaster, BTD_DROME, transcription factor btd, (644 FT aa), fasta scores: opt: 195, E():1.9e-05, (27.3% identity FT in 154 aa)" FT /product="zinc finger protein; zf-C2H2 type" FT /fasta_file="fasta/c11D3.tab.seq.01599.out" FT misc_feature 172447..172509 FT /colour=8 FT /note="PS00028 zinc finger, C2H2 type, domain" FT misc_feature 172531..172596 FT /colour=8 FT /note="PS00028 zinc finger, C2H2 type, domain" FT CDS complement(174538..176034) FT /colour=7 FT /gene="SPAC11D3.18c" FT /label=SPAC11D3.18c FT /note="SPAC11D3.18c, len:498, SIMILARITY:Saccharomyces FT cerevisiae, YG5H_YEAST, putative transporter ygr260w., FT (534 aa), fasta scores: opt: 1035, E():0, (34.0% identity FT in 483 aa)" FT /product="MFS transporter of unknown specificity" FT /fasta_file="fasta/c11D3.tab.seq.01600.out" FT misc_feature 176118..176123 FT /note="nominal overlap with cosmid SPAC5H10, EM:Z49811 FT S.pombe chromosome 1" FT misc_feature 176118..176123 FT /note="nominal overlap with cosmid SPAC11D3, EM:Z68166 FT S.pombe chromosome 1" FT CDS 176650..177555 FT /colour=10 FT /gene="SPAC5H10.01" FT /note="SPAC5H10.01, len:301, SIMILARITY:Bacillus subtilis., FT YCSI_BACSU, hypothetical 28.1 kD protein, (257 aa), FT fasta scores: opt: 723, E():0, (45.1% identity in 253 aa)" FT /product="hypothetical protein; Pfam-B:PB028175; no FT apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c5H10.tab.seq.01762.out" FT CDS complement(177889..178611) FT /colour=10 FT /gene="SPAC5H10.02c" FT /note="SPAC5H10.02c, len:240, FT SIMILARITY:Schizosaccharomyces pombe, O74914, conserved FT hypothetical protein, (244 aa), fasta scores: opt: 986, FT E():0, (60.7% identity in 234 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YPL280W" FT /fasta_file="fasta/c5H10.tab.seq.01763.out" FT rRNA 179334..179452 FT /gene="5SrRNA" FT /note="5S rRNA gene" FT /product="5SrRNA" FT CDS 181589..182248 FT /colour=7 FT /gene="SPAC5H10.03" FT /note="SPAC5H10.03, len:219, FT SIMILARITY:Schizosaccharomyces pombe, CAB58725, FT hypothetical 25.2 kD protein., (216 aa), fasta scores: FT opt: 479, E():4.5e-25, (35.6% identity in 205 aa)" FT /product="putative phosphoglycerate mutase" FT /fasta_file="fasta/c5H10.tab.seq.01764.out" FT misc_feature 181619..181648 FT /note="PS00175 Phosphoglycerate mutase family FT phosphohistidine signature" FT CDS 183063..184211 FT /EC_number="1.6.99.1" FT /colour=7 FT /gene="SPAC5H10.04" FT /note="SPAC5H10.04, len:382, FT SIMILARITY:Schizosaccharomyces pombe, OYEB_SCHPO, putative FT nadph dehydrogenase c5h10.10, (392 aa), fasta scores: opt: FT 1542, E():0, (57.5% identity in 381 aa)" FT /product="putative NADPH dehydrogenase" FT /fasta_file="fasta/c5H10.tab.seq.01765.out" FT misc_feature 183078..184121 FT /note="Match to oxidored_FMN , Score 649.99" FT CDS complement(184483..185073) FT /colour=7 FT /gene="SPAC5H10.05c" FT /note="SPAC5H10.05c, len:196, SIMILARITY:Escherichia coli., FT MDAB_ECOLI, modulator of drug activity b., (193 aa), FT fasta scores: opt: 778, E():0, (56.8% identity in 190 aa)" FT /product="NADHdh_2 domain protein; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c5H10.tab.seq.01766.out" FT CDS complement(186224..187492) FT /EC_number="1.1.1.1" FT /colour=7 FT /gene="SPAC5H10.06c" FT /note="SPAC5H10.06c, len:422, SIMILARITY:Saccharomyces FT cerevisiae, ADH4_YEAST, alcohol dehydrogenase iv, (465 aa), FT fasta scores: opt: 1511, E():0, (55.7% identity in 415 FT aa)" FT /product="iron containing alcohol dehydrogenase" FT /fasta_file="fasta/c5H10.tab.seq.01767.out" FT misc_feature complement(186251..187339) FT /note="Pfam match to entry Fe-ADH PF00465, Iron-containing FT alcohol dehydrogenases" FT misc_feature complement(186530..186577) FT /note="PS00060 Iron-containing alcohol dehydrogenases FT signature 2" FT misc_feature complement(186761..186856) FT /note="PS00913 Iron-containing alcohol dehydrogenases FT signature 1" FT CDS 188879..189148 FT /colour=8 FT /gene="SPAC5H10.07" FT /note="SPAC5H10.07, len:89" FT /note="putative est" FT /product="hypothetical protein; sequence orphan; has EST" FT /fasta_file="fasta/c5H10.tab.seq.01768.out" FT CDS complement(189770..190621) FT /EC_number="6.3.2.1" FT /colour=7 FT /gene="SPAC5H10.08c" FT /note="SPAC5H10.08c, putative pantoate--beta-alanine FT ligase len: 283, similar to SW:PANC_ECOLI P31663 pantoate-- FT beta-alanine ligase, (59.6% identity in 277 aa overlap)" FT /note="SPAC5H10.08c, len:283, SIMILARITY:Escherichia coli., FT PANC_ECOLI, pantoate--beta-alanine ligase, (283 aa), FT fasta scores: opt: 1105, E():0, (59.6% identity in 277 aa)" FT /product="putative pantoate--beta-alanine ligase" FT /fasta_file="fasta/c5H10.tab.seq.01769.out" FT CDS complement(190653..191456) FT /EC_number="2.1.2.11" FT /colour=7 FT /gene="SPAC5H10.09c" FT /note="SPAC5H10.09c, putative 3-methyl-2-oxobutanoate FT hydroxymethyltransferase, len: 267, similar to FT SW:PANB_ECOLI, P31057, 3-methyl-2-oxobutanoate FT hydroxymethyltransferase (67.9% identity in 265 aa FT overlap)" FT /note="SPAC5H10.09c, len:267, SIMILARITY:Escherichia coli., FT PANB_ECOLI, 3-methyl-2-oxobutanoate FT hydroxymethyltransferase, (264 aa), fasta scores: opt: FT 1180, E():0, (67.9% identity in 265 aa)" FT /product="putative 3-methyl-2-oxobutanoate FT hydroxymethyltransferase" FT /fasta_file="fasta/c5H10.tab.seq.01770.out" FT CDS 192636..193814 FT /EC_number="1.6.99.1" FT /colour=7 FT /gene="SPAC5H10.10" FT /note="SPAC5H10.10, len:392, FT SIMILARITY:Schizosaccharomyces pombe, OYEA_SCHPO, putative FT nadph dehydrogenase c5h10.04, (382 aa), fasta scores: opt: FT 1542, E():0, (57.5% identity in 381 aa)" FT /product="putative NADPH dehydrogenase" FT /fasta_file="fasta/c5H10.tab.seq.01771.out" FT misc_feature 192669..193715 FT /note="Match to oxidored_FMN , Score 648.36" FT CDS 194404..195393 FT /colour=7 FT /gene="gmh1" FT /gene="SPAC5H10.11" FT /label=gmh1 FT /note="SPAC5H10.11, len:329, FT SIMILARITY:Schizosaccharomyces pombe, YDB6_SCHPO, FT hypothetical 38.1 kD protein c22e12.06c in chromosome i., FT (332 aa), fasta scores: opt: 1068, E():0, (47.9% identity FT in 317 aa)" FT /product="putative galactosyltransferase; high similarity FT to Gmh3p, an alpha-1,2-galactosyltransferase" FT /fasta_file="fasta/c5H10.tab.seq.01772.out" FT CDS complement(196096..197211) FT /colour=12 FT /gene="B20341-3" FT /gene="SPAC5H10.12c" FT /label=B20341-3 FT /note="SPAC5H10.12c, len:371, FT SIMILARITY:Schizosaccharomyces pombe, O43062, hypothetical FT 44.1 kD protein., (376 aa), fasta scores: opt: 1288, E():0, FT (49.1% identity in 373 aa)" FT /note="putative gatactosyltransferase" FT /product="Pfam-B_20341; possibly S. pombe specific" FT /fasta_file="fasta/c5H10.tab.seq.01773.out" FT CDS complement(198486..199526) FT /colour=7 FT /gene="gmh2" FT /gene="SPAC5H10.13c" FT /note="SPAC5H10.13c, len:346, FT SIMILARITY:Schizosaccharomyces pombe, YA0B_SCHPO, putative FT galactosyltransferase, (329 aa), fasta scores: opt: 1016, FT E():0, (47.3% identity in 332 aa)" FT /product="putative galactosyltransferase; similar to Gmh3p, FT an alpha-1,2-galactosyltransferase" FT /fasta_file="fasta/c5H10.tab.seq.01774.out" FT misc_feature complement(200816..200959) FT /note="Match to helicase_C , Score 32.43" FT misc_feature 200838..200962 FT /note="nominal overlap with cosmid SPAC13G6, EM:Z54308 FT S.pombe chromosome 1" FT misc_feature 200838..200962 FT /note="overlap with cosmid SPAC5H10, EM:Z49811 S.pombe FT chromosome 1" FT misc_feature complement(200840..201067) FT /colour=9 FT /note="Pfam match to entry PF00271 helicase_C, Helicases FT co nserved C-terminal domain" FT misc_feature complement(201284..201421) FT /colour=9 FT /note="Pfam match to entry PF00097 zf-C3HC4, zinc finger, FT C 3HC4 type (RING finger)" FT misc_feature complement(201581..201775) FT /colour=9 FT /note="Pfam match to entry PF00176 SNF2_N, SNF2 and others FT N-terminal domain" FT misc_feature complement(201947..202180) FT /colour=9 FT /note="Pfam match to entry PF00176 SNF2_N, SNF2 and others FT N-terminal domain" FT misc_feature complement(202289..202708) FT /colour=9 FT /note="Pfam match to entry PF00176 SNF2_N, SNF2 and others FT N-terminal domain" FT CDS complement(204689..205447) FT /colour=2 FT /gene="rps3a-1" FT /gene="rps1-1" FT /gene="SPAC13G6.02c" FT /label=rps1-1 FT /note="SPAC13G6.02c, len:252aa" FT /product="40S ribosomal protein S3a(S1)" FT /fasta_file="fasta/c13G6.tab.seq.00459.out" FT misc_feature complement(204782..205417) FT /colour=9 FT /note="Pfam match to entry PF01015 Ribosomal_S3Ae, FT Ribosomal S3Ae family, score 497.60, E-value 9.3e-146" FT promoter complement(205502..205509) FT /colour=4 FT /note="Homol D box" FT CDS 206968..209244 FT /colour=7 FT /gene="SPAC13G6.03" FT /label=SPAC13G6.03 FT /note="SPAC13G6.03, len:758, SIMILARITY:Caenorhabditis FT elegans, Q19870, f28c6.4 protein, (795 aa), fasta scores: FT opt: 1049, E():0, (33.4% identity in 709 aa)" FT /product="putative glycosylphospatidylinositol FT modification by similar to las21" FT /fasta_file="fasta/c13G6.tab.seq.00460.out" FT CDS join(210099..210204,210262..210452) FT /colour=2 FT /gene="tim8" FT /gene="SPAC13G6.04" FT /label=tim8 FT /note="SPAC13G6.04, len:98aa" FT /product="small mitochondrial carrier import zinc finger FT protein tim8" FT /fasta_file="fasta/c13G6.tab.seq.00461.out" FT misc_feature 210205..210210 FT /colour=6 FT /note="gtatga, splice donor sequence" FT intron 210205..210261 FT /note="intron confirmed by EST coverage" FT misc_feature 210245..210261 FT /colour=6 FT /note="ctaatccaaaaccttag, splice branch and acceptor" FT CDS complement(join(210753..211112,211161..211250, FT 211308..211425,211677..211846)) FT /colour=7 FT /gene="SPAC13G6.05c" FT /label=SPAC13G6.05c FT /note="SPAC13G6.05c, len:245, SIMILARITY:Homo sapiens, FT O75865, r32611_2, (160 aa), fasta scores: opt: 310, FT E():1.9e-12, (34.4% identity in 157 aa)" FT /product="Possibly required for modification of FT glycosylphosphatidylinositol (GPI) by similar to S. FT cerevisiae las21,gpi13" FT /fasta_file="fasta/c13G6.tab.seq.00462.out" FT misc_feature complement(211113..211130) FT /colour=6 FT /note="ctaatcgtttctttttag, splice branch and acceptor" FT misc_feature complement(211155..211160) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature complement(211251..211270) FT /colour=6 FT /note="ctaacggtttaaaaatttag, splice branch and acceptor" FT misc_feature complement(211302..211307) FT /colour=6 FT /note="gtacaa, splice donor sequence" FT misc_feature complement(211426..211437) FT /colour=6 FT /note="ttgattgaacag, splice branch and acceptor" FT misc_feature complement(211671..211676) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS complement(212652..215705) FT /EC_number="1.4.4.2" FT /colour=7 FT /gene="SPAC13G6.06c" FT /label=SPAC13G6.06c FT /note="SPAC13G6.06c, len:1017, SIMILARITY:Caenorhabditis FT elegans., Q21962, similar to glycine dehydrogenase., (979 FT aa), fasta scores: opt: 3081, E():0, (50.9% identity in FT 978 aa)" FT /product="putative glycine dehydrogenase (decarboxylating)" FT /fasta_file="fasta/c13G6.tab.seq.00463.out" FT CDS complement(216520..217239) FT /colour=2 FT /gene="rps6-1" FT /gene="SPAC13G6.07c" FT /label=rps6-1 FT /note="SPAC13G6.07c, len:239aa" FT /product="40S ribosomal protein S6" FT /fasta_file="fasta/c13G6.tab.seq.00464.out" FT misc_feature complement(216859..217239) FT /colour=9 FT /note="Pfam match to entry PF01092 Ribosomal_S6e, FT Ribosomal protein S6e, score 309.70, E-value 3.5e-89" FT misc_feature complement(217051..217086) FT /colour=8 FT /note="PS00578 Ribosomal protein S6e signature" FT misc_feature complement(217304..217311) FT /colour=4 FT /note="Homol D box" FT CDS 218053..219660 FT /colour=7 FT /gene="SPAC13G6.08" FT /label=SPAC13G6.08 FT /note="SPAC13G6.08c, len:535, FT SIMILARITY:Schizosaccharomyces pombe, O94411, putative wd- FT domain protein., (509 aa), fasta scores: opt: 1109, E():0, FT (39.6% identity in 487 aa)" FT /product="putative activator of anaphase promoting complex FT (APC); required for microtubule function at mitosis and FT for exit from anaphase; WD repeat protein" FT /fasta_file="fasta/c13G6.tab.seq.00465.out" FT misc_feature 218710..218826 FT /colour=9 FT /note="Pfam match to entry PF00400 WD40, WD domain, G-beta FT repeat, score 0.00, E-value 55" FT misc_feature 218833..218955 FT /colour=9 FT /note="Pfam match to entry PF00400 WD40, WD domain, G-beta FT repeat, score 2.80, E-value 24" FT misc_feature 218986..219102 FT /colour=9 FT /note="Pfam match to entry PF00400 WD40, WD domain, G-beta FT repeat, score 26.20, E-value 0.00079" FT misc_feature 219115..219237 FT /colour=9 FT /note="Pfam match to entry PF00400 WD40, WD domain, G-beta FT repeat, score 0.10, E-value 54" FT CDS join(219998..220260,220406..220967) FT /colour=7 FT /gene="SPAC13G6.09" FT /label=SPAC13G6.09 FT /note="SPAC13G6.09, len:274, SIMILARITY:Rattus norvegicus, FT RP8_RAT, zinc finger protein rp-8, (287 aa), fasta scores: FT opt: 326, E():6.5e-14, (30.9% identity in 194 aa)" FT /product="possibly associated with programmed cell death/ FT apoptosis by similar to C. elegans R07E5.10 and human and FT rat RP-8 proteins; Pfam-B_4773; no apparent S. cerevisiae FT ortholog" FT /fasta_file="fasta/c13G6.tab.seq.00466.out" FT misc_feature 220261..220266 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 220386..220405 FT /colour=6 FT /note="ctaactttacatttacttag, splice branch and acceptor" FT CDS complement(221972..223564) FT /colour=8 FT /gene="SPAC13G6.10c" FT /label=SPAC13G6.10c FT /note="SPAC13G6.10c, len:530, SIMILARITY:Leishmania major., FT CAB46679, proteophosphoglycan , (873 aa), fasta scores: FT opt: 418, E():2.4e-14, (40.1% identity in 247 aa)" FT /product="hypothetical serine-rich protein; sequence FT orphan; predicted N-terminal signal sequence" FT /fasta_file="fasta/c13G6.tab.seq.00467.out" FT CDS complement(join(223795..224934,225184..225258)) FT /EC_number="2.7.1.36" FT /colour=7 FT /gene="SPAC13G6.11c" FT /label=SPAC13G6.11c FT /note="SPAC13G6.11c, len:404, SIMILARITY:Homo sapiens, FT KIME_HUMAN, mevalonate kinase, (396 aa), fasta scores: FT opt: 722, E():0, (36.7% identity in 398 aa)" FT /product="putative mevalonate kinase" FT /fasta_file="fasta/c13G6.tab.seq.00468.out" FT misc_feature complement(224581..224616) FT /colour=8 FT /note="PS00627 GHMP kinases putative ATP-binding domain" FT misc_feature complement(224722..224934) FT /colour=9 FT /note="Pfam match to entry PF00288 GHMP_kinases, GHMP FT kinases putative ATP-binding proteins" FT misc_feature complement(224935..224946) FT /colour=6 FT /note="ctaactttctag, splice branch and acceptor" FT intron complement(224935..225183) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(225178..225183) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(225851..225863) FT /colour=6 FT /note="ctaactataatag, splice branch and acceptor" FT misc_feature complement(225891..225896) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(227318..227806) FT /colour=9 FT /note="Pfam match to entry PF01644 Chitin_synth, Chitin FT synthase, score 479.90, E-value 2e-140" FT misc_feature 227793..234318 FT /note="overlap with cosmid SPAC24B11 EM:Z67757, S. pombe FT chromosome 1" FT misc_feature 230079..230198 FT /colour=9 FT /note="Pfam match to entry PF00293 mutT, Bacterial mutT FT protein, score 25.10, E-value 1.2e-05" FT misc_feature 227793..234318 FT /note="nominal overlap with cosmid SPAC13G6, EM: Z54308 FT S.pombe chromosome 1" FT misc_feature 230079..230198 FT /colour=9 FT /note="Pfam match to entry PF00293 mutT, Bacterial mutT FT protein," FT CDS 234889..235569 FT /colour=7 FT /gene="SPAC24B11.05" FT /label=SPAC24B11.05 FT /note="SPAC24B11.05, len:226, SIMILARITY:Saccharomyces FT cerevisiae, YGX4_YEAST, hypothetical 32.0 kD protein in FT gog5-nif3 intergenic region., (280 aa), fasta scores: opt: FT 632, E():0, (44.2% identity in 224 aa)" FT /product="putative haloacid dehalogenase-like hydrolase" FT /fasta_file="fasta/c24B11.tab.seq.00788.out" FT misc_feature 234901..235473 FT /colour=9 FT /note="Pfam match to entry PF00702 Hydrolase, haloacid FT dehalogenase-like hydrolase," FT CDS complement(236540..237589) FT /colour=2 FT /gene="sty1" FT /gene="spc1" FT /gene="phh1" FT /gene="SPAC24B11.06c" FT /label=sty1 FT /note="SPAC24B11.06c, len:349" FT /product="serine/threonine protein kinase; stess activated FT MAP kinase (MAPK); acts downstream of 2 component response FT regulator; similar to S. cerevisiae HOG1" FT /fasta_file="fasta/c24B11.tab.seq.00789.out" FT misc_feature complement(236693..237532) FT /colour=9 FT /note="Pfam match to entry PF00069 pkinase, Eukaryotic FT protein kinase domain," FT misc_feature complement(237143..237181) FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT misc_feature complement(237488..237514) FT /colour=8 FT /note="PS00107 protein kinases ATP-binding region FT signature" FT CDS complement(239022..240707) FT /colour=8 FT /gene="SPAC24B11.07c" FT /label=SPAC24B11.07c FT /note="SPAC24B11.07c, len:561, similar to S. pombe FT SPCC1902.02" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c24B11.tab.seq.00790.out" FT CDS complement(241710..242882) FT /colour=7 FT /gene="SPAC24B11.08c" FT /label=SPAC24B11.08c FT /note="SPAC24B11.08c, len:390, SIMILARITY:Homo sapiens, FT AAD27763, hypothetical 43.2 kDa protein, (383 aa), fasta FT scores: opt: 763, E():0, (36.8% identity in 389 aa)" FT /product="involved in vesicular transport between the FT endoplasmic reticulum and Golgi apparatus by similar to S. FT cerevisiae erv46" FT /fasta_file="fasta/c24B11.tab.seq.00791.out" FT mRNA 245023..245224 FT /colour=3 FT /note="mRNA from AU008536, not associated with an ORF" FT CDS 246159..246515 FT /colour=10 FT /gene="SPAC24B11.09" FT /label=SPAC24B11.09 FT /note="SPAC24B11.09, len:118, SIMILARITY:Caenorhabditis FT elegans, YXX3_CAEEL, hypothetical 16.3 kD protein f53f10.3 FT in chromosome i, (145 aa), fasta scores: opt: 354, FT E():4.9e-20, (49.5% identity in 103 aa)" FT /product="conserved protein" FT /fasta_file="fasta/c24B11.tab.seq.00792.out" FT CDS complement(248333..251131) FT /colour=7 FT /gene="SPAC24B11.10c" FT /label=SPAC24B11.10c FT /note="Possibility of splicing at 3' end but extra exon FT (20311..20497) doesn't improve homology" FT /note="SPAC24B11.10c, len:93, SIMILARITY:Saccharomyces FT cerevisiae, SKT5_YEAST, skt5 protein., (696 aa), fasta FT scores: opt: 560, E():1.6e-23, (26.8% identity in 559 aa)" FT /product="similar to S. cerevisiae protoplast regeneration FT and killer toxin resistance protein" FT /fasta_file="fasta/c24B11.tab.seq.00793.out" FT CDS complement(251705..253528) FT /colour=2 FT /gene="sid2" FT /gene="SPAC24B11.11c" FT /label=sid2 FT /note="SPAC24B11.11c, len:606, SIMILARITY:Saccharomyces FT cerevisiae, DBFB_YEAST, protein kinase dbf20, (564 aa), FT fasta scores: opt: 1652, E():0, (45.7% identity in 575 aa)" FT /product="serine/threonine protein kinase; protein kinase FT C terminal domain; involved in cytokinesis; similar to S. FT cerevisiae DBF2 and DBF20" FT /fasta_file="fasta/c24B11.tab.seq.00794.out" FT misc_feature complement(251900..252004) FT /colour=9 FT /note="Pfam match to entry PF00433 pkinase_C, protein FT kinase C terminal domain," FT misc_feature complement(252005..252907) FT /colour=9 FT /note="Pfam match to entry PF00069 pkinase, Eukaryotic FT protein kinase domain," FT misc_feature complement(252512..252550) FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT misc_feature complement(252863..252889) FT /colour=8 FT /note="PS00107 protein kinases ATP-binding region FT signature" FT CDS complement(join(254072..257908,257988..258359)) FT /EC_number="3.6.3.1" FT /colour=7 FT /gene="SPAC24B11.12c" FT /label=SPAC24B11.12c FT /note="SPAC24B11.12c, len:1402, FT SIMILARITY:Schizosaccharomyces pombe, O36028, putative FT calcium-transporting atpase, (1367 aa), fasta scores: opt: FT 3138, E():0, (47.1% identity in 1247 aa)" FT /product="P-type calcium ATPase" FT /fasta_file="fasta/c24B11.tab.seq.00795.out" FT misc_feature complement(255690..256163) FT /colour=9 FT /note="Pfam match to entry PF00122 E1-E2_ATPase, E1-E2 FT ATPases," FT misc_feature complement(256556..256576) FT /colour=8 FT /note="PS00154 E1-E2 ATPases phosphorylation site" FT misc_feature complement(256620..256682) FT /colour=9 FT /note="Pfam match to entry PF00122 E1-E2_ATPase, E1-E2 FT ATPases," FT misc_feature complement(257909..257926) FT /colour=2 FT /note="splice branch and acceptor sequence, FT tactaacgttttatg tag" FT misc_feature complement(257982..257987) FT /colour=2 FT /note="splice donor sequence, gtatgc" FT misc_feature 259951..261706 FT /note="nominal overlap with cosmid SPAC806, EM:AL117212 S. FT pombe chromosome 1" FT misc_feature 261349..261705 FT /colour=9 FT /note="Pfam match to entry PF01379 Porphobil_deam, FT Porphobilinogen deaminase," FT misc_feature 259951..261706 FT /note="nominal overlap with cosmid SPAC24B11, EM:Z67757 S. FT pombe chromosome 1" FT misc_feature 261349..262269 FT /note="Match to PF01379 Porphobil_deam, Porphobilinogen FT deaminase Score 606.68" FT CDS complement(join(262907..264729,264779..264782)) FT /colour=7 FT /gene="SPAC806.02c" FT /label=SPAC806.02c FT /note="SPAC806.02c, len:608, SIMILARITY:Saccharomyces FT cerevisiae, YIA3_YEAST, hypothetical 31.9 kD protein in FT bet1-pan1 intergenic region., (293 aa), fasta scores: opt: FT 926, E():0, (55.9% identity in 286 aa)" FT /product="WD repeat protein" FT /fasta_file="fasta/c806.tab.seq.00720.out" FT misc_feature complement(262916..262990) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 20.31" FT misc_feature complement(263252..263347) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 40.01" FT misc_feature complement(263384..263494) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 30.42" FT misc_feature complement(263519..263629) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 47.84" FT misc_feature complement(263780..263893) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 36.97" FT misc_feature complement(264730..264744) FT /colour=6 FT /note="ttaactttataatag, splice branch and acceptor" FT misc_feature complement(264773..264778) FT /colour=6 FT /note="gtaaat, splice donor sequence" FT CDS complement(265329..265691) FT /colour=2 FT /gene="rps26-1" FT /gene="SPAC806.03c" FT /label=rps26 FT /note="SPAC806.03c, len:120, SIMILARITY:Neurospora crassa., FT RS26_NEUCR, 40S ribosomal protein S26e, (119 aa), fasta FT scores: opt: 614, E():0, (71.4% identity in 119 aa)" FT /product="40S ribosomal protein S26" FT /fasta_file="fasta/c806.tab.seq.00721.out" FT misc_feature complement(265353..265691) FT /note="Match to PF01283 Ribosomal_S26e, Ribosomal protein FT S26e Score 246.59" FT misc_RNA complement(266725..267524) FT /note="misc RNA associated with spc02611 spc02031, FT possiible celllular RNA as no obvious open reading frame FT or spliced gene in this region" FT CDS complement(join(271102..271213,271265..271369, FT 271411..272491,272593..272617)) FT /colour=10 FT /gene="SPAC806.04c" FT /label=SPAC806.04c FT /note="SPAC806.04c, len:429, FT SIMILARITY:Schizosaccharomyces pombe, O94725, hypothetical FT 50.1 kD protein., (442 aa), fasta scores: opt: 1822, E():0, FT (60.5% identity in 441 aa)" FT /product="conserved protein" FT /fasta_file="fasta/c806.tab.seq.00722.out" FT misc_feature complement(271214..271227) FT /colour=6 FT /note="ctaacaggaaatag, splice branch and acceptor" FT misc_feature complement(271259..271264) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(271370..271380) FT /colour=6 FT /note="ctaaactacag, splice branch and acceptor" FT misc_feature complement(271405..271410) FT /colour=6 FT /note="gtgctt, splice donor sequence" FT misc_feature complement(272492..272511) FT /colour=6 FT /note="ttaatgctttgttaacctag, splice branch and acceptor" FT misc_feature complement(272587..272592) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 273341..273344 FT /note="True l.h end of c1639 S. pombe chromosome 1" FT CDS 274407..274784 FT /colour=9 FT /gene="SPAC806.05" FT /label=SPAC806.05 FT /note="SPAC806.05, len:125" FT /product="very hypothetical protein" FT /fasta_file="fasta/c806.tab.seq.00723.out" FT CDS complement(274980..276077) FT /colour=7 FT /gene="SPAC806.06c" FT /label=SPAC806.06c FT /note="SPAC806.06c, len:365, SIMILARITY:Saccharomyces FT cerevisiae, Q06178, chromosome xii cosmid 8543., (401 aa), FT fasta scores: opt: 1344, E():0, (72.1% identity in 272 aa)" FT /product="putative nicotinamide mononucleotide (NMN) FT adenylyltransferase; similar to S. cerevisiae YLR328W" FT /fasta_file="fasta/c806.tab.seq.00724.out" FT CDS 277604..278059 FT /EC_number="2.7.4.6" FT /colour=2 FT /gene="ndk1" FT /gene="SPAC806.07" FT /label=ndk1 FT /note="SPAC806.07, len:151" FT /product="nucleoside diphosphate kinase" FT /fasta_file="fasta/c806.tab.seq.00725.out" FT misc_feature 277613..278056 FT /note="Match to PF00334 NDK, Nucleoside diphosphate FT kinases Score 335.35" FT CDS complement(278356..280212) FT /colour=8 FT /gene="SPAC806.08c" FT /label=SPAC806.08c FT /note="SPAC806.08c, len:618, SIMILARITY:Neisseria FT meningitidis., Q51281, alpha-2,8-polysialyltransferase, FT (495 aa), fasta scores: opt: 125, E():0.91, (20.5% FT identity in 298 aa)" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c806.tab.seq.00021.out" FT misc_feature 280539..282820 FT /note="nominal overlap with cosmid SPAC1639, EM:AL117213 FT S. pombe chromosome 1" FT misc_feature complement(join(281585..282013,282068..282428)) FT /note="Match to PF01151 GNS1_SUR4, GNS1/SUR4 family Score FT 315.69" FT misc_feature complement(282014..282029) FT /colour=6 FT /note="ctaacatacgttttag, splice branch and acceptor" FT misc_feature complement(282062..282067) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(282429..282442) FT /colour=6 FT /note="ctaacaatttttag, splice branch and acceptor" FT misc_feature complement(282615..282620) FT /colour=6 FT /note="gtatta, splice donor sequence" FT misc_feature 280539..282820 FT /note="nominal overlap with cosmid SPAC806, EM:AL117212 S. FT pombe chromosome 1" FT misc_feature complement(join(281585..282000,282055..282448)) FT /note="Match to PF01151 GNS1_SUR4, GNS1/SUR4 family Score FT 315.69" FT misc_feature complement(282014..282029) FT /colour=6 FT /note="ctaacatacgttttag, splice branch and acceptor" FT misc_feature complement(282062..282067) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(282429..282442) FT /colour=6 FT /note="ctaacaatttttag, splice branch and acceptor" FT misc_feature complement(282615..282620) FT /colour=6 FT /note="gtatta, splice donor sequence" FT misc_feature complement(284795..286139) FT /note="nominal overlap with cosmid SPAC1F5, EM:Z68136 S. FT pombe chromosome 1" FT misc_feature complement(285811..285831) FT /colour=6 FT /note="ctaacggtttatttactttag, splice branch and acceptor" FT misc_feature complement(286015..286020) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 284795..286139 FT /note="nominal overlap with cosmid SPAC1639, EM:AL117213 FT S. pombe chromosome 1" FT misc_feature complement(285811..285831) FT /colour=6 FT /note="ctaacggtttatttactttag, splice branch and acceptor" FT misc_feature complement(286015..286020) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(286047..286067) FT /colour=6 FT /note="ttaacgattttaaaaaaacag, splice branch and acceptor" FT misc_feature complement(286097..286102) FT /colour=6 FT /note="gtgagt, splice donor sequence" FT misc_feature complement(286122..286136) FT /colour=6 FT /note="ctaataatggtttag, splice branch and acceptor" FT misc_feature complement(286212..286217) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(286289..286302) FT /colour=6 FT /note="ttaactcataaaag, splice branch and acceptor" FT misc_feature complement(286354..286359) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(286427..286438) FT /colour=6 FT /note="ttaacggaatag, splice branch and acceptor" FT misc_feature complement(286467..286472) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(286686..286701) FT /colour=6 FT /note="ctaaatagctttttag, splice branch and acceptor" FT misc_feature complement(286725..286730) FT /colour=6 FT /note="gtaaat, splice donor sequence" FT misc_feature complement(286747..286761) FT /colour=6 FT /note="ctaacaatggactag, splice branch and acceptor" FT misc_feature complement(286786..286791) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(286812..286822) FT /colour=6 FT /note="ctgatcattag, splice branch and acceptor" FT misc_feature complement(286849..286854) FT /colour=6 FT /note="gtaagg, splice donor sequence" FT misc_feature complement(286858..286873) FT /colour=6 FT /note="ctaacgtttaatttag, splice branch and acceptor" FT misc_feature complement(286899..286904) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(287861..287871) FT /colour=6 FT /note="ttgacctttag, splice branch and acceptor" FT misc_feature complement(287890..287895) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(288797..288811) FT /colour=6 FT /note="ttaactattttttag, splice branch and acceptor" FT misc_feature complement(288831..288836) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT CDS join(289395..289458,289520..300423) FT /colour=7 FT /gene="SPAC1F5.11c" FT /label=SPAC1F5.11c FT /note="SPAC1F5.11c, len:3655, SIMILARITY:Saccharomyces FT cerevisiae, YHP9_YEAST, hypothetical 433.2 kD strong FT similar to human TRRAP protein, (3744 aa), fasta scores: FT opt: 2959, E():0, (33.3% identity in 3828 aa)" FT /product="putative phosphatidylinositol kinase; TPR domain FT protein; similar to S. cerevisiae TRA1" FT /fasta_file="fasta/c1F5.tab.seq.02048.out" FT misc_feature 289459..289464 FT /colour=6 FT /note="gtatat, splice donor sequence" FT misc_feature 289505..289519 FT /colour=6 FT /note="ctaactttttttaag, splice branch and acceptor" FT misc_feature 293356..293379 FT /note="PS00017 ATP/GTP-binding site motif A" FT misc_feature 295891..295947 FT /note="PS00095 C-5 cytosine-specific DNA methylasesC- FT termin al signature" FT CDS complement(join(300696..301792,301846..301866, FT 301933..301999)) FT /colour=2 FT /gene="tif412" FT /gene="SPAC1F5.10" FT /label=tif412 FT /note="SPAC1F5.10, len:394" FT /product="eukaryotic initiation factor 4a" FT /fasta_file="fasta/c1F5.tab.seq.02049.out" FT misc_feature complement(300816..301055) FT /note="Match to PF00271 helicase_C, Helicases conserved C- FT terminal domain Score 131.36" FT misc_feature complement(301170..301781) FT /note="Match to PF00270 DEAD, DEAD/DEAH box helicase Score FT 185.78" FT misc_feature complement(301353..301379) FT /note="PS00039 DEAD-box subfamily ATP-dependent FT helicasessi gnature" FT misc_feature complement(301665..301688) FT /note="PS00017 ATP/GTP-binding site motif A" FT misc_feature complement(301793..301806) FT /colour=6 FT /note="ctaacaacatgcag, splice branch and acceptor" FT misc_feature complement(301840..301845) FT /colour=6 FT /note="gttagt, splice donor sequence" FT misc_feature complement(301867..301883) FT /colour=6 FT /note="ctaacattgttttgcag, splice branch and acceptor" FT misc_feature complement(301927..301932) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS 302828..304597 FT /colour=2 FT /gene="shk2" FT /gene="pak2" FT /gene="SPAC1F5.09c" FT /label=shk2 FT /note="SPAC1F5.09c, len:589" FT /product="serine/threonine protein kinase; pleckstrain FT homology domain; P21 activated MAP kinase shk2" FT /fasta_file="fasta/c1F5.tab.seq.02050.out" FT misc_feature 302894..303193 FT /note="Match to PF00169 PH, PH domain Score 29.58" FT misc_feature 303212..303388 FT /note="Match to PF00786 PBD, P21-Rho-binding domain Score FT 114.90" FT misc_feature 303752..304525 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 301.44" FT misc_feature 304115..304153 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT CDS 304765..306225 FT /colour=2 FT /gene="yam8" FT /gene="ehs1" FT /gene="SPAC1F5.08c" FT /note="SPAC1F5.08c, len:486, SIMILARITY:Saccharomyces FT cerevisiae, MID1_YEAST, mid1 protein., (548 aa), fasta FT scores: opt: 514, E():1.2e-24, (30.7% identity in 433 aa)" FT /product="calcium channel; similar to S. cerevisiae MID1" FT /fasta_file="fasta/c1F5.tab.seq.02051.out" FT CDS 306569..308041 FT /EC_number="1.3.3.4" FT /colour=7 FT /gene="SPAC1F5.07c" FT /label=SPAC1F5.07c FT /note="SPAC1F5.07c, len:490, SIMILARITY:Homo sapiens, FT PPOX_HUMAN, protoporphyrinogen oxidase, (477 aa), fasta FT scores: opt: 568, E():4.1e-29, (31.1% identity in 492 aa)" FT /product="putative protoporphyrinogen oxidase" FT /fasta_file="fasta/c1F5.tab.seq.02052.out" FT CDS complement(308275..310821) FT /colour=7 FT /gene="SPAC1F5.06" FT /label=SPAC1F5.06 FT /note="SPAC1F5.06, len:848, SIMILARITY:Homo sapiens, FT AAC50947, 150 kDa oxygen-regulated protein orp150., (999 FT aa), fasta scores: opt: 961, E():0, (36.6% identity in 454 FT aa)" FT /product="heast shock protein 70 family" FT /fasta_file="fasta/c1F5.tab.seq.02053.out" FT misc_feature complement(309676..309720) FT /note="PS01036 Heat shock hsp70 proteins family signature3" FT CDS 311625..312080 FT /colour=8 FT /gene="SPAC1F5.05c" FT /label=SPAC1F5.05c FT /note="SPAC1F5.05c, len:151" FT /product="hypothetical protein; sequence orphan; has EST" FT /fasta_file="fasta/c1F5.tab.seq.02054.out" FT CDS 313152..318677 FT /colour=2 FT /gene="cdc12" FT /gene="SPAC1F5.04c" FT /label=cdc12 FT /note="SPAC1F5.04c, len:1841" FT /product="formin; required for actin ring assembly; FT predicted regulator of cell polarity" FT /fasta_file="fasta/c1F5.tab.seq.02055.out" FT CDS join(319628..319661,319863..320977) FT /colour=10 FT /gene="SPAC1F5.03c" FT /label=SPAC1F5.03c FT /note="SPAC1F5.03c, len:382, SIMILARITY:Saccharomyces FT cerevisiae, YHG9_YEAST, hypothetical 57.0 kD protein in FT sod2-rpl27a intergenic region., (518 aa), fasta scores: FT opt: 303, E():1.8e-12, (30.6% identity in 496 aa);" FT /product="putative oxidoreductase; similar to D-amino-acid FT oxidases; similar to S. cerevisiae YHR009C" FT /fasta_file="fasta/c1F5.tab.seq.02056.out" FT misc_feature 319662..319667 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 319845..319862 FT /colour=6 FT /note="ctaacaaatatttttcag, splice branch and acceptor" FT CDS complement(321936..323414) FT /EC_number="5.3.4.1" FT /colour=7 FT /gene="SPAC1F5.02" FT /label=SPAC1F5.02 FT /note="SPAC1F5.02, len:492, SIMILARITY:Trichoderma reesei, FT O74568, protein disulphide isomerase ., (502 aa), fasta FT scores: opt: 1330, E():0, (41.5% identity in 499 aa)" FT /product="putative protein disulphide isomerase" FT /fasta_file="fasta/c1F5.tab.seq.02057.out" FT misc_feature complement(322251..322271) FT /note="PS00194 Thioredoxin family active site" FT misc_feature complement(323034..323354) FT /note="Match to PF00085 thiored, Thioredoxin Score 151.08" FT misc_feature complement(323253..323273) FT /note="PS00194 Thioredoxin family active site" FT misc_feature complement(324156..325036) FT /note="overlap with cosmid SPAC18B11, EM:Z50728 S.pombe FT chromosome I" FT misc_feature complement(324156..325036) FT /note="overlap with cosmid SPAC1F5, EM:Z68136 S.pombe FT chromosome 1" FT CDS complement(join(329304..330939,331112..331196, FT 331264..331387)) FT /colour=2 FT /gene="tup11" FT /gene="SPAC18B11.10" FT /label=tup11 FT /note="SPAC18B11.10, len:614, SIMILARITY:Neurospora FT crassa., RCO1_NEUCR, transcriptional repressor rco-1., FT (604 aa), fasta scores: opt: 1424, E():0, (42.5% identity FT in 626 aa)" FT /product="Transcriptional repressor functioning FT redundantly with Tup12p; homolog of S. cerevisiae Tup1p FT glucose repression regulatory protein; WD repeat protein; FT subcellular localization of GFP fusion- Nucleus" FT /fasta_file="fasta/c18B11.tab.seq.02022.out" FT misc_feature complement(329325..329426) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 42.08" FT misc_feature complement(329451..329567) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 33.49" FT misc_feature complement(329610..329654) FT /colour=8 FT /note="PS00678 Beta-transducin family Trp-Asp repeats FT signa ture" FT misc_feature complement(329616..329729) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 53.72" FT misc_feature complement(329736..329822) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 29.02" FT misc_feature complement(329856..329900) FT /colour=8 FT /note="PS00678 Beta-transducin family Trp-Asp repeats FT signa ture" FT misc_feature complement(329859..329972) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 61.40" FT misc_feature complement(329982..330026) FT /colour=8 FT /note="PS00678 Beta-transducin family Trp-Asp repeats FT signa ture" FT misc_feature complement(329985..330065) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 30.97" FT misc_feature complement(330940..330952) FT /colour=6 FT /note="ctaacatttatag, splice branch and acceptor" FT misc_feature complement(331106..331111) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(331197..331218) FT /colour=6 FT /note="ctaacattctgttctattgcag, splice branch and acceptor" FT misc_feature complement(331258..331263) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 332396..332505 FT /note="similar to a region inteRNAl to predicted protein FT sequence SPBC16H5.13 70% at the DNA level" FT CDS join(332837..332907,333010..333316,333392..333469, FT 333528..333695) FT /colour=7 FT /gene="SPAC18B11.09c" FT /label=SPAC18B11.09c FT /note="SPAC18B11.09c, len:207, SIMILARITY:Saccharomyces FT cerevisiae, YJV8_YEAST, putative acetyltransferase, (196 FT aa), fasta scores: opt: 459, E():0, (40.7% identity in 189 FT aa ov erlap)" FT /product="putative acetyltransferase; similar to S. FT cerevisiae YJL218W" FT /fasta_file="fasta/c18B11.tab.seq.02023.out" FT misc_feature 332908..332913 FT /colour=6 FT /note="gtaagg, splice donor sequence" FT misc_feature 332992..333009 FT /colour=6 FT /note="ctaattactaaataacag, splice branch and acceptor" FT misc_feature 333185..333223 FT /colour=9 FT /note="Pfam match to entry PF00132 hexapep, Bacterial FT transferase hexapeptide (four repeats)" FT misc_feature 333293..333397 FT /colour=9 FT /note="Pfam match to entry PF00132 hexapep, Bacterial FT transferase hexapeptide (four repeats)" FT misc_feature 333317..333322 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 333374..333391 FT /colour=6 FT /note="ctaatggtgtctttccag, splice branch and acceptor" FT misc_feature 333470..333475 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 333505..333527 FT /colour=6 FT /note="ctaacaaacaaaattttatcaag, splice branch and acceptor" FT misc_feature 333528..333632 FT /note="Match to PF00132 hexapep, Bacterial transferase FT hexapeptide (four repeats) Score 72.86" FT misc_feature 333546..333632 FT /colour=8 FT /note="PS00101 Bacterial hexapeptide-repeat containing- FT tran sferases signature" FT CDS join(334139..334211,334350..334407,334447..334536, FT 334595..334631,334676..334705) FT /colour=10 FT /gene="SPAC18B11.08c" FT /label=SPAC18B11.08c FT /note="SPAC18B11.08c, len:95, SIMILARITY:Saccharomyces FT cerevisiae, Q12160, hypothetical 15.4 kD protein ypr056c., FT (140 aa), fasta scores: opt: 103, E():0.18, (28.0% FT identity in 118 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YPR063C" FT /fasta_file="fasta/c18B11.tab.seq.00034.out" FT misc_feature 334212..334217 FT /colour=6 FT /note="gtaaag, splice donor sequence" FT misc_feature 334335..334349 FT /colour=6 FT /note="ctaaccctattatag, splice branch and acceptor" FT misc_feature 334408..334413 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 334436..334446 FT /colour=6 FT /note="ttaacgagaag, splice branch and acceptor" FT misc_feature 334537..334542 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 334580..334594 FT /colour=6 FT /note="ttaacatttgatcag, splice branch and acceptor" FT misc_feature 334632..334637 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 334663..334675 FT /colour=6 FT /note="ttaacttgtgcag, splice branch and acceptor" FT CDS join(335399..335440,335488..335552,335766..335886, FT 335992..336095,336144..336267) FT /EC_number="6.3.2.19" FT /colour=2 FT /gene="rhp6" FT /gene="ubc2" FT /gene="SPAC18B11.07c" FT /label=rhp6 FT /note="SPAC18B11.07c, len:151" FT /product="ubiquitin-conjugating enzyme e2-17 kD; similar FT to S. cerevisiae RAD6" FT /fasta_file="fasta/c18B11.tab.seq.02025.out" FT misc_feature 335441..335446 FT /colour=6 FT /note="gtacgg, splice donor sequence" FT misc_feature 335473..335487 FT /colour=6 FT /note="ttaaccaattcttag, splice branch and acceptor" FT misc_feature join(335488..335552,335766..335886,335992..336095, FT 336144..336252) FT /note="Match to PF00179 UQ_con, Ubiquitin-conjugating FT enzyme Score 213.59" FT misc_feature 335553..335558 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 335750..335765 FT /colour=6 FT /note="ctaaccatttgagcag, splice branch and acceptor" FT misc_feature 335887..335892 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 335974..335991 FT /colour=6 FT /note="cttacttattggctttag, splice branch and acceptor" FT misc_feature 335992..336036 FT /colour=8 FT /note="PS00183 Ubiquitin-conjugating enzymes active site" FT misc_feature 336096..336101 FT /colour=6 FT /note="gtttgc, splice donor sequence" FT misc_feature 336133..336143 FT /colour=6 FT /note="ctaacttttag, splice branch and acceptor" FT CDS complement(336640..337623) FT /colour=7 FT /gene="SPAC18B11.06" FT /label=SPAC18B11.06 FT /note="SPAC18B11.06, len:327, SIMILARITY:Saccharomyces FT cerevisiae, YEV7_YEAST, hypothetical 40.8 kD protein in FT rsp5-pak1 intergenic region., (357 aa), fasta scores: opt: FT 204, E():2.6e-05, (27.6% identity in 308 aa)" FT /product="putative U3 snoRNP component; required for pre- FT 18S rRNA processing; similar to S. cerevisiae LCP5" FT /fasta_file="fasta/c18B11.tab.seq.02026.out" FT CDS complement(338057..339337) FT /colour=10 FT /gene="SPAC18B11.05" FT /label=SPAC18B11.05 FT /note="SPAC18B11.05, len:426, SIMILARITY:Saccharomyces FT cerevisiae, YBL4_YEAST, hypothetical 50.8 kD protein in FT coq1-flr1 intergenic region ., (433 aa), fasta scores: FT opt: 320, E():1.9e-13, (29.4% identity in 446 aa)" FT /product="protein similar to YBR004C expresssed between 3 FT and 6 hours after transfer to sporulation medium" FT /fasta_file="fasta/c18B11.tab.seq.02027.out" FT CDS complement(join(340335..340466,340513..340856, FT 340975..341007,341047..341110)) FT /colour=7 FT /gene="SPAC18B11.04" FT /label=SPAC18B11.04 FT /note="SPAC18B11.04, len:190, SIMILARITY:Mus musculus, FT AAD01642, neuronal calcium sensor-1., (190 aa), fasta FT scores: opt: 910, E():0, (69.5% identity in 190 aa)" FT /product="related to neuronal calcium sensor 1 proteins" FT /fasta_file="fasta/c18B11.tab.seq.02028.out" FT misc_feature complement(340383..340463) FT /note="Match to PF00036 efhand, EF hand Score 32.76" FT misc_feature complement(340401..340439) FT /colour=8 FT /note="PS00018 EF-hand calcium-binding domain" FT misc_feature complement(340467..340481) FT /colour=6 FT /note="ctaataattttttag, splice branch and acceptor" FT misc_feature complement(340507..340512) FT /colour=6 FT /note="gtttga, splice donor sequence" FT misc_feature complement(340570..340647) FT /note="Match to PF00036 efhand, EF hand Score 26.35" FT misc_feature complement(340591..340629) FT /colour=8 FT /note="PS00018 EF-hand calcium-binding domain" FT misc_feature complement(340684..340752) FT /note="Match to PF00036 efhand, EF hand Score 33.86" FT misc_feature complement(340699..340737) FT /colour=8 FT /note="PS00018 EF-hand calcium-binding domain" FT misc_feature complement(340857..340871) FT /colour=6 FT /note="ctaacaagtatgcag, splice branch and acceptor" FT misc_feature complement(340969..340974) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(341008..341021) FT /colour=6 FT /note="ctaacaaatccaag, splice branch and acceptor" FT misc_feature complement(341041..341046) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT CDS 341940..343262 FT /colour=10 FT /gene="SPAC18B11.03c" FT /label=SPAC18B11.03c FT /note="SPAC18B11.03c, len:440, SIMILARITY:Saccharomyces FT cerevisiae, YG4K_YEAST, hypothetical 54.5 kD protein in FT zpr1-rta1 intergenic region., (468 aa), fasta scores: opt: FT 160, E():0.0018, (22.8% identity in 452 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YGR212W" FT /fasta_file="fasta/c18B11.tab.seq.02029.out" FT CDS 343706..344890 FT /colour=7 FT /gene="SPAC18B11.02c" FT /label=SPAC18B11.02c FT /note="SPAC18B11.02c, len:394, SIMILARITY:Saccharomyces FT cerevisiae, YD36_YEAST, hypothetical 53.4 kD protein in FT prp9-nat1 intergenic region., (462 aa), fasta scores: opt: FT 1120, E():0, (47.8% identity in 393 aa)" FT /product="putative DRAP deaminase; riboflavin biosynthesis FT pathway; similar to S. cerevisiae RIB2" FT /fasta_file="fasta/c18B11.tab.seq.02030.out" FT misc_feature 344027..344497 FT /note="Match to PF00849 YABO, Hypothetical yabO/yceC/sfhB FT family Score 232.59" FT misc_feature 345383..345691 FT /note="Match to PF00752 XPG_N, XPG N-terminal domain Score FT 183.41" FT misc_feature 346238..346519 FT /note="Match to PF00867 XPG_I, XPG I-region Score 148.50" FT misc_feature complement(346643..347002) FT /note="nominal overlap with cosmid SPAC12G12, EM:Z66568 S. FT pombe chromosome 1" FT CDS complement(join(346986..347138,347190..347848, FT 347897..348617)) FT /colour=10 FT /gene="SPAC12G12.15" FT /label=SPAC12G12.15 FT /note="SPAC12G12.15, len:510, SIMILARITY:Saccharomyces FT cerevisiae, YFL8_YEAST, hypothetical 75.9 kD protein in FT sap155-ymr31 intergenic region., (662 aa), fasta scores: FT opt: 808, E():0, (32.7% identity in 587 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YFR048W" FT /fasta_file="fasta/c12G12.tab.seq.00551.out" FT misc_feature complement(346643..347002) FT /note="nominal overlap with cosmid SPAC18B11, EM:Z50728 S. FT pombe chromosome 1" FT misc_feature complement(347139..347158) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacataagcagct tgaag" FT misc_feature complement(347184..347189) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature complement(347849..347862) FT /colour=2 FT /note="splice branch and accxeptor sequence, FT tattaacgccattt ag" FT misc_feature complement(347891..347896) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT CDS 349650..351179 FT /colour=7 FT /gene="SPAC12G12.14c" FT /label=SPAC12G12.14c FT /note="SPAC12G12.14c, len:509, SIMILARITY:Saccharomyces FT cerevisiae, YN57_YEAST, hypothetical 53.1 kD trp-asp FT repeats containing protein in hxt14-pha2intergenic region., FT (465 aa), fasta scores: opt: 967, E():0, (37.9% identity FT in 472 aa)" FT /product="putative polyadenylation factor I subunit; mRNA FT 3'-end processing; WD repeat protein; similar to S. FT cerevisiae PFS2" FT /fasta_file="fasta/c12G12.tab.seq.00552.out" FT misc_feature 350109..350225 FT /colour=9 FT /note="Pfam match to entry PF00400 G-beta, WD domain, G- FT bet a repeat" FT misc_feature 350235..350351 FT /colour=9 FT /note="Pfam match to entry PF00400 G-beta, WD domain, G- FT bet a repeat" FT misc_feature 350361..350483 FT /colour=9 FT /note="Pfam match to entry PF00400 G-beta, WD domain, G- FT bet a repeat" FT misc_feature 350493..350612 FT /colour=9 FT /note="Pfam match to entry PF00400 G-beta, WD domain, G- FT bet a repeat" FT misc_feature 350697..350813 FT /colour=9 FT /note="Pfam match to entry PF00400 G-beta, WD domain, G- FT bet a repeat" FT CDS 351804..353654 FT /colour=2 FT /function="essential gene required for normal chromosome FT segregation" FT /gene="cid14" FT /gene="SPAC12G12.13c" FT /label=cid14 FT /note="SPAC12G12.13c, len:616, SIMILARITY:Saccharomyces FT cerevisiae, TRF4_YEAST, topoisomerase 1-related protein FT trf4., (584 aa), fasta scores: opt: 896, E():0, (31.5% FT identity in 603 aa)" FT /product="putative DNA polymerase sigma; putative FT nucleotidyl transferase; essential; required for normal FT chromosome segregation; similar to S. cerevisiae TRF4 and FT TRF5" FT /fasta_file="fasta/c12G12.tab.seq.00553.out" FT CDS complement(join(353870..354083,354138..354842, FT 354901..354956)) FT /colour=7 FT /gene="SPAC12G12.12" FT /label=SPAC12G12.12 FT /note="SPAC12G12.12, len:324, LOW SIMILARITY:., FT Schizosaccharomyces pombe, O59769, UDP-galactose FT transporter homolog., (329 aa), fasta scores: opt: 185, FT E(): 5.2e-05, (24.0% identity in 329 aa)" FT /product="NST UDP-galactose transporter; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c12G12.tab.seq.00554.out" FT misc_feature complement(354084..354101) FT /colour=2 FT /note="splice branch and acceptor sequence, FT tactaacgttccaac cttag" FT misc_feature complement(354132..354137) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature complement(354843..354863) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacaaatcatcca aatag" FT misc_feature complement(354895..354900) FT /colour=2 FT /note="splice donor sequence, gtcagt" FT CDS join(356370..356532,356618..357067,357174..357658) FT /colour=10 FT /gene="SPAC12G12.11c" FT /label=SPAC12G12.11c FT /note="SPAC12G12.11c, len:365, SIMILARITY:Saccharomyces FT cerevisiae, Q08930, chromosome xvi reading frame orf FT ypl191c., (360 aa), fasta scores: opt: 287, E():3.7e-11, FT (28.7% identity in 327 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YPL191C; predicted coiled-coil" FT /fasta_file="fasta/c12G12.tab.seq.00555.out" FT misc_feature 356533..356538 FT /colour=2 FT /note="splice donor sequence, gtaatc" FT misc_feature 356602..356617 FT /colour=2 FT /note="splice branch and acceptor sequence, FT cttactttgtattca g" FT misc_feature 357068..357073 FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature 357158..357173 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacacttcaaata g" FT CDS complement(357898..359160) FT /colour=10 FT /gene="SPAC12G12.10" FT /label=SPAC12G12.10 FT /note="SPAC12G12.10, len:420," FT /product="hypothetical protein; contains 2 WD-repeat FT domains" FT /fasta_file="fasta/c12G12.tab.seq.00556.out" FT CDS complement(359486..362419) FT /colour=8 FT /gene="SPAC12G12.09" FT /label=SPAC12G12.09 FT /note="SPAC12G12.09, len:977," FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c12G12.tab.seq.00557.out" FT CDS complement(363371..364012) FT /colour=7 FT /gene="SPAC12G12.08" FT /label=SPAC12G12.08 FT /note="SPAC12G12.08, len:213, SIMILARITY:Saccharomyces FT cerevisiae, RM06_YEAST, 60S ribosomal protein L6, FT mitochondrial , (214 aa), fasta scores: opt: 434, E():1.5e- FT 22, (39.1% identity in 161 aa)" FT /product="mitochondrial ribosomal protein L6" FT /fasta_file="fasta/c12G12.tab.seq.00558.out" FT misc_feature complement(363407..363892) FT /colour=9 FT /note="Pfam match to entry PF00347 L6, Ribosomal protein FT L6" FT misc_feature complement(363422..363448) FT /colour=8 FT /note="PS00525 Ribosomal protein L6 signature 1" FT CDS join(364336..364458,364506..365621) FT /colour=10 FT /gene="SPAC12G12.07c" FT /label=SPAC12G12.07c FT /note="SPAC12G12.07c, len:412," FT /product="hypothetical protein; similar to A. thaliana FT T7N9.15; has domain similar to integrin-a cytoplasmic FT region; predicted coiled-coil region; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c12G12.tab.seq.00056.out" FT misc_feature 364459..364464 FT /colour=2 FT /note="splice donor sequence, gtaaga" FT intron 364459..364505 FT /colour=2 FT /note="confirmed intron" FT misc_feature 364490..364505 FT /colour=2 FT /note="splice branch and acceptor sequence, FT cttactaaatctgta g" FT misc_feature 366104..367177 FT /colour=9 FT /note="Pfam match to entry PF01137 RCT, RNA 3'-terminal FT pho sphate cyclase" FT CDS 366104..367195 FT /colour=7 FT /gene="SPAC12G12.06c" FT /label=SPAC12G12.06c FT /note="SPAC12G12.06c, len:363, SIMILARITY:Saccharomyces FT cerevisiae, RTC1_YEAST, RNA 3'-terminal phosphate cyclase, FT (367 aa), fasta scores: opt: 924, E():0, (41.7% identity FT in 367 aa)" FT /product="putative RNA 3'-terminal phosphate cyclase" FT /fasta_file="fasta/c12G12.tab.seq.00560.out" FT CDS 368068..368559 FT /colour=7 FT /gene="SPAC12G12.05c" FT /label=SPAC12G12.05c FT /note="SPAC12G12.05c, len:163, SIMILARITY:Saccharomyces FT cerevisiae, YM75_YEAST, hypothetical 17.3 kD protein in FT RNA1-rnt1 intergenic region., (157 aa), fasta scores: opt: FT 422, E():1.9e-20, (45.9% identity in 133 aa) also shows FT some similar to, Homo sapiens, T2D7_HUMAN, transcription FT initiation factor tfIID 31Kd subunit., (264 aa), fasta FT scores: opt: 385, E(): 7.1e-18, (38.7% identity in 150 aa)" FT /product="putative transcription initiation factor TFIID FT subunit; TAF(II) complex (TBP-associated protein complex); FT putative SAGA complex ; possibly involved in chromatin FT architecture; similar to S. cerevisiae TAF17" FT /fasta_file="fasta/c12G12.tab.seq.00561.out" FT snRNA 369224..369318 FT /evidence=EXPERIMENTAL FT /function="guide for 2'-O-ribose methylation of rRNA" FT /gene="snr52" FT /product="snr52" FT CDS complement(369783..371531) FT /colour=2 FT /gene="hsp60" FT /gene="mcp60" FT /gene="SPAC12G12.04" FT /label=hsp60 FT /note="SPAC12G12.04, len:582" FT /product="puative mitochondrial chaperonin 60; putative FT succinate dehydrogenase assembly; heat shock protein 60" FT /fasta_file="fasta/c12G12.tab.seq.00562.out" FT misc_feature complement(369852..371372) FT /colour=9 FT /note="Pfam match to entry PF00118 cpn60_TCP1, TCP-1/cpn60 FT chaperonin family" FT CDS complement(373075..374805) FT /colour=10 FT /gene="SPAC12G12.03" FT /label=SPAC12G12.03 FT /note="SPAC12G12.03, len:576, FT SIMILARITY:Schizosaccharomyces pombe, O42923, hypothetical FT 53.5 kD protein c16a3.18 in chromosome ii., (490 aa), FT fasta scores: opt: 710, E():0, (33.8% identity in 517 aa)" FT /product="putative RNA-binding protein; subcellular FT localization of GFP fusion- cytoplasm" FT /fasta_file="fasta/c12G12.tab.seq.00563.out" FT misc_feature complement(373891..374106) FT /colour=9 FT /note="Pfam match to entry PF00076 rrm, RNA recognition FT mot if. (aka RRM, RBD, or RNP domain)" FT misc_feature complement(373966..373989) FT /colour=8 FT /note="PS00030 Eukaryotic putative RNA-binding region RNP- FT 1 signature" FT misc_feature 375295..378737 FT /note="nominal overlap with cosmid SPAC630, EM:AL109832 S. FT pombe chromosome 1" FT misc_feature complement(375728..375740) FT /colour=2 FT /note="splice branch and acceptor sequence, FT tactaacctatttag" FT misc_feature complement(375784..375789) FT /colour=2 FT /note="splice donor sequence, gtatgt" FT misc_feature complement(375921..375933) FT /colour=2 FT /note="splice branch and acceptor sequence, FT tactgattttctcag" FT misc_feature complement(375977..375982) FT /colour=2 FT /note="splice donor sequence, gtatga" FT misc_feature complement(376116..376130) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacttcctttaag" FT misc_feature complement(376214..376219) FT /colour=2 FT /note="gtgtgt, splice donor sequence" FT misc_feature complement(375295..378737) FT /note="nominal overlap with cosmid SPAC12G12, EM:Z66568 S. FT pombe chromosome 1" FT CDS join(380153..380187,380251..380274,380347..380875, FT 380971..381570,381636..381731) FT /colour=2 FT /gene="act2" FT /gene="SPAC630.03" FT /label=act2 FT /note="SPAC630.03, len:427" FT /product=" ARP2/3 actin-organizing complex; involved in FT actin assembly and function; actin-like protein; null FT lethal; possibly involved in cell polarity; possibly FT involved in endocytosis; similar to S. cerevisiae ARP3" FT /fasta_file="fasta/c630.tab.seq.01057.out" FT misc_feature 380504..380875 FT /note="Match to PF00022 actin, Actin Score 125.95" FT misc_feature 380974..381609 FT /note="Match to PF00022 actin, Actin Score 86.49" FT CDS complement(382103..382603) FT /colour=9 FT /gene="SPAC630.04c" FT /label=SPAC630.04c FT /note="SPAC630.04c, len:166," FT /product="very hypothetical protein" FT /fasta_file="fasta/c630.tab.seq.01058.out" FT CDS 383576..385807 FT /colour=7 FT /gene="SPAC630.05" FT /label=SPAC630.05 FT /note="SPAC630.05, len:743, SIMILARITY:Yarrowia lipolytica, FT O14440, GTPase activating protein., (730 aa), fasta FT scores: opt: 1191, E():0, (36.7% identity in 735 aa)" FT /product="TBC domain protein; putative GTPase activating FT protein of Rab-like GTPase" FT /fasta_file="fasta/c630.tab.seq.01059.out" FT misc_feature 384803..385546 FT /note="Match to PF00566 TBC, TBC domain Score 189.56" FT CDS complement(join(385909..386109,386187..386268, FT 386311..386580,386660..386673)) FT /colour=8 FT /gene="SPAC630.06c" FT /label=SPAC630.06c FT /note="SPAC630.06c, len:188," FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c630.tab.seq.01060.out" FT CDS complement(387269..388561) FT /colour=8 FT /gene="SPAC630.07c" FT /label=SPAC630.07c FT /note="SPAC630.07c, len:430," FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c630.tab.seq.01061.out" FT CDS complement(389736..390638) FT /colour=7 FT /gene="SPAC630.08c" FT /label=SPAC630.08c FT /note="SPAC630.08c, len:300, SIMILARITY:Saccharomyces FT cerevisiae, ER25_YEAST, c-4 methyl sterol oxidase, (309 FT aa), fasta scores: opt: 1283, E():0, (57.0% identity in FT 298 aa)" FT /product="putative c-4 methyl sterol oxidase" FT /fasta_file="fasta/c630.tab.seq.01062.out" FT CDS 391233..391550 FT /colour=8 FT /gene="SPAC630.15" FT /label=SPAC630.15 FT /note="SPAC630.15 len:110aa" FT /product="hypothetical protein; sequence orphan; poor FT correlation score; has transcript profile on microarray" FT /fasta_file="fasta/c630.tab.seq.01063.out" FT CDS complement(392445..393278) FT /colour=10 FT /gene="SPAC630.09c" FT /label=SPAC630.09c FT /note="SPAC630.09c, len:277, SIMILARITY:Saccharomyces FT cerevisiae, YG4F_YEAST, hypothetical 33.3 kD protein in FT ade3-ser2 intergenic region., (290 aa), fasta scores: opt: FT 516, E():7e-26, (37.5% identity in 283 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YGR205W" FT /fasta_file="fasta/c630.tab.seq.01064.out" FT tRNA 394831..394902 FT /note="tRNA Pro anticodon TGG, Cove score 71.02" FT CDS 395226..396038 FT /colour=10 FT /gene="SPAC630.10" FT /label=SPAC630.10 FT /note="SPAC630.10, len:270, SIMILARITY:Saccharomyces FT cerevisiae, YBZ1_YEAST, hypothetical 38.5 kD protein in FT ira1-mak5 intergenic region., (337 aa), fasta scores: opt: FT 428, E():5.5e-22, (36.8% identity in 253 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YBR141C;" FT /fasta_file="fasta/c630.tab.seq.01065.out" FT CDS join(396477..396493,396549..396567,396644..396716, FT 396799..396865,396969..397024,397071..397207) FT /colour=7 FT /gene="SPAC630.11" FT /label=SPAC630.11 FT /note="SPAC630.11, len:122, SIMILARITY:Saccharomyces FT cerevisiae, YJ14_YEAST, hypothetical 15.7 kD protein in FT nup85-ssc1 intergenic region (140 aa), fasta scores: opt: FT 299, E():1.2e-14, (42.3% identity in 130 aa)" FT /product=" similar to Drosophila yakuba NADH dehydrogenase FT chain 5" FT /fasta_file="fasta/c630.tab.seq.01066.out" FT CDS 398248..399516 FT /colour=7 FT /gene="SPAC630.12" FT /label=SPAC630.12 FT /note="SPAC630.12, len:422, SIMILARITY:Saccharomyces FT cerevisiae, CC1_YEAST, cell division control protein 1., FT (491 aa), fasta scores: opt: 881, E():0, (39.2% identity FT in 352 aa)" FT /product="putative serine/threonine specific protein FT phosphatase; similar to S. cerevisiae CDC1" FT /fasta_file="fasta/c630.tab.seq.01067.out" FT CDS complement(399621..403640) FT /colour=7 FT /gene="SPAC630.13c" FT /label=SPAC630.13c FT /note="SPAC630.13c, len:1339, FT SIMILARITY:Schizosaccharomyces pombe, YA3B_SCHPO, FT hypothetical 149.2 kD protein c18b11.11 in chromosome i., FT (1294 aa), fasta scores: opt: 620, E():0, (21.2% identity FT in 1289 aa). C-terminal similar to eg. rat, TSC2_RAT, FT tuberin (tuberous sclerosis 2 homolog protein), (1809 aa), FT fasta scores: opt: 576, E(): 6.2e-31, (34.9% identity in FT 347 aa)" FT /product="putative GTPase activating protein; Rap_GAp FT domain; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c630.tab.seq.01068.out" FT CDS complement(join(404359..405506,405770..406122, FT 406520..406607,406669..406840)) FT /colour=2 FT /gene="tup1" FT /gene="SPAC630.14c" FT /label=tup1 FT /note="SPAC630.14c, len:586. identicle to FT schizosaccharomyces pombe, O14432, TUP1, except we predict FT a different met due to homology. the O14432, TUP1 cDNA is FT truncated." FT /product="general transcriptional repressor tup1" FT /fasta_file="fasta/c630.tab.seq.01069.out" FT misc_feature complement(404374..404475) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 40.28" FT misc_feature complement(404500..404616) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 42.93" FT misc_feature complement(404665..404778) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 54.77" FT misc_feature complement(404788..404892) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 33.14" FT misc_feature complement(404908..405012) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 50.23" FT misc_feature complement(405034..405114) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 34.00" FT intron complement(405507..405769) FT /colour=2 FT /note="confirmed intron" FT misc_feature 405904..407294 FT /note="nominal overlap with cosmid SPAC1751, EM:AL133154 FT S. pombe chromosome 1" FT intron complement(406123..406519) FT /colour=2 FT /note="confirmed intron" FT intron complement(406608..406668) FT /colour=2 FT /note="confirmed intron" FT misc_feature 407095..407294 FT /note="nominal overlap with cosmid SPAC630, EM:AL109832 S. FT pombe chromosome 1" FT CDS complement(407868..410030) FT /colour=2 FT /gene="gti1" FT /gene="SPAC1751.01c" FT /label=gti1 FT /note="SPAC1751.01c, len:720" FT /product="required for gluconate-H+ symport" FT /fasta_file="fasta/c1751.tab.seq.00117.out" FT misc_feature 410294..414302 FT /note="low complexity gene-free region" FT misc_feature 413876..414025 FT CDS join(414303..414426,414488..414564,414662..414736, FT 414801..414896) FT /colour=8 FT /gene="SPAC1751.04" FT /label=SPAC1751.04 FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c1751.tab.seq.00118.out" FT misc_feature 414814..415044 FT CDS complement(join(415431..415563,415614..415719, FT 415783..415855,415972..415986)) FT /colour=7 FT /gene="SPAC1751.02c" FT /label=SPAC1751.02c FT /note="SPAC1751.02c, len:108, SIMILARITY:Saccharomyces FT cerevisiae, YN8L_YEAST, putative 40S ribosomal protein FT ynr037c., (91 aa), fasta scores: opt: 345, E():5.1e-19, FT (56.5% identity in 85 aa)" FT /note="initiation is possibly at second Met, and upstream FT splicing possiply in 5' UTR" FT /product="mitochondrial ribosomal protein S19" FT /sigcleave_file="sigcleave/c1751.tab.seq.00001.out" FT /fasta_file="fasta/c1751.tab.seq.00119.out" FT misc_feature complement(415464..415550) FT /note="Match to PF00203 Ribosomal_S19, Ribosomal protein FT S19 Score 59.77" FT misc_feature complement(415564..415578) FT /colour=6 FT /note="ctaactaaattctag, splice branch and acceptor" FT misc_feature complement(415608..415613) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(415720..415731) FT /colour=6 FT /note="ctgacattatag, splice branch and acceptor" FT misc_feature complement(415777..415782) FT /colour=6 FT /note="gtaaat, splice donor sequence" FT misc_feature complement(415856..415874) FT /colour=6 FT /note="ttaacgattgctgcattag, splice branch and acceptor" FT misc_feature complement(415966..415971) FT /colour=6 FT /note="gttagt, splice donor sequence" FT misc_feature 416071..416076 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT intron 416071..416133 FT /note="intron confirmed by mRNA" FT misc_feature 416116..416133 FT /colour=6 FT /note="ctaacgaaatttcaaaag, splice branch and acceptor" FT misc_feature 416291..416296 FT /colour=6 FT /note="gtaatg, splice donor sequence" FT intron 416291..416461 FT /note="intron confirmed by mRNA" FT misc_feature 416448..416461 FT /colour=6 FT /note="ctaacacgaaacag, splice branch and acceptor" FT misc_feature 417210..417388 FT /note="nominal overlap with cosmid SPAC31A2, EM:Z50113 S. FT pombe chromosome 1" FT misc_feature 417210..417388 FT /note="nominal overlap with cosmid SPAC1751, EM:AL133154 FT S. pombe chromosome 1" FT CDS join(418076..418091,418128..418297,418397..418489, FT 418535..418636) FT /colour=10 FT /gene="SPAC31A2.02" FT /label=SPAC31A2.02 FT /note="SPAC31A2.02, len:126, SIMILARITY:Saccharomyces FT cerevisiae, YN8Q_YEAST, hypothetical 15.1 kD protein in FT pet494-mso1 intergenic region, (135 aa), fasta scores: FT opt: 294, E():2.5e-14, (46.2% identity in 130 aa)" FT /product="conserved protein" FT /fasta_file="fasta/c31A2.tab.seq.01121.out" FT misc_feature 418092..418097 FT /colour=2 FT /note="splice donor sequence, gtacga" FT misc_feature 418117..418127 FT /colour=2 FT /note="splice branch and acceptor sequence, ctaatgaatag" FT misc_feature 418298..418303 FT /colour=2 FT /note="splice donor sequence, gtttgt" FT misc_feature 418383..418396 FT /colour=2 FT /note="splice branch and acceptor sequence, ctaaccataactag" FT misc_feature 418490..418495 FT /colour=2 FT /note="splice donor sequence, gtatga" FT misc_feature 418518..418534 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaaccttaactact ag" FT CDS join(419219..419240,419293..419921) FT /colour=7 FT /gene="SPAC31A2.03" FT /label=SPAC31A2.03 FT /note="SPAC31A2.03, len:216, SIMILARITY:Citrus greening FT disease-associated bacterium-like organism, RL10_CGDAB, FT 50s ribosomal protein l10, (172 aa), fasta scores: opt: FT 134, E():0.022, (21.8% identity in 170 aa)" FT /product="mitochondrial ribosomal protein L10" FT /fasta_file="fasta/c31A2.tab.seq.01122.out" FT misc_feature 419241..419246 FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature 419270..419292 FT /colour=2 FT /note="splice branch and acceptor sequence, FT tacttacaatttttt atttttag" FT CDS complement(420265..420849) FT /EC_number="3.4.25.1" FT /colour=7 FT /gene="SPAC31A2.04c" FT /label=SPAC31A2.04c FT /note="SPAC31A2.04c, len:194, SIMILARITY:Saccharomyces FT cerevisiae, PRCG_YEAST, proteasome component c11, (198 aa), FT fasta scores: opt: 746, E():0, (53.9% identity in 193 FT aa)" FT /product="20S proteasome component (beta 4)" FT /fasta_file="fasta/c31A2.tab.seq.01123.out" FT misc_feature complement(420382..420843) FT /colour=9 FT /note="Pfam match to entry PF00227 proteasome, Proteasome FT A-type and B-type" FT CDS complement(join(421514..421591,421632..422288, FT 422328..422463,422504..424287,424332..424799, FT 424843..426178,426222..426417,426457..426553)) FT /colour=2 FT /gene="mis4" FT /gene="SPAC31A2.05c" FT /label=mis4 FT /note="SPAC31A2.05c, len:1583" FT /product="adherin; sister chromatid cohesion molecule; FT chromatin associated; required for S phase; similar to S. FT cerevisiae SCC2" FT /fasta_file="fasta/c31A2.tab.seq.01124.out" FT misc_feature complement(421592..421604) FT /colour=2 FT /note="splice branch and acceptor sequence, ctgactgttttag" FT intron complement(421592..421631) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(421626..421631) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature complement(422289..422303) FT /colour=2 FT /note="splice branch and acceptor sequence, FT tactaattaaattag" FT misc_feature complement(422322..422327) FT /colour=2 FT /note="splice donor sequence, gtatgc" FT misc_feature complement(422464..422477) FT /colour=2 FT /note="splice branch and acceptor sequence, ctaatttaatgcag" FT misc_feature complement(422498..422503) FT /colour=2 FT /note="splice donor sequence, gtatgt" FT misc_feature complement(424288..424300) FT /colour=2 FT /note="splice branch and acceptor sequence, tactaacttacag" FT misc_feature complement(424326..424331) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature complement(424800..424810) FT /colour=2 FT /note="splice branch and acceptor sequence, ctaacgtgtag" FT misc_feature complement(424837..424842) FT /colour=2 FT /note="splice donor sequence, gtatgt" FT misc_feature complement(426179..426193) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctgacaaatataaag" FT misc_feature complement(426216..426221) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature complement(426418..426430) FT /colour=2 FT /note="splice branch and acceptor sequence, ttaatttacatag" FT misc_feature complement(426451..426456) FT /colour=2 FT /note="splice donor sequence, gtatgc" FT LTR complement(426699..427046) FT /colour=4 FT /note="solo tf2 element, 97.4% identity in 349 bp overlap FT w ith EMBL:SPPROREVI" FT CDS 427385..429013 FT /colour=8 FT /gene="SPAC31A2.06" FT /label=SPAC31A2.06 FT /note="SPAC31A2.06, len:542" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c31A2.tab.seq.01125.out" FT CDS complement(join(429224..431547,431648..431870)) FT /colour=7 FT /gene="SPAC31A2.07c" FT /label=SPAC31A2.07c FT /note="SPAC31A2.07c, len:848, SIMILARITY:Saccharomyces FT cerevisiae, YD31_YEAST, putative ATP-dependent RNA FT helicase ydl031w., (995 aa), fasta scores: opt: 1128, FT E():0, (44.0% identity in 926 aa)" FT /product="putative ATP-dependent RNA helicase" FT /fasta_file="fasta/c31A2.tab.seq.01126.out" FT misc_feature complement(430548..430793) FT /colour=9 FT /note="Pfam match to entry PF00271 helicase_C, Helicases FT conserved C-terminal domain" FT misc_feature complement(430893..431615) FT /colour=9 FT /note="Pfam match to entry PF00270 DEAD, DEAD/DEAH box FT helicase" FT misc_feature complement(431411..431434) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A" FT misc_feature complement(431548..431562) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacttaattatag" FT misc_feature complement(431642..431647) FT /colour=2 FT /note="splice donor sequence, gtatgt" FT LTR 432085..432458 FT /colour=4 FT /note="solo LTR element, 72.2% identity in 335 bp overlap FT w ith tf2, EMBL:SPPPROREVI" FT CDS 432736..433221 FT /colour=7 FT /gene="SPAC31A2.08" FT /label=SPAC31A2.08 FT /note="SPAC31A2.08, len:161, SIMILARITY:Saccharomyces FT cerevisiae, RM41_YEAST, mitochondrial 60s ribosomal FT protein l41 , (263 aa), fasta scores: opt: 231, E():2.2e- FT 08, (38.4% identity in 99 aa)" FT /product="mitochondrial ribosomal protein L41 (L23)" FT /fasta_file="fasta/c31A2.tab.seq.01127.out" FT misc_feature 432754..433035 FT /colour=9 FT /note="Pfam match to entry PF00276 Ribosomal_L23, FT Ribosomal protein L23" FT CDS complement(join(433489..434755,434814..434878, FT 434917..434925)) FT /colour=2 FT /gene="apm4" FT /gene="SPAC31A2.09c" FT /label=apm4 FT /note="SPAC31A2.09c, len:446, SIMILARITY:Caenorhabditis FT elegans., AP50_CAEEL, clathrin coat assembly protein ap50, FT (441 aa), fasta scores: opt: 1212, E():0, (39.5% identity FT in 451 aa)" FT /product="Clathrin-associated protein (AP) complex, medium FT subunit" FT /fasta_file="fasta/c31A2.tab.seq.01128.out" FT misc_feature complement(433588..434913) FT /colour=9 FT /note="Pfam match to entry PF00928 Adap_comp_sub, Adaptor FT complexes medium subunit family" FT misc_feature complement(434756..434774) FT /colour=2 FT /note="splice branch-acceptor sequence, FT ctaatttttcatttgaaag" FT misc_feature complement(434808..434813) FT /colour=2 FT /note="splice donor sequence, gtatgt" FT misc_feature complement(434879..434891) FT /colour=2 FT /note="splice branch-acceptor sequence, ctaactatattag" FT misc_feature complement(434911..434916) FT /colour=2 FT /note="splice donor sequence, gttagt" FT CDS join(435478..435600,435640..435708,435810..435844, FT 435944..436136,436179..437141) FT /colour=10 FT /gene="SPAC31A2.10" FT /label=SPAC31A2.10 FT /note="SPAC31A2.10, len:460, FT SIMILARITY:Schizosaccharomyces pombe, CAA21820, FT hypothetical 61.3 kD protein., (551 aa), fasta scores: FT opt: 335, E():1.1e-14, (28.9% identity in 481 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YGL164C" FT /fasta_file="fasta/c31A2.tab.seq.01129.out" FT misc_feature 435601..435606 FT /colour=2 FT /note="splice donor sequence, gtatgt" FT misc_feature 435627..435639 FT /colour=2 FT /note="splice branch-acceptor sequence, ataacaaatttag" FT misc_feature 435709..435714 FT /colour=2 FT /note="splice donor sequence, gtatgc" FT misc_feature 435792..435809 FT /colour=2 FT /note="splice branch-acceptor sequence, ctaacttgaattttacag" FT misc_feature 435845..435850 FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature 435930..435943 FT /colour=2 FT /note="splice branch-acceptor sequence, ctaacttggaatag" FT misc_feature 436137..436142 FT /colour=2 FT /note="splice donor sequence," FT misc_feature 436163..436178 FT /colour=2 FT /note="splice branch-acceptor sequence, tactaatctgtaatag" FT CDS complement(437706..438941) FT /colour=2 FT /gene="cuf1" FT /gene="SPAC31A2.11c" FT /label=cuf1 FT /note="SPAC31A2.11c, len:411" FT /product="Cu metalloregulatory transcription factor 1; FT copper fist DNA binding domain; similar to S. cerevisiae FT MAC1" FT /fasta_file="fasta/c31A2.tab.seq.01130.out" FT misc_feature complement(438732..438767) FT /colour=8 FT /note="PS00022 EGF-like domain cysteine pattern signature" FT misc_feature complement(438822..438941) FT /colour=9 FT /note="Pfam match to entry PF00649 Copper-fist, Copper FT fist DNA-binding domain" FT CDS 441760..443550 FT /colour=10 FT /gene="SPAC31A2.12" FT /label=SPAC31A2.12 FT /note="SPAC31A2.12, len:596, FT SIMILARITY:Schizosaccharomyces pombe, CAB37428, FT hypothetical 65.3 kD protein., (594 aa), fasta scores: FT opt: 917, E():0, (32.9% identity in 586 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT ROD; similar to S. pombe SPCC584.15C" FT /fasta_file="fasta/c31A2.tab.seq.01131.out" FT CDS complement(join(444147..444305,444360..444476)) FT /colour=2 FT /gene="sft1" FT /gene="SPAC31A2.13c" FT /label=sft1 FT /note="SPAC31A2.13c, len:91, SIMILARITY:Kluyveromyces FT lactis, O74231, sft1p., (97 aa), fasta scores: opt: 125, FT E():0.0046, (34.4% identity in 90 aa)" FT /product="putative ER golgi V-SNARE" FT /fasta_file="fasta/c31A2.tab.seq.01132.out" FT misc_feature complement(444306..444324) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacctgtattatt atag" FT misc_feature complement(444354..444359) FT /colour=2 FT /note="splice acceptor sequence, gtatgt" FT CDS join(445082..445361,445439..448047) FT /colour=7 FT /gene="SPAC31A2.14" FT /label=SPAC31A2.14 FT /note="SPAC31A2.14, len:962, SIMILARITY:Caenorhabditis FT elegans, CAA86338, f35g12.4b protein., (683 aa), fasta FT scores: opt: 463, E():6.8e-19, (28.5% identity in 499 aa)" FT /product="WD repeat protein; possibly localizes to cell FT pole / septum from GFP data" FT /fasta_file="fasta/c31A2.tab.seq.01133.out" FT misc_feature 445286..445402 FT /colour=9 FT /note="Pfam match to entry PF00400 WD40, WD domain, G-beta FT repeat" FT misc_feature 445362..445367 FT /colour=2 FT /note="splice donor sequence, gtaagc" FT misc_feature 445418..445540 FT /colour=9 FT /note="Pfam match to entry PF00400 WD40, WD domain, G-beta FT repeat" FT misc_feature 445425..445438 FT /colour=2 FT /note="splice branch and acceptor sequence, ctaacatttattag" FT misc_feature 445697..445813 FT /colour=9 FT /note="Pfam match to entry PF00400 WD40, WD domain, G-beta FT repeat" FT CDS complement(join(448213..448896,448944..449178, FT 449278..449408)) FT /colour=8 FT /gene="SPAC31A2.15c" FT /label=SPAC31A2.15c FT /note="SPAC31A2.15c, len:349," FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c31A2.tab.seq.01134.out" FT misc_feature complement(448897..448912) FT /colour=2 FT /note="splice branch and acceptor sequence, ctaactctcaacag" FT misc_feature complement(448938..448943) FT /colour=2 FT /note="splice donor sequence, gtatgc" FT misc_feature complement(449179..449194) FT /colour=2 FT /note="splice branch and acceptor sequence FT ctaacatcgataatag" FT misc_feature complement(449272..449277) FT /colour=2 FT /note="splice donor sequence, gtatgt" FT CDS join(450142..452563,452602..452829,452875..452983, FT 453033..453579) FT /colour=7 FT /gene="SPAC31A2.16" FT /label=SPAC31A2.16 FT /note="SPAC31A2.16, len:1101," FT /product="RhoGEF domain; guanine nucleotide exchange FT factor; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c31A2.tab.seq.01135.out" FT misc_feature 450841..451431 FT /colour=9 FT /note="Pfam match to entry PF00621 RhoGEF, RhoGEF domain" FT misc_feature 452564..452569 FT /colour=2 FT /note="splice donor sequence, gtaata" FT misc_feature 452590..452601 FT /colour=2 FT /note="splice branch and acceptor sequence, ttaactgagcag" FT misc_feature 452830..452835 FT /colour=2 FT /note="splice donor sequence, gtatgt" FT misc_feature 452863..452874 FT /colour=2 FT /note="splice branch and acceptor sequence, ctaacattgaag" FT misc_feature 452984..452989 FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature 453021..453032 FT /colour=2 FT /note="splice branch and acceptor sequence, ctaacgtcgtag" FT misc_feature 453819..454482 FT /note="nominal overlap with cosmid SPAC13C5, EM:Z50112 S. FT pombe chromosome 1" FT misc_feature complement(454339..454464) FT /colour=9 FT /note="Pfam match to entry PF00227 proteasome, Proteasome FT A-type and B-type" FT misc_feature 453819..454482 FT /note="nominal overlap with cosmid SPAC31A2, EM:Z50113 S. FT pombe chromosome 1" FT misc_feature complement(454339..454803) FT /colour=9 FT /note="Pfam match to entry proteasome PF00227, Proteasome FT A -type and B-type" FT misc_feature complement(454819..454887) FT /colour=8 FT /note="PS00388 Proteasome A-type subunits signature" FT CDS join(455706..455745,455782..455998,456040..457018) FT /colour=10 FT /gene="SPAC13C5.02" FT /label=SPAC13C5.02 FT /note="SPAC13C5.02, len:411" FT /product="protein containing 2 WW domain and 1 FF domain" FT /fasta_file="fasta/c13C5.tab.seq.01984.out" FT misc_feature join(455718..455745,455782..455843) FT /note="Match to PF00397 WW_rsp5_WWP, WW domain Score 41.98" FT misc_feature 455746..455751 FT /colour=2 FT /note="splice donor sequence, gtaaat" FT misc_feature 455771..455781 FT /colour=2 FT /note="splice branch and acceptor sequence, ctaactcatag" FT misc_feature 455999..456004 FT /colour=2 FT /note="splice donor sequence, gtatgt" FT misc_feature 456024..456039 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ttaacttttttttta g" FT misc_feature 456053..456142 FT /note="Match to PF00397 WW_rsp5_WWP, WW domain Score 47.70" FT CDS join(457259..457619,457662..458266,458329..458994) FT /colour=2 FT /gene="tht1" FT /gene="SPAC13C5.03" FT /label=tht1 FT /note="SPAC13C5.03; tht1; nuclear fusion protein, has FT different N term to D87337 frameshifted in upstream reg FT ion w.r.t Z50112, len: 543, possibly spliced to upstream FT SP AC13C5.03" FT /note="SPAC13C5.03, len:543" FT /product="nuclear fusion protein tht1" FT /fasta_file="fasta/c13C5.tab.seq.01985.out" FT misc_feature 457620..457625 FT /colour=2 FT /note="splice donor sequence, gtaaac" FT misc_feature 457646..457661 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacaatataacaa g" FT misc_feature 458267..458272 FT /colour=2 FT /note="splice donor sequence, gttagt" FT misc_feature 458312..458328 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacagtactgtat ag" FT CDS 459806..460552 FT /colour=10 FT /gene="SPAC13C5.04" FT /label=SPAC13C5.04 FT /note="SPAC13C5.04, len:248, SIMILARITY:Saccharomyces FT cerevisiae, Q12288, orf ylr126c., (251 aa), fasta scores: FT opt: 442, E():5.3e-22, (32.5% identity in 249 aa)" FT /product=" weak similarity to Pseudomonas aeroginosa FT anthranilate synthase component II" FT /fasta_file="fasta/c13C5.tab.seq.01986.out" FT snRNA 460896..460977 FT /gene="Sp-snR40-sno" FT /note="putative snoRNA Sp-snR40, complements Sp-18S-rRNA FT and modifies Gm1288 and Um1286. Yeast snR40 and snR55 FT homolog" FT CDS complement(join(461238..462658,462704..462789, FT 462830..462879)) FT /EC_number="5.4.2.3" FT /colour=7 FT /gene="SPAC13C5.05c" FT /label=SPAC13C5.05c FT /note="SPAC13C5.05c, len:518, SIMILARITY:Homo sapiens, FT AAD55097, n-acetylglucosamine-phosphate mutase, (542 aa), FT fasta scores: opt: 1327, E():0, (45.0% identity in 516 aa)" FT /product="N-acetylglucosamine-phosphate mutase" FT /fasta_file="fasta/c13C5.tab.seq.01987.out" FT misc_feature complement(462659..462675) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ttaataataataaat ag" FT misc_feature complement(462697..462747) FT /colour=9 FT /note="Pfam match to entry PGM_PMM PF00408, FT Phosphoglucomut ase and phosphomannomutase phosphoserine" FT misc_feature complement(462698..462703) FT /colour=2 FT /note="splice donor sequence, gtatgt" FT misc_feature complement(462790..462804) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ttaacttgatcaaag" FT misc_feature complement(462824..462829) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT CDS complement(join(464200..464507,464552..464777)) FT /colour=8 FT /gene="SPAC13C5.06c" FT /label=SPAC13C5.06c FT /note="SPAC13C5.06c, len:177" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c13C5.tab.seq.01988.out" FT misc_feature complement(464508..464520) FT /colour=2 FT /note="splice branch and acceptor sequence, ctaattatatttag" FT misc_feature complement(464546..464551) FT /colour=2 FT /note="splice donor sequence, gtacgt" FT CDS join(465890..466057,466106..466611,466682..467256, FT 467300..467483,467529..468045) FT /colour=2 FT /gene="rad32" FT /gene="SPAC13C5.07" FT /label=rad32 FT /note="SPAC13C5.07, len:649" FT /product="DNA repair protein; repair exonuclease; meiotic FT recombination protein; involved in the processing of DNA FT breaks; involved in end joining; similar to S. cerevisiae FT MRE11" FT /fasta_file="fasta/c13C5.tab.seq.01989.out" FT misc_feature 466612..466617 FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature 466669..466681 FT /colour=2 FT /note="splice branch and acceptor sequence, ctaatgctttaag" FT misc_feature 467257..467262 FT /colour=2 FT /note="splice donor sequence, gtaaga" FT misc_feature 467286..467299 FT /colour=2 FT /note="splice branch and acceptor sequence," FT misc_feature 467484..467489 FT /colour=2 FT /note="splice donor sequence, gtgagt" FT misc_feature 467510..467528 FT /colour=2 FT /note="splice branch and acceptor sequence, FT tactaaccgattaca ttag" FT misc_feature 469660..470318 FT /note="nominal overlap with cosmid SPAC23E2, EM:Z68887 S. FT pombe chromosome 1" FT misc_feature 469660..470318 FT /note="overlap with cosmid SPAC13C5, EM:Z50112 S.pombe FT chromosome 1" FT CDS 473245..474939 FT /colour=2 FT /gene="gaf2" FT /gene="SPAC23E2.01" FT /label=gaf2 FT /note="SPAC23E2.01, len:564" FT /product="putative transcription factor; zinc finger FT protein; zf-GATA type" FT /fasta_file="fasta/c23E2.tab.seq.00423.out" FT misc_feature 473269..473385 FT /note="Match to PF00320 GATA, GATA zinc finger Score 59.81" FT misc_feature 473758..473865 FT /note="Match to PF00320 GATA, GATA zinc finger Score 73.55" FT tRNA 475676..475747 FT /note="tRNA Val anticodon CAC, Cove score 73.06" FT LTR 475751..476018 FT /note="Tf1-type LTR" FT CDS join(476167..476189,476355..478917,478971..480206) FT /colour=10 FT /gene="SPAC23E2.02" FT /label=SPAC23E2.02 FT /note="SPAC23E2.02, len:1273, may use inteRNAl Met at FT codon 39, SIMILARITY:Schizosaccharomyces pombe, CAB46762, FT hypothetical 112.8 kD protein., (1000 aa), fasta scores: FT opt: 687, E():5.5e-32, (31.4% identity in 1016 aa)" FT /product="hypothetical protein; similar to S. pombe FT SPBC146.09C; Pfam Amino_oxidase domain; putative HMG box FT domain; GFP fusion nuclear" FT /fasta_file="fasta/c23E2.tab.seq.00424.out" FT misc_feature 476190..476195 FT /colour=2 FT /note="putative splice donor site, gtattc" FT misc_feature 476339..476354 FT /colour=2 FT /note="putative splice branch and acceptor sequence, FT ttaacg aatcgttaag" FT misc_feature 477756..477761 FT /colour=2 FT /note="putative splice donor sequence, gtatgg" FT misc_feature 477756..477833 FT /note="putative intron in SPAC23E2.02" FT misc_feature 477812..477833 FT /colour=2 FT /note="putative splice branch and acceptor sequence, FT ctaata ctggcacaacatccag" FT misc_feature 478918..478923 FT /colour=2 FT /note="splice donor sequence, gtaggt" FT misc_feature 478957..478970 FT /colour=2 FT /note="splice branch and acceptor sequence, ttaacattgagcag" FT misc_feature complement(480677..480694) FT /colour=6 FT /note="ttaactatttcgttgtag, splice branch and acceptor" FT intron complement(480677..480937) FT /colour=7 FT /note="splice junction removed from prediction, evidence: FT No intron was detected in cDNA: The ste7 gene mutated at FT the splicing donar site predicted in SPAC23E2.03c shows FT no deffect in conjugation process; GFP fluorescence was FT detected in cells transformed with a plasmid comprising FT the ste7-GFP fusion gene(w/o intron)- splice removed" FT CDS complement(480886..482595) FT /colour=2 FT /gene="ste7" FT /gene="SPAC23E2.03c" FT /label=ste7 FT /note="SPAC23E2.03c, len:576, splicing at C-term may not FT be real, SIMILARITY:Saccharomyces diastaticus, AAC49609, FT glucoamylase., (1367 aa), fasta scores: opt: 297, E():1.2e- FT 07, (24.1% identity in 518 aa)" FT /product="required for mating and meiosis" FT /fasta_file="fasta/c23E2.tab.seq.00014.out" FT misc_feature complement(480932..480937) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 483659 FT /note="single base overlap with cosmid SPAC24H6, EM:Z54142 FT S.pombe chromosome 1 true right end (will be left end when FT this is turned round) is at 18 008 in c24H6" FT misc_feature 483659 FT /note="nominal overlap with c23E2" FT misc_feature complement(483692..486202) FT /note="low complexity gene free region" FT rRNA 486203..486321 FT /label=5SrRNA FT /note="5S rRNA gene" FT CDS complement(486737..489352) FT /colour=10 FT /gene="SPAC24H6.13" FT /label=SPAC24H6.13 FT /note="SPAC24H6.13, len:871, SIMILARITY:Saccharomyces FT cerevisiae, YM8G_YEAST, hypothetical 107.7 kD protein , FT (953 aa), fasta scores: opt: 1905, E():0, (39.9% identity FT in 909 aa)" FT /product="eukaryotic conserved protein; S. cerevisiae FT homolog RSN1 is involved in tunicamycin sensitivity; FT contains DUF221; predicted integral membrane" FT /fasta_file="fasta/c24H6.tab.seq.00883.out" FT CDS 491615..492949 FT /colour=2 FT /gene="uba3" FT /gene="SPAC24H6.12c" FT /label=uba3 FT /note="SPAC24H6.12c, len:444, SIMILARITY:Physarum FT polycephalum, P90586, ubiquitin-activating enzyme, (427 FT aa), fasta scores: opt: 876, E():0, (46.5% identity in 432 FT aa)" FT /product="ubiquitin activating enzyme" FT /fasta_file="fasta/c24H6.tab.seq.00884.out" FT misc_feature 491741..492163 FT /note="Match to PF00899 ThiF_family, ThiF family Score FT 190.94" FT CDS 494975..497851 FT /colour=7 FT /gene="SPAC24H6.11c" FT /label=SPAC24H6.11c FT /note="SPAC24H6.11c, len:958, SIMILARITY:Saccharomyces FT cerevisiae, YG35_YEAST, hypothetical 117.0 kD protein in FT asn2-phb1 intergenic region., (1036 aa), fasta scores: FT opt: 1804, E():0, (36.4% identity in 968 aa)" FT /product="putative SulP sulfate transporter" FT /fasta_file="fasta/c24H6.tab.seq.00885.out" FT misc_feature 495797..496729 FT /note="Match to PF00916 Sulfate_transp, Sulfate FT transporter family Score 297.33" FT CDS 498396..499502 FT /EC_number="4.1.2.15" FT /colour=7 FT /gene="SPAC24H6.10c" FT /label=SPAC24H6.10c FT /note="SPAC24H6.10c, len:368, SIMILARITY:Saccharomyces FT cerevisiae, AROG_YEAST, phospho-2-dehydro-3-deoxyheptonate FT aldolase, tyrosine-inhibited(ec 4.1.2.15), (370 aa), fasta FT scores: opt: 1447, E():0, (62.5% identity in 347 aa)" FT /product="putative phospho-2-dehydro-3-deoxyheptonate FT aldolase" FT /fasta_file="fasta/c24H6.tab.seq.00886.out" FT misc_feature 498447..499484 FT /note="Match to PF00793 DAHP_synth_1, DAHP synthetase FT family Score 903.18" FT CDS complement(join(500259..502478,502534..502575)) FT /colour=7 FT /gene="SPAC24H6.09" FT /label=SPAC24H6.09 FT /note="SPAC24H6.09, len:753, SIMILARITY:Dictyostelium FT discoideum, AAD47903, unconventional myosin heavy chain FT myom., (1737 aa), fasta scores: opt: 302, E():6.2e-10, FT (24.4% identity in 488 aa)" FT /product="putative guanine nucleotide exchange factor; FT coiled-coil regions; predicted coiled-coil region" FT /fasta_file="fasta/c24H6.tab.seq.00887.out" FT misc_feature complement(501003..501578) FT /note="Match to PF00621 RhoGEF, RhoGEF domain Score 288.04" FT misc_feature complement(502479..502495) FT /colour=6 FT /note="ttaacaatgttgatcag, splice branch and acceptor" FT misc_feature complement(502528..502533) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS complement(503711..504373) FT /colour=8 FT /gene="SPAC24H6.08" FT /label=SPAC24H6.08 FT /note="SPAC24H6.08, len:220aa" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c24H6.tab.seq.00888.out" FT CDS complement(join(505169..505729,505775..505789)) FT /colour=2 FT /gene="rps9-1" FT /gene="SPAC24H6.07" FT /gene="rps9a" FT /label=rps9-1 FT /note="SPAC24H6.07, len:191" FT /product="40S ribosomal protein S9" FT /fasta_file="fasta/c24H6.tab.seq.00889.out" FT misc_feature complement(505172..505729) FT /note="Match to PF00163 Ribosomal_S4, Ribosomal protein FT S4/S9 N-terminal domain Score 316.39" FT misc_feature complement(505358..505432) FT /colour=8 FT /note="PS00632 Ribosomal protein S4 signature" FT misc_feature complement(505730..505744) FT /colour=6 FT /note="ctaacattaaattag, splice branch and acceptor" FT misc_feature complement(505769..505774) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT promoter complement(505840..505847) FT /colour=4 FT /note="Homol D box" FT promoter complement(505859..505868) FT /colour=4 FT /note="Homol E box" FT CDS complement(join(506225..507218,507312..508282, FT 508331..508372)) FT /colour=10 FT /gene="SPAC24H6.06" FT /label=SPAC24H6.06 FT /note="SPAC24H6.06, len:668, SIMILARITY: LOW to Sus scrofa, FT Q29070, gastric mucin, (317 aa), fasta scores: opt: 138, FT E():0.13, (25.9% identity in 216 aa)" FT /product="hypothetical protein; sequence orphan; predicted FT coiled-coil region" FT /fasta_file="fasta/c24H6.tab.seq.00890.out" FT misc_feature complement(507219..507231) FT /colour=6 FT /note="ctaatgataacag, splice branch and acceptor" FT misc_feature complement(507306..507311) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(508283..508296) FT /colour=6 FT /note="ttgacatcttttag, splice branch and acceptor" FT intron complement(508283..508330) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(508325..508330) FT /colour=6 FT /note="gtactt, splice donor sequence" FT CDS complement(509426..511216) FT /EC_number="3.1.3.48" FT /colour=2 FT /gene="cdc25" FT /gene="sal2" FT /gene="SPAC24H6.05" FT /label=cdc25 FT /note="SPAC24H6.05, len:596aa; conflict with published FT sequence" FT /note="SPAC24H6.05, len:596" FT /product="M-phase inducer phosphatase; G2/M phase FT transition; DNA damage checkpoint protein; similar to S. FT cerevisiae MIH1" FT /fasta_file="fasta/c24H6.tab.seq.00891.out" FT misc_feature complement(509636..509953) FT /note="Match to PF00581 Rhodanese, Rhodanese-like domain FT Score 116.58" FT CDS complement(513123..514577) FT /EC_number="2.7.1.1" FT /colour=2 FT /gene="hxk1" FT /gene="SPAC24H6.04" FT /label=hxk1 FT /note="SPAC24H6.04, len:484" FT /product="hexokinase 1" FT /fasta_file="fasta/c24H6.tab.seq.00892.out" FT misc_feature complement(513168..514505) FT /note="Match to PF00349 hexokinase, Hexokinase Score FT 959.14" FT misc_feature complement(514038..514115) FT /colour=8 FT /note="PS00378 Hexokinases signature" FT CDS complement(join(515636..515807,515864..516273, FT 516325..516498,516543..516607,516660..516769, FT 516809..518193,518250..518291)) FT /colour=2 FT /gene="pcu3" FT /gene="SPAC24H6.03" FT /label=pcu3 FT /note="SPAC24H6.03, len:785" FT /product="cullin family" FT /fasta_file="fasta/c24H6.tab.seq.00893.out" FT misc_feature complement(join(515639..515807,515864..516273)) FT /note="Match to PF00888 Cullin, Cullin family Score 311.50" FT misc_feature complement(515808..515823) FT /colour=6 FT /note="ctaacagtaaattaag, splice branch and acceptor" FT misc_feature complement(515858..515863) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(516274..516290) FT /colour=6 FT /note="ctaacaatcctatttag, splice branch and acceptor" FT misc_feature complement(516319..516324) FT /colour=6 FT /note="gtatag, splice donor sequence" FT misc_feature complement(516325..516495) FT /note="Match to PF00888 Cullin, Cullin family Score 80.72" FT misc_feature complement(516499..516509) FT /colour=6 FT /note="ctaacagttag, splice branch and acceptor" FT misc_feature complement(516537..516542) FT /colour=6 FT /note="gttagt, splice donor sequence" FT misc_feature complement(join(516543..516607,516660..516769, FT 516809..518178)) FT /note="Match to PF00888 Cullin, Cullin family Score 749.66" FT misc_feature complement(516608..516618) FT /colour=6 FT /note="ttaatgcttag, splice branch and acceptor" FT misc_feature complement(516654..516659) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(516770..516782) FT /colour=6 FT /note="ttaacacttttag, splice branch and acceptor" FT misc_feature complement(516803..516808) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature complement(518194..518204) FT /colour=6 FT /note="ctgacatttag, splice branch and acceptor" FT misc_feature complement(518244..518249) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS join(518455..518705,518750..519026) FT /colour=10 FT /gene="SPAC24H6.02c" FT /label=SPAC24H6.02c FT /note="SPAC24H6.02c, len:175, SIMILARITY:Saccharomyces FT cerevisiae, YN50_YEAST, hypothetical 23.5 kD protein, (205 FT aa), fasta scores: opt: 308, E():5.9e-14, (45.4% identity FT in 108 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YNL310C; Pfam-B_16411" FT /fasta_file="fasta/c24H6.tab.seq.00894.out" FT misc_feature 518706..518711 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 518735..518749 FT /colour=6 FT /note="ctaaccaaatgaaag, splice branch and acceptor" FT misc_feature 519939..519944 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 519999..520013 FT /colour=6 FT /note="ctaactaggcgtcag, splice branch and acceptor" FT misc_feature 520448..520453 FT /colour=6 FT /note="gtacgc, splice donor sequence" FT misc_feature 520473..520487 FT /colour=6 FT /note="ttaatctttttacag, splice branch and acceptor" FT misc_feature complement(520491) FT /note="single base overlap with cosmid SPAC23E2, EM:Z68887 FT S.pombe chromosome 1" FT misc_feature 520395..520491 FT /note="485 (+1) 36737 36833 SPAC24H6 S. pombe chromosome 1" FT BLASTCDS 521598..521684 FT /note="83 (+1) 581 609 TR:Q08929 Q08929 CHROMOSOME XVI FT READING FRAME ORF YPL189W. [0]" FT CDS join(522137..522152,522188..522306,522349..524061, FT 524099..524291,524343..527365) FT /colour=10 FT /gene="SPAPB21F2.02" FT /label=SPAPB21F2.02 FT /product=" similar to Aspergillus nidulans dopA which FT causes delayed and asynchronous morphogenesis during FT asexual reproduction and S. cerevisiae DOP1 ( lethal)" FT /fasta_file="fasta/pB21F2.tab.seq.02373.out" FT CDS join(527847..527849,527891..528406) FT /colour=8 FT /gene="SPAPB21F2.03" FT /label=SPAPB21F2.03 FT /product="hypothetical protein; sequence orphan; confirmed FT intron" FT /fasta_file="fasta/pB21F2.tab.seq.02374.out" FT intron 527850..527890 FT /colour=2 FT /note="confirmed intron" FT misc_feature 529095..529188 FT /note="nominal overlap with SPAC227 S. pombe chromosome 1" FT misc_RNA 530481..530900 FT /colour=3 FT /note="mRNA from AU006865 not associated with an ORF" FT CDS complement(531443..532060) FT /colour=10 FT /gene="SPAC227.02c" FT /label=SPAC227.02c FT /note="SPAC227.02c, len:205, SIMILARITY: Saccharomyces FT cerevisiae, Q06511, hypothetical protein (250 aa) fasta FT scores, opt: 252, E(): 7.7e-08, (26.4% identity in 193 FT aa overlap)" FT /product="eukaryotic conserved protein; similar to S. FT cerevisiae YPR143W null lethal; putative coiled-coil FT region" FT /fasta_file="fasta/c227.tab.seq.00100.out" FT CDS complement(532654..533769) FT /colour=7 FT /gene="SPAC227.03c" FT /label=SPAC227.03c FT /note="SPAC227.03c, len:371, SIMILARITY:Saccharomyces FT cerevisiae, YIA6_YEAST, putative mitochondrial carrier FT yil006w., (373 aa), fasta scores: opt: 405, E():7.9e-20, FT (37.8% identity in 373 aa)" FT /product="MC transporter of unknown specificity" FT /fasta_file="fasta/c227.tab.seq.00101.out" FT misc_feature complement(532660..533088) FT /note="Match to PF00153 mito_carr, Mitochondrial carrier FT proteins Score 138.34" FT misc_feature complement(533260..533754) FT /note="Match to PF00153 mito_carr, Mitochondrial carrier FT proteins Score 138.66" FT CDS 534729..535268 FT /colour=8 FT /gene="SPAC227.04" FT /label=SPAC227.04 FT /note="SPAC227.04, len:179" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c227.tab.seq.00102.out" FT CDS 535660..536031 FT /colour=7 FT /gene="SPAC227.05" FT /label=SPAC227.05 FT /note="SPAC227.05, len:123, SIMILARITY:Caenorhabditis FT elegans., Q17435, hypothetical 14.0 kD protein b0035.4 in FT chromosome iv., (126 aa), fasta scores: opt: 230, E():8.4e- FT 08, (34.4% identity in 122 aa)" FT /product="putative GIM complex; prefoldin subunit 4" FT /fasta_file="fasta/c227.tab.seq.00103.out" FT CDS 536219..536968 FT /colour=10 FT /gene="SPAC227.06" FT /label=SPAC227.06 FT /note="SPAC227.06, len:249, SIMILARITY:Caenorhabditis FT elegans., AAD12839, y25c1a.7b protein., (287 aa), fasta FT scores: opt: 335, E():4.1e-15, (31.0% identity in 203 aa)" FT /product="conserved protein; similar to S. cerevisiae FT YGL161C S. cerevisiae YGL161C is predicted to be involved FT in vesicular transport and membrane fusion from 2-hybrid FT data" FT /fasta_file="fasta/c227.tab.seq.00104.out" FT CDS complement(join(537812..537835,537879..539161, FT 539239..539279,539324..539367)) FT /colour=2 FT /gene="pab1" FT /gene="SPAC227.07c" FT /label=pab1 FT /note="SPAC227.07c, len:463" FT /product="protein phosphatase pp2a regulatory subunit b" FT /fasta_file="fasta/c227.tab.seq.00105.out" FT misc_feature complement(537836..537850) FT /colour=6 FT /note="ctaatgtttcaatag, splice branch and acceptor" FT misc_feature complement(537873..537878) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(join(537879..539161,539239..539278)) FT /note="Match to PF01240 PR55, protein phosphatase 2A FT regulatory subunit PR55 Score 849.23" FT misc_feature complement(539162..539174) FT /colour=6 FT /note="ctaacaagtttag, splice branch and acceptor" FT misc_feature complement(539233..539238) FT /colour=6 FT /note="gtattg, splice donor sequence" FT misc_feature complement(539280..539291) FT /colour=6 FT /note="ctaactctttag, splice branch and acceptor" FT misc_feature complement(539318..539323) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS complement(join(540345..540396,540456..540746, FT 540843..541012)) FT /colour=7 FT /gene="SPAC227.08c" FT /label=SPAC227.08c FT /note="SPAC227.08c, len:170, SIMILARITY:Mus musculus, FT O54930, clipper/cleavage and polyadenylation specificity FT factor 30 kDasubunit homolog, (208 aa), fasta scores: opt: FT 526, E():6.6e-25, (53.1% identity in 128 aa)" FT /product="zinc finger protein; zf-CCCH type; putative FT cleavage and polyadenylation factor; similar to S. FT cerevisiae YTH1" FT /fasta_file="fasta/c227.tab.seq.00106.out" FT misc_feature complement(540397..540410) FT /colour=6 FT /note="ctaacatgttctag, splice branch and acceptor" FT misc_feature complement(540450..540455) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(540747..540761) FT /colour=6 FT /note="ctaatattatataag, splice branch and acceptor" FT misc_feature complement(540837..540842) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS 541483..542736 FT /colour=7 FT /gene="SPAC227.09" FT /label=SPAC227.09 FT /note="SPAC227.09, len:417, SIMILARITY:Saccharomyces FT cerevisiae, FOLD_YEAST, putative folylpolyglutamate FT synthase, (427 aa), fasta scores: opt: 924, E():0, (39.9% FT identity in 431 aa)" FT /product="putative folylpolyglutamate synthase" FT /fasta_file="fasta/c227.tab.seq.00107.out" FT misc_feature 541567..542361 FT /note="Match to PF01225 Mur_ligase, Mur ligase family FT Score 42.96" FT CDS join(543507..543534,543584..543674,543722..543845, FT 543920..544021) FT /colour=7 FT /gene="SPAC227.10" FT /label=SPAC227.10 FT /note="SPAC227.10, len:114, SIMILARITY:Saccharomyces FT cerevisiae, YEA3_YEAST, hypothetical 14.3 kD protein in FT gcn4-wbp1 intergenic region., (123 aa), fasta scores: opt: FT 301, E():6.6e-14, (43.3% identity in 104 aa)" FT /product="putative GIM complex; prefoldin subunit 2" FT /fasta_file="fasta/c227.tab.seq.00108.out" FT misc_feature 543535..543540 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 543570..543583 FT /colour=6 FT /note="ttgaccagttccag, splice branch and acceptor" FT misc_feature 543675..543680 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 543710..543721 FT /colour=6 FT /note="ctaactaaaaag, splice branch and acceptor" FT misc_feature 543846..543851 FT /colour=6 FT /note="gtaagg, splice donor sequence" FT misc_feature 543904..543919 FT /colour=6 FT /note="ctaatcaaaatattag, splice branch and acceptor" FT CDS complement(join(544110..544165,544233..544758, FT 544898..545158,545210..545335)) FT /colour=10 FT /gene="SPAC227.11c" FT /label=SPAC227.11c FT /note="SPAC227.11c, len:322" FT /product="hypothetical protein; similar to S. cerevisiae FT YDR057W" FT /fasta_file="fasta/c227.tab.seq.00109.out" FT misc_feature complement(544166..544179) FT /colour=6 FT /note="ctaataacataaag, splice branch and acceptor" FT misc_feature complement(544227..544232) FT /colour=6 FT /note="gttagt, splice donor sequence" FT misc_feature complement(544759..544774) FT /colour=6 FT /note="ctaatcattgtattag, splice branch and acceptor" FT misc_feature complement(544892..544897) FT /colour=6 FT /note="gtacga, splice donor sequence" FT misc_feature complement(545159..545178) FT /colour=6 FT /note="ctaacggacttcctttgtag, splice branch and acceptor" FT misc_feature complement(545204..545209) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT CDS join(545473..545509,545572..546923) FT /colour=7 FT /gene="SPAC227.12" FT /label=SPAC227.12 FT /note="SPAC227.12, len:462, SIMILARITY:Caenorhabditis FT elegans., Q93339, c36b1.5 protein., (496 aa), fasta FT scores: opt: 1076, E():0, (37.6% identity in 442 aa)" FT /product="putative pre-mRNA splicing factor; WD repeat FT protein" FT /fasta_file="fasta/c227.tab.seq.00110.out" FT misc_feature 545510..545515 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 545555..545571 FT /colour=6 FT /note="ctaataaaaaactttag, splice branch and acceptor" FT misc_feature 546039..546134 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 26.51" FT misc_feature 546153..546287 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 30.93" FT misc_feature 546315..546413 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 33.09" FT misc_feature 546444..546539 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 29.15" FT misc_feature 546576..546665 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 34.76" FT misc_feature 546681..546797 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 37.72" FT misc_feature 546807..546914 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 35.98" FT CDS complement(547541..548119) FT /colour=7 FT /gene="isu1" FT /gene="SPAC227.13c" FT /label=isu1 FT /note="SPAC227.13c, len:192, SIMILARITY:Saccharomyces FT cerevisiae, Q03020, lpi10p., (165 aa), fasta scores: opt: FT 661, E():0, (64.7% identity in 156 aa)" FT /product="similar to iron-sulpher cluster proteins; Nif-u FT like protein; iron metabolism; mitochondrial" FT /fasta_file="fasta/c227.tab.seq.00111.out" FT misc_feature complement(547583..547963) FT /colour=9 FT /note="Pfam match to entry PF01592 NifU_N, NifU-like N FT terminal domain," FT CDS join(550609..550809,550891..551397) FT /colour=7 FT /gene="SPAC227.14" FT /label=SPAC227.14 FT /note="SPAC227.14, len:235, LOW SIMILARITY:Arabidopsis FT thaliana, AAD25806, f10o3.15 protein., (270 aa), fasta FT scores: opt: 273, E():7e-11, (30.5% identity in 243 aa)" FT /product="similar to uridine kinase" FT /fasta_file="fasta/c227.tab.seq.00112.out" FT misc_feature 550810..550815 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 550875..550890 FT /colour=6 FT /note="ctaacattttttaaag, splice branch and acceptor" FT CDS 552922..555543 FT /colour=7 FT /gene="SPAC227.15" FT /label=SPAC227.15 FT /note="SPAC227.15, len:873 SIMILARITY: LOW to FT Saccharomysces cerevisiae, HEX2_YEAST, HEX2 PROTEIN, (1014 FT aa) fastsa scores, opt:400, E(): 1.6e-15, (23.8% identity FT in 621 aa overlap)" FT /product="putative regulatory subunit for protein FT phosphatase; similar to S. cerevisiae HEX2" FT /fasta_file="fasta/c227.tab.seq.00113.out" FT snRNA 556402..556479 FT /evidence=EXPERIMENTAL FT /function="guide for 2'-O-ribose methylation of rRNA" FT /gene="Z8 snoRNA" FT /product="Z8 small nucleolar RNA" FT snRNA 556613..556712 FT /evidence=EXPERIMENTAL FT /function="guide for 2'-O-ribose methylation of rRNA" FT /gene="Z7 snoRNA" FT /product="Z7 small nucleolar RNA" FT snRNA 556867..556951 FT /evidence=EXPERIMENTAL FT /function="Guide for 2'-O-ribose methylation of rRNA" FT /gene="Z5 snoRNA" FT /product="Z5 small nucleolar RNA" FT snRNA 557063..557150 FT /evidence=EXPERIMENTAL FT /function="guide for 2'-O-ribose methylation of rRNA" FT /gene="z4 snoRNA" FT /product="Z4 small nucleolar RNA" FT snRNA 557300..557389 FT /evidence=EXPERIMENTAL FT /function="guide for 2'-O-ribose methylation of rRNA" FT /gene="Z3 snoRNA" FT /product="Z3 small nucleolar RNA" FT CDS complement(join(557679..557740,557800..557945, FT 558002..558136,558243..558301,558349..558447)) FT /colour=10 FT /gene="SPAC227.16c" FT /label=SPAC227.16c FT /note="SPAC227.16c, len:158, SIMILARITY:Saccharomyces FT cerevisiae, Q12146, chromosome xv reading frame orf FT yol146w., (236 aa), fasta scores: opt: 120, E():0.11, FT (29.2% identity in 195 aa overlap)" FT /product="hypothetical protein; similar to S. cerevisiae FT YOL146W" FT /fasta_file="fasta/c227.tab.seq.00114.out" FT misc_feature complement(557741..557765) FT /colour=6 FT /note="ctaacaaaagctcgtgctgccacag, splice branch and FT acceptor" FT misc_feature complement(557794..557799) FT /colour=6 FT /note="gtatgt, splice donor" FT misc_feature complement(557946..557959) FT /colour=6 FT /note="ctaactcattgtag, splice branch and acceptor" FT misc_feature complement(557996..558001) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(558137..558148) FT /colour=6 FT /note="cttactttatag, splice branch and acceptor" FT misc_feature complement(558237..558242) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(558302..558322) FT /colour=6 FT /note="ttgactttctaaacagtttag, splice branch and acceptor" FT misc_feature complement(558343..558348) FT /colour=6 FT /note="gttagt, splice donor sequence" FT CDS complement(559477..559842) FT /colour=8 FT /gene="SPAC227.17c" FT /label=SPAC227.17c FT /note="SPAC227.17c, len:121" FT /product="hypothetical protein; very low similar to S. FT cerevisiae YDR512C; sequence orphan" FT /fasta_file="fasta/c227.tab.seq.00115.out" FT misc_feature 561155..561893 FT /note="nominal overlap with cosmid SPAC2F7, EM:Z50142 S. FT pombe chromosome 1" FT misc_feature 561155..561893 FT /note="nominal overlap with cosmid SPAC227, EM:AL133156 S. FT pombe chromosome 1" FT CDS complement(562108..563085) FT /colour=7 FT /gene="SPAC2F7.02c" FT /label=SPAC2F7.02c FT /note="SPAC2F7.02c, len:325, SIMILARITY to C FT term:Saccharomyces cerevisiae, Q07800, chromosome xii FT reading frame orf yll010c., (427 aa), fasta scores: opt: FT 819, E():0, (45.2% identity in 310 aa)" FT /product="plasma membrane phosphatase; possibly involved FT in sodium stress response; similar to S. cerevisiae PSR1" FT /fasta_file="fasta/c2F7.tab.seq.01840.out" FT CDS complement(564138..567401) FT /colour=2 FT /gene="pom1" FT /gene="SPAC2F7.03c" FT /label=pom1 FT /note="SPAC2F7.03c, len:1087" FT /product="serine/threonine protein kinase; dual FT specificity protein kinase; involved in cell polarity" FT /fasta_file="fasta/c2F7.tab.seq.01841.out" FT misc_feature complement(564417..564503) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 20.54" FT misc_feature complement(564663..565307) FT /colour=9 FT /note="Pfam match to entry pkinase PF00069, Eukaryotic FT prot ein kinase domain" FT misc_feature complement(564903..564941) FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT misc_feature complement(565263..565289) FT /colour=8 FT /note="PS00107 protein kinases ATP-binding region FT signature" FT CDS join(568071..568304,568351..568998,569041..569523) FT /colour=2 FT /gene="pmc2" FT /gene="SPAC2F7.04" FT /label=pmc2 FT /note="SPAC2F7.04, len:454" FT /product="mediator complex component; involved in FT regulating RNA polymerase II activity; no apparent FT orthologs" FT /fasta_file="fasta/c2F7.tab.seq.00037.out" FT misc_feature 568305..568310 FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature 568334..568350 FT /colour=2 FT /note="splice branch and acceptor sequence, FT tactaattagtatct ag" FT misc_feature 568999..569004 FT /colour=2 FT /note="splice donor sequence,gtaagt" FT misc_feature 569024..569040 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ttaactaatttcacc ag" FT CDS complement(569801..570988) FT /colour=7 FT /gene="SPAC2F7.05c" FT /label=SPAC2F7.05c FT /note="SPAC2F7.05c, len:395, SIMILARITY:Rattus norvegicus, FT IF5_RAT, eukaryotic translation initiation factor 5, (429 FT aa), fasta scores: opt: 1018, E():0, (43.0% identity in FT 400 aa)" FT /product="eukaryotic translation initiation factor 5" FT /fasta_file="fasta/c2F7.tab.seq.01843.out" FT CDS complement(571713..573233) FT /colour=7 FT /gene="SPAC2F7.06c" FT /label=SPAC2F7.06c FT /note="SPAC2F7.06c, len:506, SIMILARITY:Rattus norvegicus, FT DPOB_RAT, DNA polymerase beta, (334 aa), fasta scores: FT opt: 445, E():3.5e-22, (27.3% identity in 344 aa)" FT /product="DNA polymerase X family; involved in repair" FT /fasta_file="fasta/c2F7.tab.seq.01844.out" FT misc_feature complement(571770..572450) FT /note="Match to PF00966 DNA_polymeraseX, DNA polymerase X FT family Score 346.27" FT CDS complement(574093..575916) FT /colour=7 FT /gene="SPAC2F7.07c" FT /label=SPAC2F7.07c FT /note="SPAC2F7.07c, len:607, SIMILARITY:Saccharomyces FT cerevisiae, YMW5_YEAST, hypothetical 78.8 kD protein in FT abf2-chl12 intergenic region., (684 aa), fasta scores: FT opt: 425, E():2.7e-18, (26.5% identity in 574 aa)" FT /product="zinc finger protein; zf-PHD finger" FT /fasta_file="fasta/c2F7.tab.seq.01845.out" FT misc_feature complement(574540..574701) FT /note="Match to PF00628 PHD, PHD-finger Score 70.26" FT misc_feature complement(574981..575130) FT /note="Match to PF00628 PHD, PHD-finger Score 75.83" FT misc_feature complement(575104..575121) FT /colour=8 FT /note="PS00190 Cytochrome c family heme-binding site FT signat ure" FT CDS complement(576340..578238) FT /colour=7 FT /gene="SPAC2F7.08c" FT /label=SPAC2F7.08c FT /note="SPAC2F7.08c, len:632, SIMILARITY:Saccharomyces FT cerevisiae, SNF5_YEAST, transcription regulatory protein FT snf5, (905 aa), fasta scores: opt: 472, E():2.1e-22, FT (34.6% identity in 399 aa)" FT /product="putative SWI/SNF global activator complex FT comoponent; involved in chromatin remodeling; FT transcriptional activator complex; similar to S. FT cerevisiae SNF5" FT /fasta_file="fasta/c2F7.tab.seq.01846.out" FT CDS complement(578444..579919) FT /colour=10 FT /gene="SPAC2F7.09c" FT /label=SPAC2F7.09c FT /note="SPAC2F7.09c, len:491" FT /product="putative ATP/GTP binding protein; no apparent S. FT cerevisiae ortholog; conserved in bacteria" FT /fasta_file="fasta/c2F7.tab.seq.00036.out" FT misc_feature complement(579251..579274) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A" FT CDS 580687..582615 FT /colour=10 FT /gene="SPAC2F7.10" FT /label=SPAC2F7.10 FT /note="SPAC2F7.10, len:642, SIMILARITY:Saccharomyces FT cerevisiae, AKR1_YEAST, ankyrin repeat-containing protein FT akr1., (764 aa), fasta scores: opt: 876, E():0, (27.3% FT identity in 670 aa)" FT /product="ankyrin repeat protein; zinc finger protein; zf- FT DHHC type; similar to S. cerevisiae AKR2 involved in FT constitutive endocytosis of Ste3p" FT /fasta_file="fasta/c2F7.tab.seq.01848.out" FT misc_feature 580696..580782 FT /colour=9 FT /note="Pfam match to entry PF00023 ank, Ank repeat, score FT 1.90, E-value 40" FT misc_feature 580783..580881 FT /colour=9 FT /note="Pfam match to entry PF00023 ank, Ank repeat, score FT 37.20, E-value 3.8e-07" FT misc_feature 580885..580983 FT /colour=9 FT /note="Pfam match to entry PF00023 ank, Ank repeat, score FT 29.80, E-value 6.2e-05" FT misc_feature 580984..581082 FT /colour=9 FT /note="Pfam match to entry PF00023 ank, Ank repeat, score FT 14.80, E-value 1.3" FT misc_feature 581083..581181 FT /colour=9 FT /note="Pfam match to entry PF00023 ank, Ank repeat, score FT 26.10, E-value 0.00085" FT misc_feature 581182..581283 FT /colour=9 FT /note="Pfam match to entry PF00023 ank, Ank repeat, score FT 4.40, E-value 21" FT misc_feature 581857..582051 FT /colour=9 FT /note="Pfam match to entry PF01529 zf-DHHC, DHHC zinc FT finger domain, score 138.20, E-value 1.5e-37" FT CDS 586307..587896 FT /colour=2 FT /gene="nrd1" FT /gene="SPAC2F7.11" FT /label=nrd1 FT /note="SPAC2F7.11, len:529" FT /product="negative regulator of differentiation 1" FT /fasta_file="fasta/c2F7.tab.seq.01849.out" FT misc_feature 586655..586855 FT /colour=9 FT /note="Pfam match to entry rrm PF00076, RNA recognition FT mot if. (aka RRM, RBD, or RNP domain)" FT misc_feature 586928..587128 FT /colour=9 FT /note="Pfam match to entry rrm PF00076, RNA recognition FT mot if. (aka RRM, RBD, or RNP domain)" FT misc_feature 587279..587479 FT /colour=9 FT /note="Pfam match to entry rrm PF00076, RNA recognition FT mot if. (aka RRM, RBD, or RNP domain)" FT misc_feature 587552..587752 FT /colour=9 FT /note="Pfam match to entry rrm PF00076, RNA recognition FT mot if. (aka RRM, RBD, or RNP domain)" FT misc_feature 588114..588500 FT /note="was SPAC2F7.12, len: 128, questionable orf, but now FT thought to be not coding" FT CDS complement(588993..590180) FT /EC_number="6.1.1.2" FT /colour=7 FT /gene="SPAC2F7.13c" FT /label=SPAC2F7.13c FT /note="SPAC2F7.13c, len:395, SIMILARITY:Saccharomyces FT cerevisiae, SYWC_YEAST, tryptophanyl-tRNA synthetase, FT cytoplasmic, (432 aa), fasta scores: opt: 1768, E():0, FT (64.7% identity in 394 aa)" FT /product="tryptophanyl-tRNA synthetase, cytoplasmic" FT /fasta_file="fasta/c2F7.tab.seq.01850.out" FT misc_feature complement(589260..589928) FT /colour=9 FT /note="Pfam match to entry PF00579 tRNA-synt_1b, tRNA FT synthetases class I (W and Y), score 93.70, E-value 3.7e- FT 24" FT misc_feature complement(589878..589910) FT /colour=8 FT /note="PS00178 Aminoacyl-transfer RNA synthetases class-I FT s ignature" FT CDS complement(590654..591643) FT /colour=7 FT /gene="SPAC2F7.14c" FT /label=SPAC2F7.14c FT /note="SPAC2F7.14c, len:329, SIMILARITY:Saccharomyces FT cerevisiae, YHM9_YEAST, hypothetical 39.4 kD protein in FT dys1-erg7 intergenic region., (359 aa), fasta scores: opt: FT 864, E():0, (49.3% identity in 353 aa)" FT /product="putative exosome 3'-5' exoribonuclease complex; FT possibly required for 3' processing of ribosomal 5.8S FT rRNA; similar to S. cerevisiae RRP4" FT /fasta_file="fasta/c2F7.tab.seq.01851.out" FT LTR complement(592997..593304) FT /note="Tf1-type LTR" FT CDS join(593846..594140,594229..594710) FT /colour=7 FT /gene="SPAC2F7.15" FT /label=SPAC2F7.15 FT /note="SPAC2F7.15, len:258, SIMILARITY:Saccharomyces FT cerevisiae, Q03976, hypothetical 37.4 kD protein., (319 FT aa), fasta scores: opt: 273, E():1.8e-11, (36.1% identity FT in 155 aa)" FT /product="putative mitochondrial ribosomal protein Small FT subunit; similar to S. cerevisiae RSM24" FT /fasta_file="fasta/c2F7.tab.seq.01852.out" FT misc_feature 594141..594146 FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature 594216..594228 FT /colour=2 FT /note="splice branch and acceptor sequence, ctgacaattatag" FT CDS complement(594844..598953) FT /colour=7 FT /gene="SPAC2F7.16c" FT /label=SPAC2F7.16c FT /note="SPAC2F7.16c, len:1369, SIMILARITY:Saccharomyces FT cerevisiae, SP14_YEAST, phospholipase d1, (1380 aa), fasta FT scores: opt: 2018, E():0, (32.1% identity in 1391 aa)" FT /product="putative phospholipase d1; similar to S. FT cerevisiae SPO14" FT /fasta_file="fasta/c2F7.tab.seq.01853.out" FT misc_feature complement(596050..596133) FT /note="Match to PF00614 PLDc, Phospholipase D. Active site FT motif Score 40.97" FT misc_feature complement(596950..597033) FT /note="Match to PF00614 PLDc, Phospholipase D. Active site FT motif Score 36.96" FT misc_feature complement(596968..597015) FT /colour=8 FT /note="PS00038 Myc-type, 'helix-loop-helix' putative DNA- FT bi nding domain signature" FT misc_feature complement(597817..598332) FT /note="Match to PF00787 PX, PX domain Score 117.40" FT CDS join(599912..600082,600225..600323,600561..601481) FT /colour=7 FT /gene="SPAC2F7.17" FT /label=SPAC2F7.17 FT /note="SPAC2F7.17, len:396, SIMILARITY:Saccharomyces FT cerevisiae, RF1M_YEAST, mitochondrial peptide chain FT release factor 1 , (413 aa), fasta scores: opt: 943, E():0, FT (42.7% identity in 377 aa)" FT /product="mitochondrial peptide chain release factor; FT similar to S. cerevisiae MRF1" FT /fasta_file="fasta/c2F7.tab.seq.01854.out" FT misc_feature 600083..600088 FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature 600207..600224 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacttatatcttt tag" FT misc_feature 600324..600329 FT /colour=2 FT /note="splice donor sequence, gtatga" FT misc_feature 600549..600560 FT /colour=2 FT /note="splice branch and acceptor sequence, ctaacaatttag" FT misc_feature 600747..601358 FT /note="Match to PF00472 RF-1, Prokaryotic-type class I FT peptide chain release factors Score 480.55" FT misc_feature complement(602117..602602) FT /note="Match to PF00620 RhoGAP, RhoGAP domain Score 212.03" FT misc_feature complement(603116..603361) FT /note="Match to PF00610 DEP, Domain found in Dishevelled, FT Egl-10, and Pleckstrin Score 105.00" FT misc_feature 603561..603664 FT /note="nominal overlap with cosmid SPAC13A11, EM:Z54096 S. FT pombe chromosome 1" FT misc_feature 603561..603664 FT /note="overlap with cosmid SPAC2F7, EM:Z50142 S.pombe FT chromosome 1" FT misc_feature complement(join(603704..603900,603945..604029)) FT /note="Match to PF00611 FCH, Fes/CIP4 homology domain FT Score 103.18" FT misc_feature complement(603901..603914) FT /colour=6 FT /note="ctaacaacgaatag, splice branch and acceptor" FT misc_feature complement(603939..603944) FT /colour=6 FT /note="gtattt, splice donor sequence" FT CDS complement(604811..606298) FT /colour=2 FT /gene="cyp51" FT /gene="SPAC13A11.02c" FT /label=cyp51 SPAC13A11.02c FT /note="SPAC13A11.02c, len:495" FT /product="putative cytochrome p450 51" FT /fasta_file="fasta/c13A11.tab.seq.01662.out" FT misc_feature complement(604823..606202) FT /note="Match to PF00067 p450, Cytochrome P450 Score 169.72" FT misc_feature complement(604967..604996) FT /colour=8 FT /note="PS00086 Cytochrome P450 cysteine heme-iron ligand FT si gnature" FT CDS join(608197..608262,608357..608923) FT /colour=10 FT /gene="SPAC13A11.03" FT /label=SPAC13A11.03 FT /note="SPAC13A11.03, len:210, SIMILARITY:Arabidopsis FT thaliana, CAB43931, hypothetical 14.7 kD protein., (128 FT aa), fasta scores: opt: 236, E():2.7e-08, (37.5% identity FT in 120 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YGL183C N-terminal truncated at SGD ; predicted coiled- FT coil" FT /fasta_file="fasta/c13A11.tab.seq.01663.out" FT misc_feature 608263..608268 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 608335..608356 FT /colour=6 FT /note="ctaatctatgttttttttatag, splice branch and acceptor" FT CDS complement(join(609396..609465,609511..609575, FT 609629..609926,609972..610659,610760..610892, FT 610971..611066)) FT /EC_number="3.1.2.15" FT /colour=7 FT /gene="SPAC13A11.04c" FT /label=SPAC13A11.04c FT /note="SPAC13A11.04c, len:449, FT SIMILARITY:Schizosaccharomyces pombe, O74442, ubiquitin FT carboxyl-terminal hydrolase, (457 aa), fasta scores: opt: FT 536, E():3.1e-27, (30.6% identity in 320 aa)" FT /product="ubiquitin carboxyl-terminal hydrolase; zinc FT finger protein; zf-UBP type; similar to S. cerevisiae UBP8" FT /fasta_file="fasta/c13A11.tab.seq.01664.out" FT misc_feature complement(609466..609480) FT /colour=6 FT /note="ctaaccagattatag, splice branch and acceptor" FT misc_feature complement(609505..609510) FT /colour=6 FT /note="gtaggc, splice donor sequence" FT misc_feature complement(609576..609588) FT /colour=6 FT /note="ctaatttttgtag, splice branch and acceptor" FT misc_feature complement(609623..609628) FT /colour=6 FT /note="gtatat, splice donor sequence" FT misc_feature complement(609629..609709) FT /note="Match to PF00443 UCH-2, Ubiquitin carboxyl-terminal FT hydrolases family 2 Score 53.18" FT misc_feature complement(609927..609945) FT /colour=6 FT /note="ttaacaaatattattttag, splice branch and acceptor" FT misc_feature complement(609966..609971) FT /colour=6 FT /note="gtaaaa, splice donor sequence" FT misc_feature complement(610578..610631) FT /colour=9 FT /note="Pfam match to entry PF00442 UCH-1, Ubiquitin FT carboxyl-terminal hydrolases family 2" FT misc_feature complement(610660..610670) FT /colour=6 FT /note="ctaattcttag, splice branch and acceptor" FT misc_feature complement(610754..610759) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(610821..610838) FT /colour=8 FT /note="PS00190 Cytochrome c family heme-binding site FT signat ure" FT misc_feature complement(610893..610912) FT /colour=6 FT /note="ttaacatttctttcatttag, splice branch and acceptor" FT misc_feature complement(610965..610970) FT /colour=6 FT /note="gtaagg, splice donor sequence" FT CDS 612168..613709 FT /colour=7 FT /gene="SPAC13A11.05" FT /label=SPAC13A11.05 FT /note="SPAC13A11.05, len:513, SIMILARITY:Bos taurus, FT AMPL_BOVIN, cytosol aminopeptidase, (487 aa), fasta FT scores: opt: 1008, E():0, (42.1% identity in 442 aa)" FT /product="cytosol aminopeptidase; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c13A11.tab.seq.01665.out" FT misc_feature 612303..613607 FT /note="Match to PF00883 Peptidase_M17, Cytosol FT aminopeptidase family Score 764.41" FT misc_feature 613245..613268 FT /colour=8 FT /note="PS00631 Cytosol aminopeptidase signature" FT misc_feature 615315..615722 FT /note="Match to PF00205 TPP_enzymes, Thiamine FT pyrophosphate enzymes Score 168.62" FT misc_feature 615606..615728 FT /note="nominal overlap with cosmid SPAC3H8, EM:Z69086 S. FT pombe chromosome 1" FT misc_feature 615606..615728 FT /note="nominal overlap with cosmid SPAC13A11, EM:Z54096 FT S.pombe chromosome 1" FT misc_feature 615606..616913 FT /colour=9 FT /note="Pfam match to entry PF00205 TPP_enzymes, Thiamine FT pyrophosphate enzymes," FT CDS 618601..619935 FT /colour=7 FT /gene="SPAC3H8.02" FT /label=SPAC3H8.02 FT /note="SPAC3H8.02, len:444, SIMILARITY:Saccharomyces FT cerevisiae, Q06705, chromosome xii cosmid l3502., (408 aa), FT fasta scores: opt: 850, E():0, (34.7% identity in 412 FT aa)" FT /product="sec14 cytosolic factor family" FT /fasta_file="fasta/c3H8.tab.seq.01602.out" FT misc_feature 619060..619581 FT /colour=9 FT /note="Pfam match to entry PF00650 CRAL_TRIO, CRAL/TRIO FT domain.," FT CDS join(620743..620922,621094..621231) FT /colour=7 FT /gene="SPAC3H8.03" FT /label=SPAC3H8.03 FT /note="SPAC3H8.03, len:105, SIMILARITY:Saccharomyces FT cerevisiae, YCW1_YEAST, hypothetical 13.6 kD protein in FT cpr4-ssk22 intergenic region., (121 aa), fasta scores: FT opt: 143, E():0.00036, (38.9% identity in 72 aa)" FT /product="required for mitochondrial geneome integrity by FT similar to S. cerevisiae img2" FT /fasta_file="fasta/c3H8.tab.seq.01603.out" FT misc_feature 620923..620928 FT /note="splice donor sequence, gtaagt" FT misc_feature 621073..621093 FT /note="splice branch and acceptor sequence, FT ctaacaatattttat caatag" FT CDS 622419..623435 FT /colour=8 FT /gene="SPAC3H8.04" FT /label=SPAC3H8.04 FT /note="SPAC3H8.04, len:338," FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c3H8.tab.seq.01604.out" FT CDS complement(join(623653..624407,624447..624535, FT 624576..626953)) FT /colour=8 FT /gene="SPAC3H8.05c" FT /label=SPAC3H8.05c FT /note="SPAC3H8.05c, len:1073," FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c3H8.tab.seq.01605.out" FT misc_feature complement(624408..624422) FT /note="splice branch and acceptor sequence, FT ctaacgattatttag" FT misc_feature complement(624441..624446) FT /note="splice donor sequence, gtaagt" FT misc_feature complement(624536..624552) FT /note="splice branch and acceptor sequence, FT tactaacaattacac ag" FT misc_feature complement(624570..624575) FT /note="splice donor sequence, gtgagt" FT misc_feature complement(625757..625780) FT /note="PS00017 ATP/GTP-binding site motif A" FT CDS 628592..629860 FT /colour=2 FT /gene="aur1" FT /gene="SPAC3H8.06" FT /label=aur1 FT /note="SPAC3H8.06, len:422" FT /product="aureobasidin a resistance protein" FT /fasta_file="fasta/c3H8.tab.seq.01606.out" FT CDS complement(join(630559..630958,631003..631101, FT 631151..631161)) FT /colour=7 FT /gene="SPAC3H8.07c" FT /label=SPAC3H8.07c FT /note="SPAC3H8.07c, len:169, SIMILARITY:Homo sapiens, FT VBP1_HUMAN, von Hippel-Lindau binding protein 1, (160 aa), FT fasta scores: opt: 390, E():8.6e-20, (43.7% identity in FT 151 aa overlap)" FT /product="putative GIM complex; prefoldin subunit 3" FT /fasta_file="fasta/c3H8.tab.seq.01607.out" FT misc_feature complement(630959..630976) FT /note="splice branch and acceptor sequence, FT ttaatataatgtaat ttag" FT misc_feature complement(630997..631002) FT /note="splice donor sequence, gtaagg" FT misc_feature complement(631102..631114) FT /note="splice branch and acceptor sequence, ctaatatgaatag" FT misc_feature complement(631145..631150) FT /note="splice donor sequence, gtatgt" FT CDS complement(631736..633427) FT /colour=7 FT /gene="SPAC3H8.08c" FT /label=SPAC3H8.08c FT /note="SPAC3H8.08c, len:563, FT SIMILARITY:Schizosaccharomyces pombe, O60131, zinc finger FT protein., (560 aa), fasta scores: opt: 1127, E():0, (34.0% FT identity in 564 aa)" FT /product="putative transcriptional regulator; zinc finger FT protein; fungal binuclear cluster domain" FT /fasta_file="fasta/c3H8.tab.seq.01608.out" FT misc_feature complement(633263..633379) FT /colour=9 FT /note="Pfam match to entry PF00172 Zn_clus, fungal Zn(2)- FT Cys(6) binuclear cluster domain," FT misc_feature complement(633293..633376) FT /note="PS00463 fungal Zn(2)-Cys(6) binuclear cluster FT domain" FT CDS complement(join(634172..634635,634691..635031, FT 635114..636525)) FT /colour=7 FT /gene="SPAC3H8.09c" FT /label=SPAC3H8.09c FT /note="SPAC3H8.09c, len:738, SIMILARITY:Saccharomyces FT cerevisiae, NAB3_YEAST, nuclear polyadenylated RNA-binding FT protein nab3., (802 aa), fasta scores: opt: 232, E():2.4e- FT 06, (22.8% identity in 646 aa)" FT /product="putative RNA-binding protein" FT /fasta_file="fasta/c3H8.tab.seq.01609.out" FT misc_feature complement(634636..634653) FT /note="splice branch and acceptor sequence, FT ctaactttgtcttta tag" FT misc_feature complement(634685..634690) FT /note="splice donor sequence, gtacgt" FT misc_feature complement(635032..635045) FT /note="splice branch and acceptor sequence, ctaacgtaatacag" FT misc_feature complement(635108..635113) FT /note="splice donor sequence, gtaagg" FT misc_feature complement(635239..635433) FT /colour=9 FT /note="Pfam match to entry PF00076 rrm, RNA recognition FT motif. (aka RRM, RBD, or RNP domain)," FT misc_feature 638472..638476 FT /note="this TATAA was duplicated by an E. coli Tn1000 FT inse rtion. The Tn1000 sequence of 5981bp and the FT duplicated TA TAA has been removed from this sequence" FT CDS join(638668..638826,638875..639177,639374..639496, FT 639560..639835) FT /colour=2 FT /gene="spo20" FT /gene="sec14" FT /gene="SPAC3H8.10" FT /label=spo20 FT /note="SPAC3H8.10, len:286, SIMILARITY:Kluyveromyces FT lactis, SC14_KLULA, sec14 cytosolic factor, (301 aa), FT fasta scores: opt: 1160, E():0, (59.6% identity in 285 aa)" FT /product="involved in forespore membrane formation; FT similar to S. cerevisiae SEC14 cytosolic factor; FT phosphatidylinositol/phosphatidyl-choline transfer FT protein; golgi transport" FT /fasta_file="fasta/c3H8.tab.seq.01610.out" FT misc_feature 638827..638832 FT /note="splice donor sequence, gtaagt" FT intron 638827..638874 FT /colour=2 FT /note="confirmed intron" FT misc_feature 638858..638874 FT /note="splice branch and acceptor sequence, FT tactaatggattctt ag" FT misc_feature 638902..639459 FT /colour=9 FT /note="Pfam match to entry PF00650 CRAL_TRIO, CRAL/TRIO FT domain.," FT misc_feature 639178..639183 FT /note="splice donor sequence, gtaagt" FT misc_feature 639360..639373 FT /note="splice branch and acceptor sequence, ttaaccgtcttcag" FT misc_feature 639497..639502 FT /note="splice donor sequence, gtaagt" FT misc_feature 639546..639559 FT /note="splice branch and acceptor sequence, ttaacacgttaaag" FT misc_feature 640881..640934 FT /note="nominal overlap with cosmid SPAC1F3, EM:Z70690 S. FT pombe chromosome 1" FT misc_feature 640881..640934 FT /note="nominal overlap with cosmid SPAC3H8, EM:Z69086 S. FT pombe chromosome 1" FT misc_feature 641265..641888 FT /colour=9 FT /note="Pfam match to entry PF01612 3_5_exonuclease, 3'-5' FT exonuclease," FT misc_feature 641943..642185 FT /colour=9 FT /note="Pfam match to entry PF00570 HRDC, HRDC domain," FT CDS complement(643174..646524) FT /colour=2 FT /gene="mkh1" FT /gene="mhk1" FT /gene="pmk1" FT /gene="SPAC1F3.02c" FT /label=mhk1 FT /note="SPAC1F3.02c, len:1116" FT /product="MAPKK kinase; serine/threonine protein kinase; FT involved in cell wall maintenance; involved in chloride FT homeostasis" FT /fasta_file="fasta/c1F3.tab.seq.00427.out" FT misc_feature complement(643243..644046) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 283.77" FT misc_feature complement(643636..643674) FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT misc_feature complement(643963..644034) FT /colour=8 FT /note="PS00107 protein kinases ATP-binding region FT signature" FT LTR 647042..647391 FT /note="Tf1-type LTR" FT CDS join(647520..647621,647669..648098,648147..650052, FT 650096..650672) FT /colour=7 FT /gene="SPAC1F3.03" FT /label=SPAC1F3.03 FT /note="SPAC1F3.03, len:1004, LOW SIMILARITY:Saccharomyces FT cerevisiae, SNI2_YEAST, sni2 protein, (1010 aa), fasta FT scores: opt: 516, E():1.5e-25, (24.3% identity in 1016 aa)" FT /product="similar to regulators of exocytosis S. FT cerevisiae sro7/sro77 which function downstream of the FT Rho3p GTPase" FT /fasta_file="fasta/c1F3.tab.seq.00428.out" FT misc_feature 647622..647627 FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature 647652..647668 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ttaataacaaagatt ag" FT misc_feature 648099..648104 FT /colour=2 FT /note="splice donor sequence, gtacgt" FT misc_feature 648136..648146 FT /colour=2 FT /note="splice branch and acceptor sequence, ctaattttcag" FT misc_feature 650053..650058 FT /colour=2 FT /note="splice donor sequence, gtaagg" FT misc_feature 650080..650095 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaactattccatta g" FT CDS complement(join(650865..651528,651665..651867)) FT /colour=10 FT /gene="SPAC1F3.04c" FT /label=SPAC1F3.04c FT /note="SPAC1F3.04c, len:288, SIMILARITY:Saccharomyces FT cerevisiae, YO06_YEAST, hypothetical 35.7 kD protein in FT dnl4-slg1 intergenic region., (313 aa), fasta scores: opt: FT 874, E():0, (50.4% identity in 246 aa)" FT /product="conserved protein; similar to S. cerevisiae FT YOR006C" FT /fasta_file="fasta/c1F3.tab.seq.00429.out" FT misc_feature complement(651529..651540) FT /colour=2 FT /note="splice branch and acceptor sequence, ttaacgctgcag" FT misc_feature complement(651659..651664) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT CDS join(652948..652981,653051..653138,653194..653269, FT 653428..654762) FT /colour=7 FT /gene="SPAC1F3.05" FT /label=SPAC1F3.05 FT /note="SPAC1F3.05, len:510, SIMILARITY:Schizosaccharomyces FT pombe, P87157, hypothetical 59.5 kD protein c25h2.16c in FT chromosome ii., (533 aa), fasta scores: opt: 947, E():0, FT (37.0% identity in 533 aa)" FT /product="possibly involved in trafficking of proteins FT between the trans-Golgi network and the vacuole; similar FT to S. cerevisiae GGA2" FT /fasta_file="fasta/c1F3.tab.seq.00430.out" FT misc_feature 652982..652987 FT /colour=2 FT /note="splice donor sequence, gtgagt" FT misc_feature 653036..653050 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctgacaagtaattag" FT misc_feature join(653047..653138,653194..653269,653428..653667) FT /note="Match to PF00790 VHS, VHS domain Score 196.83" FT misc_feature 653139..653144 FT /colour=2 FT /note="splice donor sequence, gtacgt" FT misc_feature 653180..653193 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctgactttttcgcag" FT misc_feature 653270..653275 FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature 653410..653427 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ttaacataagtgctt tag" FT CDS complement(655106..660979) FT /colour=2 FT /gene="spo15" FT /gene="SPAC1F3.06c" FT /label=spo15 FT /note="SPAC1F3.06c, len:1957" FT /product="mutant defective in spore formation; putative FT coiled-coil protein; possibly localizes to microtubules; FT colocalizes with sad1 spindle pole body component during FT meiotic and vegetative growth; no apparent S. cerevisiae FT ortholog" FT /fasta_file="fasta/c1F3.tab.seq.00431.out" FT CDS complement(join(661232..662100,662175..662517)) FT /colour=8 FT /gene="SPAC1F3.07c" FT /label=SPAC1F3.07c FT /note="SPAC1F3.07c, len:403" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c1F3.tab.seq.00432.out" FT misc_feature complement(662101..662114) FT /colour=2 FT /note="splice branch and acceptor sequence, ctaatttagtcaag" FT misc_feature complement(662169..662174) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT CDS complement(662824..663150) FT /colour=8 FT /gene="SPAC1F3.08c" FT /label=SPAC1F3.08c FT /note="SPAC1F3.08c, len:108" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c1F3.tab.seq.00433.out" FT CDS join(664613..664647,664745..664911,665025..665852, FT 665910..665990,666061..666635) FT /colour=10 FT /gene="SPAC1F3.09" FT /label=SPAC1F3.09 FT /note="SPAC1F3.09, len:561, LOW SIMILARITY:Caenorhabditis FT elegans., O16213, f17a9.3 protein., (509 aa), fasta FT scores: opt: 278, E():1.5e-10, (26.5% identity in 306 aa). FT NOTE:corresponding transcript SPD244 is framshifted w.r.t FT this sequence; it also does not use the two final FT predicted splice sites; however this prediction shows FT reasonable homology to yeast YGR093W in this region and FT hence has been kept; it is putative this locus displays FT alteRNAtive splicing, or SPD244 is incompletely spliced" FT /product="conserved protein; similar to S. cerevisiae FT YGR093W" FT /fasta_file="fasta/c1F3.tab.seq.00434.out" FT misc_feature 664648..664653 FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature 664726..664744 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacatagattcga atag" FT misc_feature 664912..664917 FT /colour=2 FT /note="splice donor sequence, gtatga" FT misc_feature 665009..665024 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacctgagctgta g" FT misc_feature 665853..665858 FT /colour=2 FT /note="splice donor sequence, gtgagt" FT misc_feature 665893..665909 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacttcttttctc ag" FT misc_feature 665991..665996 FT /colour=2 FT /note="splice donor sequence, gtacgt" FT misc_feature 666049..666060 FT /colour=2 FT /note="splice branch and acceptor sequence, ctaacgactcag" FT CDS complement(666699..668987) FT /EC_number="3.4.24.59" FT /colour=7 FT /gene="SPAC1F3.10c" FT /label=SPAC1F3.10c FT /note="SPAC1F3.10c, len:762, SIMILARITY:Schizophyllum FT commune, PMIP_SCHCO, mitochondrial intermediate peptidase , FT (775 aa), fasta scores: opt: 1569, E():0, (37.1% FT identity in 779 aa)" FT /product="putative mitochondrial intermediate peptidase; FT duplicated in S. pombe" FT /fasta_file="fasta/c1F3.tab.seq.00435.out" FT misc_feature complement(666738..668666) FT /colour=9 FT /note="Pfam match to entry PF01432 Peptidase_M3, Peptidase FT family M3," FT misc_feature complement(667338..667367) FT /colour=8 FT /note="PS00142 Neutral zinc metallopeptidases, zinc FT binding region signature" FT misc_feature 668988..669174 FT /note="nominal overlap with cosmid SPAC1D4, EM:Z69239 S. FT pombe chromosome 1" FT misc_feature 668988..669120 FT /note="the sequence of this region is derived from cosmid FT c 1F3, the true end of c1D4 is at position 134, while the FT true end of c1F3 is at position 4137 in this sequence" FT misc_feature 668988..669174 FT /note="nominal overlap with cosmid SPAC1F3, EM:Z70690 S. FT pombe chromosome 1" FT CDS complement(join(670075..670623,670673..670860, FT 670957..671077,671124..671303)) FT /colour=7 FT /gene="SPAC1D4.02c" FT /label=SPAC1D4.02c FT /note="SPAC1D4.02c, len:345, SIMILARITY:Rattus norvegicus, FT O35254, golgi peripheral membrane protein p65., (451 aa), FT fasta scores: opt: 493, E():4.7e-20, (34.4% identity in FT 305 aa)" FT /product="putative spindle checkpoint by similar to S. FT cerevisiae grh1, has similar to mammalian GRASP proteins" FT /fasta_file="fasta/c1D4.tab.seq.00505.out" FT misc_feature complement(670624..670638) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacaatttaacag" FT misc_feature complement(670667..670672) FT /colour=2 FT /note="splice donor sequence, gtatgt" FT misc_feature complement(670861..670873) FT /colour=2 FT /note="splice branch and acceptor sequence, ctaacgactacag" FT misc_feature complement(670951..670956) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature complement(671078..671095) FT /colour=6 FT /note="ctaaagtgtttttcacag, splice branch and acceptor" FT misc_feature complement(671118..671123) FT /colour=6 FT /note="gtatga, splice donor sequence" FT CDS complement(join(671561..671807,671894..673188)) FT /colour=10 FT /gene="SPAC1D4.03c" FT /label=SPAC1D4.03c FT /note="SPAC1D4.03c, len:513, SIMILARITY:Fugu rubripes, FT Q9YGN1, sand protein., (520 aa), fasta scores: opt: 609, FT E():7.2e-32, (28.5% identity in 407 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YGL124C; highly similar to pufferfish SAND protein, a FT receptor for plasminogen related growth factors?" FT /fasta_file="fasta/c1D4.tab.seq.00506.out" FT misc_feature complement(671808..671823) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaactatgttttta g" FT misc_feature complement(671888..671893) FT /colour=2 FT /note="splice donor sequence, gtacgt" FT CDS join(674387..674389,674426..674557,674605..676053) FT /colour=2 FT /gene="cct2" FT /gene="SPAC1D4.04" FT /label=cct2 FT /note="SPAC1D4.04, len:527" FT /product="t-complex protein 1, beta subunit" FT /fasta_file="fasta/c1D4.tab.seq.00507.out" FT misc_feature 674412..674425 FT /colour=2 FT /note="splice branch and acceptor sequence, tactaacgatatag" FT misc_feature join(674516..674557,674605..676032) FT /note="Match to PF00118 cpn60_TCP1, TCP-1/cpn60 chaperonin FT family Score 590.77" FT misc_feature 674558..674563 FT /colour=2 FT /note="splice donor sequence, gtaagg" FT misc_feature 674591..674604 FT /colour=2 FT /note="splice branch and acceptor sequence, ttaacgatttatag" FT misc_feature 674728..674754 FT /colour=8 FT /note="PS00995 Chaperonins TCP-1 signature 3" FT CDS complement(join(676269..677353,677406..677484)) FT /colour=7 FT /gene="SPAC1D4.05c" FT /label=SPAC1D4.05c FT /note="SPAC1D4.05c, len:387, LOW SIMILARITY:Mus musculus, FT Q9Z0U0, polytropic murine leukamia virus receptor syg1., FT (695 aa), fasta scores: opt: 261, E():1.5e-10, (25.1% FT identity in 398 aa) also shows low similar to, FT Saccharomyces cerevisiae, ERD1_YEAST, ERD1 protein., (362 FT aa), fasta scores: opt: 187, E(): 1e-05, (23.6% identity FT in 382 aa)" FT /note="SPAC1D4.05c, len:387, SIMILARITY:Mus musculus, FT Q9Z0U0, polytropic murine leukamia virus receptor syg1., FT (695 aa), fasta scores: opt: 261, E():1.5e-10, (25.1% FT identity in 398 aa)" FT /product="protein similar to S. cerevisiae ERD1- protein FT required for retention of luminal ER proteins" FT /fasta_file="fasta/c1D4.tab.seq.00508.out" FT misc_feature complement(677354..677376) FT /colour=2 FT /note="splice branch and acceptor sequence, FT tactaacaatctcta ttctttag" FT misc_feature complement(677400..677405) FT /colour=2 FT /note="splice donor sequence, gtatga" FT CDS complement(join(677977..678177,678290..678505, FT 678566..679069)) FT /colour=2 FT /gene="csk1" FT /gene="SPAC1D4.06c" FT /label=csk1 FT /note="SPAC1D4.06c, len:306" FT /product="cyclin dependant kinase activating kinase (CAK) FT ; serine/threonine protein kinase; similar to S. FT cerevisiae CIV1" FT /fasta_file="fasta/c1D4.tab.seq.00509.out" FT misc_feature complement(678178..678192) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaactgtttttaag" FT misc_feature complement(678284..678289) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature complement(678506..678521) FT /colour=2 FT /note="splice donor sequence, ctaacgttttttttag" FT misc_feature complement(678560..678565) FT /colour=2 FT /note="splice donor sequence, gtatgt" FT misc_feature complement(678623..679039) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 58.05" FT CDS complement(679125..679565) FT /colour=9 FT /gene="SPAC1D4.07c" FT /label=SPAC1D4.07c FT /note="SPAC1D4.07c, len:146" FT /product="very hypothetical protein" FT /fasta_file="fasta/c1D4.tab.seq.00510.out" FT CDS join(680490..680569,680849..681524) FT /EC_number="2.7.8.11" FT /colour=7 FT /gene="SPAC1D4.08" FT /label=SPAC1D4.08 FT /note="SPAC1D4.08, len:251, SIMILARITY:Saccharomyces FT cerevisiae, PIS_YEAST, cdp-diacylglycerol--inositol 3- FT phosphatidyltransferase, (220 aa), fasta scores: opt: 503, FT E():2.5e-27, (40.6% identity in 217 aa)" FT /product="putative cdp-diacylglycerol--inositol 3- FT phosphatidyltransferase" FT /fasta_file="fasta/c1D4.tab.seq.00511.out" FT misc_feature 680570..680575 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 680934..681473 FT /note="Match to PF01066 CDP-OH_P_transf, CDP-alcohol FT phosphatidyltransferase Score 206.98" FT misc_feature 680973..681041 FT /colour=8 FT /note="PS00379 CDP-alcohol phosphatidyltransferases FT signatu re" FT CDS complement(join(682035..682205,682252..682374, FT 682439..682854,682898..682910)) FT /colour=10 FT /gene="SPAC1D4.09c" FT /label=SPAC1D4.09c FT /note="SPAC1D4.09c, len:240, SIMILARITY: Caenorhabditis FT elegans., O02209, C01A2.5 protein, (300 aa), fasta scores: FT opt: 135, E():0.053, (32.4% identity in 204 aa)" FT /product="conserved protein; no apparent S. cerevisiae FT ortholog" FT /fasta_file="fasta/c1D4.tab.seq.00512.out" FT intron complement(682206..682251) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(682375..682389) FT /colour=6 FT /note="ctaacacaacatcag, splice branch and acceptor" FT misc_feature complement(682433..682438) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(682855..682868) FT /colour=6 FT /note="ttaacatgttttag, splice branch and acceptor" FT misc_feature complement(682892..682897) FT /colour=6 FT /note="gtagga, splice donor sequence" FT CDS join(683450..683834,683872..685916) FT /colour=10 FT /gene="SPAC1D4.10" FT /label=SPAC1D4.10 FT /note="SPAC1D4.10, len:809, LOW SIMILARITY:Saccharomyces FT cerevisiae, YK59_YEAST, hypothetical 96.8 kD protein in FT sis2-mtd1 intergenic region., (838 aa), fasta scores: opt: FT 307, E():1.4e-11, (27.7% identity in 860 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YKR079C" FT /fasta_file="fasta/c1D4.tab.seq.00513.out" FT misc_feature 683835..683840 FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature 683852..683871 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ttaataatttctgac aatag" FT CDS complement(686436..688163) FT /colour=2 FT /gene="lkh1" FT /gene="SPAC1D4.11c" FT /label=lkh1 FT /note="SPAC1D4.11c, len:690, SIMILARITY:Arabidopsis FT thaliana, Q39184, protein kinase., (467 aa), fasta scores: FT opt: 1120, E():0, (42.8% identity in 421 aa)" FT /product="dual specificity protein kinase; LAMMER family; FT negative regulator of filamentous growth and flocculation; FT serine/threonine protein kinase" FT /fasta_file="fasta/c1D4.tab.seq.00514.out" FT misc_feature complement(686463..687425) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 233.86" FT misc_feature complement(687021..687059) FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT misc_feature complement(687336..687407) FT /colour=8 FT /note="PS00107 protein kinases ATP-binding region FT signature" FT misc_feature complement(688509..694457) FT /note="low complexity gene-free region" FT misc_feature 690343..690459 FT /note="repetitive DNA similar to H. sapiens" FT misc_RNA complement(692820..693028) FT /note="cDNA EST, but cannot predict corresponding gene FT here" FT CDS 694458..696776 FT /colour=2 FT /gene="rad15" FT /gene="rhp3" FT /gene="SPAC1D4.12" FT /label=rad15 FT /note="SPAC1D4.12, len:772" FT /product="DNA repair protein; transcription initiation FT factor TFIIH subunit; involved in excision repair; FT DEAD/DEAH box helicase; Xeroderma pigmentosum group D FT protein signature; similar to S. cerevisiae RAD3" FT /fasta_file="fasta/c1D4.tab.seq.00515.out" FT CDS 697829..698851 FT /colour=2 FT /gene="byr1" FT /gene="ste1" FT /gene="ste3" FT /gene="SPAC1D4.13" FT /label=byr1 FT /note="SPAC1D4.13, len:340" FT /product="serine/threonine protein kinase; MAPKK; FT conjugation and sporulation protein kinase; pheromone FT signalling pathway" FT /fasta_file="fasta/c1D4.tab.seq.00516.out" FT misc_feature 698024..698788 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 309.65" FT misc_feature 698042..698107 FT /colour=8 FT /note="PS00107 protein kinases ATP-binding region FT signature" FT misc_feature 698372..698410 FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT LTR complement(699462..699807) FT /note="tf2 type LTR" FT misc_feature complement(700076..700188) FT /note="nominal overlap with cosmid SPAC22F3, EM:Z54285 S. FT pombe chromosome 1" FT misc_feature 700104..700109 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 700139..700158 FT /colour=6 FT /note="ttaacagaatataattttag, splice branch and acceptor" FT misc_feature 700076..700188 FT /note="nominal overlap with cosmid SPAC1D4, EM:Z69239 S. FT pombe chromosome 1" FT misc_feature 700104..700109 FT /colour=2 FT /note="splice donor sequence, gtaaga" FT misc_feature 700139..700158 FT /colour=2 FT /note="splice acceptor sequence, ttaacagaatataattttag" FT CDS complement(705215..707914) FT /colour=8 FT /gene="SPAC22F3.13" FT /label=SPAC22F3.13 FT /note="SPAC22F3.13, len:899, SIMILARITY:Rattus norvegicus, FT Q9Z136, hamartin., (1163 aa), fasta scores: opt: 215, FT E():2.2e-05, (22.7% identity in 427 aa)" FT /product="hypothetical protein; sequence orphan; predicted FT coiled-coil" FT /fasta_file="fasta/c22F3.tab.seq.01520.out" FT CDS 709852..711297 FT /colour=2 FT /gene="rgs1" FT /gene="SPAC22F3.12c" FT /label=rgs1 FT /note="SPAC22F3.12c, len:481, SIMILARITY:Emericella FT nidulans, FLBA_EMENI, developmental regulator flba., (719 FT aa), fasta scores: opt: 345, E():1.1e-15, (26.9% identity FT in 465 aa)" FT /product="regulator of G-protein signalling" FT /fasta_file="fasta/c22F3.tab.seq.01521.out" FT misc_feature 710545..710784 FT /note="Match to PF00610 DEP, Domain found in Dishevelled, FT Egl-10, and Pleckstrin Score 93.07" FT misc_feature 710884..711273 FT /note="Match to PF00615 RGS, Regulator of G protein FT signaling domain Score 203.24" FT CDS join(712550..712710,712778..712785,712836..713122) FT /colour=8 FT /gene="SPAC22F3.11c" FT /label=SPAC22F3.11c FT /note="SPAC22F3.11c, len:151" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c22F3.tab.seq.01522.out" FT misc_feature 712711..712716 FT /colour=2 FT /note="splice donor sequence, gttggt" FT misc_feature 712762..712777 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ttgaccatctaaata g" FT misc_feature 712786..712791 FT /colour=2 FT /note="splice donor sequence, gtatgt" FT misc_feature 712821..712835 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacttattaacag" FT CDS join(713686..713769,714021..715946) FT /EC_number="6.3.2.2" FT /colour=2 FT /gene="gcs1" FT /gene="SPAC22F3.10c" FT /label=gcs1 FT /note="SPAC22F3.10c, len:669" FT /product="glutamate--cysteine ligase" FT /fasta_file="fasta/c22F3.tab.seq.01523.out" FT misc_feature 713770..713775 FT /colour=2 FT /note="splice donor sequence, gtacgt" FT misc_feature 714003..714020 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaactttttatctt tag" FT CDS join(716269..716500,716665..718406) FT /colour=2 FT /gene="mcs1" FT /gene="res2" FT /gene="pct1" FT /gene="SPAC22F3.09c" FT /label=res2 FT /note="SPAC22F3.09c, len:657" FT /product="Mlu-box binding factor (MBF) component; FT transcriptional activation complex; involved in control of FT start; yeast DNA binding domain; partner of Cdc10p FT transcription factor; ankyrin repeat protein; similar to FT S. cerevisiae MBP1" FT /fasta_file="fasta/c22F3.tab.seq.01524.out" FT misc_feature 716501..716506 FT /colour=2 FT /note="splice donor sequence, gtaagt" FT intron 716501..716664 FT /colour=2 FT /note="confirmed intron" FT misc_feature 716648..716664 FT /colour=2 FT /note="splice branch and acceptor sequence, FT tattaaccaaactat ag" FT misc_feature 717171..717269 FT /note="Match to PF00023 ank, Ank repeat Score 46.99" FT misc_feature 717534..717632 FT /note="Match to PF00023 ank, Ank repeat Score 36.20" FT CDS 719159..720604 FT /colour=7 FT /gene="SPAC22F3.08c" FT /label=SPAC22F3.08c FT /note="SPAC22F3.08c, len:481, SIMILARITY:Saccharomyces FT cerevisiae, ROK1_YEAST, ATP-dependent RNA helicase rok1, FT (564 aa), fasta scores: opt: 1240, E():0, (43.0% identity FT in 477 aa)" FT /product="ATP-dependent RNA helicase" FT /fasta_file="fasta/c22F3.tab.seq.01525.out" FT misc_feature 719333..719950 FT /note="Match to PF00270 DEAD, DEAD/DEAH box helicase Score FT 190.65" FT misc_feature 719426..719449 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 719738..719764 FT /colour=8 FT /note="PS00039 DEAD-box subfamily ATP-dependent helicases FT s ignature" FT misc_feature 720089..720307 FT /note="Match to PF00271 helicase_C, Helicases conserved C- FT terminal domain Score 117.42" FT CDS join(721206..721332,721382..721479,721529..721660) FT /colour=8 FT /gene="SPAC22F3.07c" FT /label=SPAC22F3.07c FT /note="SPAC22F3.07c, len:118" FT /product="hypothetical protein; putative ATP20 homolgue?" FT /fasta_file="fasta/c22F3.tab.seq.00030.out" FT misc_feature 721333..721338 FT /colour=2 FT /note="splice donor sequence, gtattt" FT misc_feature 721362..721381 FT /colour=2 FT /note="splice branch and acceptor sequence, FT aactaactttttcaa tttag" FT misc_feature 721480..721485 FT /colour=2 FT /note="splice donor sequence, gtaagc" FT misc_feature 721513..721528 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaatttctcttttag" FT CDS 723507..726710 FT /colour=7 FT /gene="SPAC22F3.06c" FT /label=SPAC22F3.06c FT /note="SPAC22F3.06c, len:1067, SIMILARITY:Caenorhabditis FT elegans., LONM_CAEEL, mitochondrial lon protease homolog , FT (971 aa), fasta scores: opt: 2481, E():0, (43.7% identity FT in 923 aa)" FT /product="mitochondrial lon protease homolog" FT /fasta_file="fasta/c22F3.tab.seq.01527.out" FT misc_feature 725226..725810 FT /note="Match to PF00004 AAA, ATPases associated with FT various cellular activities (AAA) Score 124.93" FT misc_feature 725238..725261 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 725253..725276 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 726333..726359 FT /colour=8 FT /note="PS01046 ATP-dependent serine proteases, lon family, FT serine active site" FT misc_feature join(726967..727031,727077..727131,727172..727244, FT 727297..727442,727481..727561,727604..727717) FT /note="Match to PF00025 arf, ADP-ribosylation factor FT family Score 126.00" FT CDS join(726967..727031,727077..727131,727172..727244, FT 727297..727442,727481..727561,727604..727744) FT /colour=2 FT /gene="SPAC22F3.05c" FT /gene="alp41" FT /label=alp41 FT /note="SPAC22F3.05c, len:186" FT /product="adp-ribosylation factor-like protein" FT /fasta_file="fasta/c22F3.tab.seq.01528.out" FT misc_feature 727032..727037 FT /colour=2 FT /note="splice donor and acceptor sequence, gtaaga" FT misc_feature 727064..727076 FT /colour=2 FT /note="splice branch and acceptor sequence, ctaatgactttag" FT misc_feature 727078..727101 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 727132..727137 FT /colour=2 FT /note="splice donor and acceptor sequence, gtaagt" FT misc_feature 727153..727171 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ataatttatcgattg atag" FT misc_feature 727245..727250 FT /colour=2 FT /note="splice donor sequence, gtacgt" FT misc_feature 727285..727296 FT /colour=2 FT /note="splice branch and acceptor sequence, tactaattcaag" FT misc_feature 727443..727448 FT /colour=2 FT /note="splice donor sequence, gtaggc" FT misc_feature 727466..727480 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ttaacatgcatatag" FT misc_feature 727562..727567 FT /colour=2 FT /note="splice donor sequence, gtcagt" FT misc_feature 727588..727603 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacaacaagtcaa g" FT CDS complement(join(727709..727853,727899..728117, FT 728156..728517,728560..728780,728824..729039, FT 729086..732209)) FT /colour=10 FT /gene="SPAC22F3.04" FT /label=SPAC22F3.04 FT /note="SPAC22F3.04, len:1428, FT SIMILARITY:Schizosaccharomyces pombe, YD22_SCHPO, FT hypothetical 170.7 kD protein c56f8.02 in chromosome i., FT (1517 aa), fasta scores: opt: 1491, E():0, (29.9% identity FT in 1370 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YOR093C" FT /fasta_file="fasta/c22F3.tab.seq.01529.out" FT misc_feature complement(727854..727868) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ataacaatattttag" FT misc_feature complement(727893..727898) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature complement(728118..728129) FT /colour=2 FT /note="splice branch and acceptor sequence, ctaatgtcacag" FT misc_feature complement(728150..728155) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature complement(728518..728532) FT /colour=2 FT /note="splice branch and acceptor sequence, FT tactaattaatatag" FT misc_feature complement(728554..728559) FT /colour=2 FT /note="splice donor sequence, gtacgt" FT misc_feature complement(728781..728796) FT /colour=2 FT /note="splice branch and acceptor sequence, tactaac FT aagacct ag" FT misc_feature complement(728818..728823) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature complement(729040..729055) FT /colour=2 FT /note="splice branch and accceptor sequence, FT ttaacgcatattat ag" FT misc_feature complement(729080..729085) FT /colour=2 FT /note="splice donor sequence, gtaaat" FT tRNA complement(732751..732823) FT /note="tRNA Val anticodon TAC, Cove score 76.36" FT CDS join(733465..733643,733691..733789,733881..733956, FT 734127..734212,734249..734439,734492..734565, FT 734601..734732,734771..734834,734871..734969, FT 735009..735166,735205..735277,735313..735928, FT 735968..736037,736080..736328,736364..736504) FT /colour=7 FT /gene="SPAC22F3.03c" FT /label=SPAC22F3.03c FT /note="SPAC22F3.03c, len:768, SIMILARITY:Saccharomyces FT cerevisiae, YBS3_YEAST, hypothetical 108.0 kD helicase in FT hsp26-tif32 intergenic region., (958 aa), fasta scores: FT opt: 968, E():0, (37.1% identity in 631 aa)" FT /product="DEAD box helicase; putative DNA repair" FT /fasta_file="fasta/c22F3.tab.seq.01530.out" FT misc_feature 733644..733649 FT /colour=2 FT /note="splice donor sequence, gtatgg" FT misc_feature 733675..733690 FT /colour=2 FT /note="splice branch and acceptor sequence, FT tgactaaacgcgtca g" FT misc_feature 733790..733795 FT /colour=2 FT /note="splice donor sequence, gtattc" FT misc_feature 733863..733880 FT /colour=2 FT /note="splice branch and acceptor sequence FT tattaatatatgttaa ag" FT misc_feature 733957..733962 FT /colour=2 FT /note="splice donor sequence, gtaaga" FT misc_feature 734110..734126 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacacaatgtacc ag" FT misc_feature 734213..734218 FT /colour=2 FT /note="splice donor sequence, gtatgg" FT misc_feature 734237..734248 FT /colour=2 FT /note="splice branch and acceptor sequence ctaacattacag" FT misc_feature 734301..734453 FT /note="Match to PF00176 SNF2_N, SNF2 and others N-terminal FT domain Score 85.94" FT misc_feature 734440..734445 FT /colour=2 FT /note="splice donor sequence, gtatga" FT misc_feature 734475..734491 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaatcttattattt ag" FT misc_feature join(734482..734565,734601..734738) FT /note="Match to PF00176 SNF2_N, SNF2 and others N-terminal FT domain Score 42.47" FT misc_feature 734566..734571 FT /colour=2 FT /note="splice donor sequence,gtaagt" FT misc_feature 734588..734600 FT /colour=2 FT /note="splice branch and acceptor sequence, tactaatggctag" FT misc_feature 734733..734738 FT /colour=2 FT /note="splice donor sequence,gtaatt" FT misc_feature 734758..734770 FT /colour=2 FT /note="splice branch and acceptor sequence ctaattgctaaag" FT misc_feature join(734768..734969,735009..735166) FT /note="Match to PF00176 SNF2_N, SNF2 and others N-terminal FT domain Score 129.02" FT misc_feature 734970..734975 FT /colour=2 FT /note="splice donor sequence, gtatga" FT misc_feature 734997..735008 FT /colour=2 FT /note="splice branch and acceptor sequence ttaaccgctcag" FT misc_feature 735167..735172 FT /colour=2 FT /note="splice donor sequence, gtttgt" FT misc_feature 735192..735204 FT /colour=2 FT /note="splice branch and acceptor sequence tactgatttttag" FT misc_feature join(735205..735277,735313..735464) FT /note="Match to PF00176 SNF2_N, SNF2 and others N-terminal FT domain Score 54.17" FT misc_feature 735278..735283 FT /colour=2 FT /note="splice donor sequence, gtatgc" FT misc_feature 735299..735312 FT /colour=2 FT /note="splice branch and acceptor sequence tattaacataatag" FT misc_feature 735636..735893 FT /note="Match to PF00271 helicase_C, Helicases conserved C- FT terminal domain Score 96.00" FT misc_feature 735929..735934 FT /colour=2 FT /note="splice donor sequence, gtacga" FT misc_feature 735948..735967 FT /colour=2 FT /note="splice branch and acceptor sequence, ataacatattaag" FT misc_feature 736038..736043 FT /colour=2 FT /note="splice donor sequence, gtatgt" FT misc_feature 736063..736079 FT /colour=2 FT /note="splice branch and acceptor sequence, FT tactgacttgattgt ag" FT misc_feature 736329..736334 FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature 736347..736363 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaatattaatggcc ag" FT CDS complement(736520..737149) FT /colour=2 FT /gene="atf31" FT /gene="SPAC22F3.02" FT /label=atf31 FT /note="SPAC22F3.02, len:209, FT SIMILARITY:Schizosaccharomyces pombe, ATF1_SCHPO, FT transcription factor atf1, (566 aa), fasta scores: opt: FT 263, E():2.3e-09, (38.4% identity in 138 aa)" FT /product="b-ZIP (basic-leucine-zipper) transcription FT factor family; multicopy supressor of calcium sensitivity FT of Atf1 deletants PMID: 10102365); no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c22F3.tab.seq.01531.out" FT misc_feature complement(736607..736783) FT /note="Match to PF00170 bZIP, bZIP transcription factor FT Score 53.35" FT misc_feature complement(736727..736768) FT /colour=8 FT /note="PS00036 bZIP transcription factors basic domain FT signature," FT misc_feature complement(737804..737819) FT /colour=2 FT /note="splice branch and acceptor sequence ctaatttactag" FT misc_feature complement(737838..737843) FT /colour=2 FT /note="splice donor sequence,gtaagt" FT misc_feature complement(738608..738619) FT /colour=2 FT /note="splice branch and acceptor sequence ctaatttactag" FT misc_feature 738610..738723 FT /note="nominal overlap with cosmid SPAC1296, EM:AL035439 FT S. pombe chromosome 1" FT misc_feature complement(738649..738654) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature complement(738610..738723) FT /note="nominal overlap with cosmid SPAC22F3, EM:Z54285 S. FT pombe chromosome 1" FT misc_feature complement(738649..738654) FT /note="gtaagt, splice donor sequence" FT misc_feature complement(739016..739033) FT /colour=6 FT /note="ctaatacttag, splice branch and acceptor" FT misc_feature complement(739098..739103) FT /colour=6 FT /note="gtttgt, splice donor sequence" FT misc_feature complement(739321..739333) FT /colour=6 FT /note="ctaacaatcttag, splice branch and acceptor" FT misc_feature complement(739415..739420) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature complement(739507..739524) FT /colour=6 FT /note="ttaacattttatttatag, splice branch and acceptor" FT misc_feature complement(739566..739571) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT CDS join(740977..741088,741444..741826) FT /EC_number="1.9.3.1" FT /colour=2 FT /gene="cox4" FT /gene="SPAC1296.02" FT /label=cox4 FT /note="SPAC1296.02, len:164" FT /product="cytochrome c oxidase subunit IV" FT /fasta_file="fasta/c1296.tab.seq.01239.out" FT misc_feature 741089..741094 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 741154..741453 FT /colour=9 FT /note="Pfam match to entry PF01215 COX5B, Cytochrome c FT oxid ase subunit Vb" FT misc_feature 741429..741443 FT /colour=6 FT /note="ctaacattcttttag, splice branch and acceptor" FT CDS complement(742167..743690) FT /colour=2 FT /gene="sxa2" FT /gene="SPAC1296.03c" FT /label=sxa2 FT /note="SPAC1296.03c, len:507" FT /product="putative serine carboxypeptidase; involved in FT mating response" FT /fasta_file="fasta/c1296.tab.seq.01240.out" FT misc_feature complement(742182..743498) FT /colour=9 FT /note="Pfam match to entry PF00450 serine_carbpept, Serine FT carboxypeptidase" FT CDS join(745694..745822,745899..746297) FT /colour=10 FT /gene="SPAC1296.04" FT /label=SPAC1296.04 FT /note="SPAC1296.04, len:175" FT /product="hypothetical protein; this *may* be the ortholog FT of S. cerevisiae SPO73; similarity is *very low* but they FT are reciprocal best hits" FT /fasta_file="fasta/c1296.tab.seq.01241.out" FT misc_feature 745823..745828 FT /colour=6 FT /note="gtataa, splice donor sequence" FT misc_feature 745883..745898 FT /colour=6 FT /note="ttaacgttttctatag, splice branch and acceptor" FT CDS complement(join(746616..747261,747350..747480)) FT /colour=7 FT /gene="SPAC1296.05c" FT /label=SPAC1296.05c FT /note="SPAC1296.05c, len:258" FT /product="putative cyclin related protein" FT /fasta_file="fasta/c1296.tab.seq.01242.out" FT misc_feature complement(747262..747274) FT /colour=6 FT /note="ttaacattgttag, splice branch and acceptor" FT misc_feature complement(747344..747349) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT tRNA complement(747795..747866) FT /note="tRNA Glu anticodon TTC" FT misc_feature 749258..749263 FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature 749326..749338 FT /colour=6 FT /note="ctaattattatag, splice branch and acceptor" FT misc_feature 749417..749422 FT /colour=6 FT /note="gttcgt, splice donor sequence" FT misc_feature 749565..749581 FT /colour=6 FT /note="gtaacttattttcaaag, splice branch and acceptor" FT misc_feature 749663..750319 FT /colour=9 FT /note="Pfam match to entry PF00667 FAD_binding, potential FT FAD binding domain" FT misc_feature 749701..749706 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 749724..749741 FT /colour=6 FT /note="cttacttattttttgcag, splice branch and acceptor" FT misc_feature 750395..750730 FT /colour=9 FT /note="Pfam match to entry PF00175 oxidored_fad, FT Oxidoreductase FAD/NAD-binding domain" FT CDS join(749123..749257,749339..749416,749582..749700, FT 749742..751086) FT /EC_number="1.6.2.4" FT /colour=7 FT /gene="SPAC1296.06" FT /label=SPAC1296.06 FT /note="SPAC1296.06, len:558, SIMILARITY:Saccharomyces FT cerevisiae, Q12181, hypothetical 72.3 kD protein ypr044w., FT (623 aa), fasta scores: opt: 656, E():0, (32.5% identity FT in 631 aa)" FT /product="putative NADPH cytochrome reductase" FT /fasta_file="fasta/c1296.tab.seq.01243.out" FT misc_feature 751082..751189 FT /note="nominal overlap with cosmid SPAC1296, EM:AL035439 FT S. pombe chromosome 1" FT CDS complement(join(751293..751919,751964..752169, FT 752218..752671,752739..753101)) FT /colour=2 FT /gene="vps17" FT /gene="SPAPJ696.01c" FT /label=vps17 FT /note="SPAP696.01c, len:549, LOW SIMILARITY:Saccharomyces FT cerevisiae, VP17_YEAST, vacuolar protein sorting- FT associated protein vps17., (551 aa), fasta scores: opt: FT 747, E():0, (28.2% identity in 547 aa)" FT /product="putative vacuolar sorting protein" FT /fasta_file="fasta/pJ696.tab.seq.00151.out" FT misc_feature complement(751920..751933) FT /colour=6 FT /note="cttactggaattag, splice branch and acceptor" FT misc_feature complement(751958..751963) FT /colour=6 FT /note="gtaaaa, splice donor sequence" FT misc_feature complement(752170..752186) FT /colour=6 FT /note="ctaacttttcgacatag, splice branch and acceptor" FT misc_feature complement(752212..752217) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(752475..752816) FT /colour=9 FT /note="Pfam match to entry PF00787 PX, PX domain," FT misc_feature complement(752672..752683) FT /colour=6 FT /note="ctaacttcgtag, splice branch and acceptor" FT misc_feature complement(752733..752738) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS join(753965..754001,754054..754094,754182..755396) FT /colour=10 FT /gene="SPAPJ696.02" FT /label=SPAPJ696.02 FT /note="SPAPJ696.02, len:430, SIMILARITY:Mus musculus, FT O08641, ray protein., (340 aa), fasta scores: opt: 735, FT E():0, (37.1% identity in 428 aa)" FT /product="conserved SH3 Src homology domain protein" FT /fasta_file="fasta/pJ696.tab.seq.00152.out" FT misc_feature 754002..754007 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 754042..754053 FT /colour=6 FT /note="ctaacatttaag, splice branch and acceptor" FT misc_feature 754095..754100 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 754164..754181 FT /colour=6 FT /note="ttaactgttttaatttag, splice branch and acceptor" FT misc_feature 755226..755384 FT /note="Match to PF00018 SH3, Src homology domain 3 Score FT 78.78" FT misc_feature 756386..756485 FT /note="nominal overlap with cosmid SPAC22G7, EM:Z54328 S. FT pombe chromosome 1" FT misc_feature 756386..756485 FT /note="nominal overlap with p696 S. pombe chromosome 1" FT misc_feature complement(757408..757421) FT /colour=2 FT /note="splice branch and acceptor sequence, ctaactgtacctag" FT misc_feature complement(757516..757521) FT /colour=2 FT /note="splice donor sequence, gtatgt" FT misc_feature complement(757578..757594) FT /colour=2 FT /note="splice branch and acceptor sequence, FT tattaacaattatat ag" FT misc_feature complement(757657..757662) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT CDS join(758096..758128,758170..758295,758340..760361, FT 760402..760639,760680..760864,760903..760998, FT 761045..761226,761292..761382) FT /colour=7 FT /gene="SPAC22G7.02" FT /label=SPAC22G7.02 FT /note="SPAC22G7.02, len:989, SIMILARITY:Homo sapiens, FT D1035425, kiaa0724 protein., (963 aa), fasta scores: opt: FT 347, E():2.7e-15, (21.9% identity in 1011 aa)" FT /product="putative nuclear transport factor; karyopherin- FT beta family; similar to S. cerevisiae KAP122" FT /fasta_file="fasta/c22G7.tab.seq.01228.out" FT misc_feature 758129..758134 FT /colour=2 FT /note="splice donor sequence, gtttgt" FT misc_feature 758154..758169 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaatgcatgctata g" FT misc_feature 758296..758301 FT /colour=2 FT /note="splice donor sequence, gtttgt" FT misc_feature 758329..758339 FT /colour=2 FT /note="splice branch and acceptor sequence, ctgatcattag" FT misc_feature 760362..760367 FT /colour=2 FT /note="splice donor sequence, gtaggt" FT misc_feature 760386..760401 FT /colour=2 FT /note="splice branch and acceptor sequence, FT tactaatatgatata g" FT misc_feature 760640..760645 FT /colour=2 FT /note="splice donor sequence, gtaaat" FT misc_feature 760665..760679 FT /colour=2 FT /note="splice branch and acceptor sequence, FT tactaactaaaatag" FT misc_feature 760865..760870 FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature 760890..760902 FT /colour=2 FT /note="splice branch and acceptor sequence, tattaacattaag" FT misc_feature 760999..761004 FT /colour=2 FT /note="splice donor sequence, gtaaac" FT misc_feature 761026..761044 FT /colour=2 FT /note="splice branch and acceptor sequence, FT aactaatactgattt atag" FT misc_feature 761227..761232 FT /colour=2 FT /note="splice donor sequence, gtaagc" FT misc_feature 761275..761291 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ttaacaacaaattct ag" FT CDS 761614..762324 FT /colour=8 FT /gene="SPAC22G7.03" FT /label=SPAC22G7.03 FT /note="SPAC22G7.03, len:235" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c22G7.tab.seq.01229.out" FT CDS join(762556..762573,762618..762716,762761..762927, FT 762964..763171,763212..763789,763827..765133, FT 765171..766141) FT /colour=7 FT /gene="SPAC22G7.04" FT /label=SPAC22G7.04 FT /note="SPAC22G7.04, len:1114, SIMILARITY:Saccharomyces FT cerevisiae, PAN2_YEAST, pab-dependent poly(a)-specific FT ribonuclease subunit pan2(ec 3.1.13.4), (1115 aa), fasta FT scores: opt: 877, E():0, (29.6% identity in 1132 aa)" FT /product="ubiquitin carboxyl-terminal hydrolase; putative FT polyadenylation factor; contains exonuclease domain; FT similar to S. cerevisiae PAN2" FT /fasta_file="fasta/c22G7.tab.seq.01230.out" FT misc_feature 762574..762579 FT /colour=2 FT /note="splice donor sequence, gtaatt" FT misc_feature 762606..762617 FT /colour=2 FT /note="splice branch and acceptor sequence, ttaacaaattag" FT misc_feature 762717..762722 FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature 762734..762760 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ttaattatgaaacta aactag" FT misc_feature 762928..762933 FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature 762952..762963 FT /colour=2 FT /note="splice branch and acceptor sequence, ttgatctag" FT misc_feature 763198..763211 FT /colour=2 FT /note="splice branch and acceptor sequence, ctaacatttaatag" FT misc_feature 763790..763795 FT /colour=2 FT /note="splice donor sequence, gtatgt" FT misc_feature 763815..763826 FT /colour=2 FT /note="splice branch and acceptor sequence, ctaacgacttag" FT misc_feature 764512..764580 FT /colour=8 FT /note="PS00260 Glucagon/GIP/secretin/VIP family signature" FT misc_feature 765134..765139 FT /colour=2 FT /note="splice donor sequence, gtatga" FT misc_feature 765159..765170 FT /colour=2 FT /note="splice branch and acceptor sequence, ctaactagacag" FT misc_feature 765467..766018 FT /note="Match to PF00929 exonuclease, Exonuclease" FT CDS join(766473..766713,766841..768396) FT /colour=10 FT /gene="SPAC22G7.05" FT /label=SPAC22G7.05 FT /note="SPAC22G7.05, len:597, SIMILARITY:Caenorhabditis FT elegans., Q20760, f54c9.9., (755 aa), fasta scores: opt: FT 441, E():1.9e-16, (27.5% identity in 641 aa)" FT /product="predicted coiled-coil protein; similar to S. FT cerevisiae KRI1 which binds protein essential for cell FT division and spore germination" FT /fasta_file="fasta/c22G7.tab.seq.01231.out" FT misc_feature 766519..766867 FT /note="the sequence of this region has only been FT determined on one strand" FT misc_feature 766714..766719 FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature 766825..766840 FT /colour=2 FT /note="splice branch and acceptor sequence, FT tactaactaaaatta g" FT CDS complement(768976..775710) FT /EC_number="6.3.5.5" FT /colour=2 FT /gene="ura1" FT /gene="SPAC22G7.06c" FT /label=ura1 FT /note="SPAC22G7.06c, len:2243" FT /product="contains glutamine-dependent carbamoyl- FT phosphatesynthase; contains aspartate carbamoyl FT transferase; similar to S. cerevisiae URA2" FT /fasta_file="fasta/c22G7.tab.seq.01232.out" FT misc_feature complement(769000..769902) FT /note="Match to OTCace Score 574.44" FT misc_feature complement(769744..769767) FT /colour=8 FT /note="PS00097 Aspartate and ornithine FT carbamoyltransferase s signature" FT misc_feature complement(770164..771126) FT /note="Match to Dihydrooratase Score 539.93" FT misc_feature complement(771811..771834) FT /colour=8 FT /note="PS00867 Carbamoyl-phosphate synthase subdomain FT signa ture 2" FT misc_feature complement(772060..772665) FT /note="Match to CPSase_L_chain Score 96.87" FT misc_feature complement(772177..772221) FT /colour=8 FT /note="PS00866 Carbamoyl-phosphate synthase subdomain FT signa ture 1" FT misc_feature complement(772849..774285) FT /note="Match to PF00289, CPSase_L_chain, Carbamoyl- FT phosphate synthase (CPSase)" FT misc_feature complement(773107..774285) FT /note="Match to CPSase_L_chain Score 837.12" FT misc_feature complement(773413..773436) FT /colour=8 FT /note="PS00867 Carbamoyl-phosphate synthase subdomain FT signa ture 2" FT misc_feature complement(773782..773826) FT /colour=8 FT /note="PS00866 Carbamoyl-phosphate synthase subdomain FT signa ture 1" FT misc_feature complement(774385..774915) FT /note="Match to GATase Score 229.82" FT misc_feature complement(774679..774714) FT /colour=8 FT /note="PS00442 Glutamine amidotransferases class-I active FT s ite" FT misc_feature complement(775051..775536) FT /note="Match to CPSase_sm_chain Score 350.10" FT CDS complement(776819..778060) FT /colour=10 FT /gene="SPAC22G7.07c" FT /label=SPAC22G7.07c FT /note="SPAC22G7.07c, len:412, SIMILARITY:Caenorhabditis FT elegans., Q09956, hypothetical 42.2 kD protein c18a3.1 in FT chromosome ii., (365 aa), fasta scores: opt: 351, E():2.6e- FT 16, (31.5% identity in 276 aa)" FT /product="conserved protein; no apparent S. cerevisiae FT ortholog" FT /fasta_file="fasta/c22G7.tab.seq.01233.out" FT CDS join(779606..779671,779789..781264) FT /colour=7 FT /gene="SPAC22G7.08" FT /label=SPAC22G7.08 FT /note="SPAC22G7.08, len:512, FT SIMILARITY:Schizosaccharomyces pombe, O59763, hypothetical FT 73.2 kD protein., (650 aa), fasta scores: opt: 810, E():0, FT (37.7% identity in 358 aa)" FT /product="putative serine/threonine protein kinase" FT /fasta_file="fasta/c22G7.tab.seq.01234.out" FT misc_feature 779672..779677 FT /colour=2 FT /note="splice donor sequence, gtatgt" FT misc_feature 779772..779788 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaactaatgatatt ag" FT misc_feature 780443..781237 FT /note="Match to PF00069, pkinase, Eukaryotic protein FT kinase domain" FT misc_feature 780446..781210 FT /note="Match to pkinase Score 162.98" FT misc_feature 780800..780838 FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT CDS complement(join(781349..781476,781516..781807, FT 781864..781972,782019..782105,782149..782755, FT 782832..782886)) FT /colour=7 FT /gene="SPAC22G7.09c" FT /label=SPAC22G7.09c FT /note="SPAC22G7.09c, len:425, SIMILARITY:Saccharomyces FT cerevisiae, NU49_YEAST, nucleoporin nup49/nsp49, (472 aa), FT fasta scores: opt: 428, E():3.1e-15, (31.8% identity in FT 484 aa)" FT /product="putative nucleoporin; putative nuclear pore FT component; similar to S. cerevisiae NUP49" FT /fasta_file="fasta/c22G7.tab.seq.01235.out" FT intron complement(781477..781515) FT /note="confirmed" FT misc_feature complement(781808..781822) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaactaaaataaag" FT misc_feature complement(781858..781863) FT /colour=2 FT /note="splice donor sequence, gtgagt" FT misc_feature complement(781973..781988) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaatcatgtccgta g" FT misc_feature complement(782013..782018) FT /colour=2 FT /note="splice donor sequence, gtatgt" FT misc_feature complement(782106..782120) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ttaacaaaaaaacag" FT misc_feature complement(782143..782148) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature complement(782756..782770) FT /colour=2 FT /note="splice branch and acceptor sequence, FT tattaaccttttcag" FT misc_feature complement(782826..782831) FT /colour=2 FT /note="splice donor sequence, gtatgt" FT CDS join(783380..783517,783563..783615,783663..784506) FT /colour=7 FT /gene="SPAC22G7.10" FT /label=SPAC22G7.10 FT /note="SPAC22G7.10, len:343, SIMILARITY:Caenorhabditis FT elegans., O16293, f32d1.9 protein., (513 aa), fasta FT scores: opt: 295, E():1.7e-08, (25.8% identity in 361 aa)" FT /product="putative polyadenylation factor; similar to S. FT cerevisiae FIP1" FT /fasta_file="fasta/c22G7.tab.seq.01236.out" FT misc_feature 783404..783442 FT /colour=8 FT /note="PS00301 GTP-binding elongation factors signature" FT misc_feature 783518..783523 FT /colour=2 FT /note="splice donor sequence, gtaaga" FT misc_feature 783544..783562 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaactgctaatttt gtag" FT misc_feature 783616..783621 FT /colour=2 FT /note="splice donor sequence, gtatgt" FT misc_feature 783648..783662 FT /colour=2 FT /note="splice branch and acceptor sequence, FT tactaataatgttag" FT misc_feature 784923..785035 FT /note="nominal overlap with SPAC4G8, EM:Z56276 S. pombe FT chromosome 1" FT misc_feature 784923..785035 FT /note="nominal overlap with SPAC22G7, EM:Z54328 S. pombe FT chromosome 1" FT CDS complement(join(786274..786286,786455..786557, FT 786665..786761)) FT /colour=7 FT /gene="SPAC4G8.02c" FT /label=SPAC4G8.02c FT /note="SPAC4G8.02c, len:70, SIMILARITY:Canis familiaris, FT S61G_CANFA, protein transport protein sec61 gamma subunit., FT (68 aa), fasta scores: opt: 245, E():5.6e-13, (49.3% FT identity in 67 aa)" FT /product="putative protein transport protein sec61 gamma FT subunit" FT /fasta_file="fasta/c4G8.tab.seq.00326.out" FT misc_feature complement(786287..786304) FT /colour=2 FT /note="splice branch and acceptor sequence, FT tattaacattaatat tag" FT intron complement(786287..786454) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(786449..786454) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature complement(join(786454..786557,786665..786722)) FT /note="Match to PF00584 SecE, SecE/Sec61-gamma subunits of FT protein translocation complex Score 57.34" FT misc_feature complement(786558..786571) FT /colour=2 FT /note="splice branch and acceptor sequence, tactaatagaacag" FT intron complement(786558..786664) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(786659..786664) FT /colour=2 FT /note="splice donor sequence, gtatcg" FT CDS complement(787884..790226) FT /colour=7 FT /gene="SPAC4G8.03c" FT /label=SPAC4G8.03c FT /note="SPAC4G8.03c, len:780, FT SIMILARITY:Schizosaccharomyces pombe, YDHE_SCHPO, FT hypothetical 73.3 kD protein c6g9.14 in chromosome i., FT (681 aa), fasta scores: opt: 858, E():0, (32.3% identity FT in 598 aa)" FT /product="RNA-binding protein; pumilio family" FT /fasta_file="fasta/c4G8.tab.seq.00327.out" FT misc_feature complement(787974..788078) FT /colour=9 FT /note="Pfam match to entry PF00806 PUF, Pumilio-family FT RNAb inding domains (aka PUM-HD, Pumilio homology domain)" FT misc_feature complement(788088..788192) FT /colour=9 FT /note="Pfam match to entry PF00806 PUF, Pumilio-family FT RNAb inding domains (aka PUM-HD, Pumilio homology domain)" FT misc_feature complement(788196..788300) FT /colour=9 FT /note="Pfam match to entry PF00806 PUF, Pumilio-family FT RNAb inding domains (aka PUM-HD, Pumilio homology domain)" FT misc_feature complement(788304..788408) FT /colour=9 FT /note="Pfam match to entry PF00806 PUF, Pumilio-family FT RNAb inding domains (aka PUM-HD, Pumilio homology domain)" FT misc_feature complement(788412..788516) FT /colour=9 FT /note="Pfam match to entry PF00806 PUF, Pumilio-family FT RNAb inding domains (aka PUM-HD, Pumilio homology domain)" FT misc_feature complement(788520..788627) FT /colour=9 FT /note="Pfam match to entry PF00806 PUF, Pumilio-family FT RNAb inding domains (aka PUM-HD, Pumilio homology domain)" FT misc_feature complement(788631..788735) FT /colour=9 FT /note="Pfam match to entry PF00806 PUF, Pumilio-family FT RNAb inding domains (aka PUM-HD, Pumilio homology domain)" FT misc_feature complement(788739..788843) FT /colour=9 FT /note="Pfam match to entry PF00806 PUF, Pumilio-family FT RNAb inding domains (aka PUM-HD, Pumilio homology domain)" FT misc_feature complement(790227..796282) FT /note="low complexity gene-free region" FT CDS complement(join(796283..796396,796486..796512)) FT /colour=9 FT /gene="SPAC4G8.15c" FT /label=SPAC4G8.15c FT /note="SPAC4G8.15c, len:45" FT /product="very hypothetical protein" FT /fasta_file="fasta/c4G8.tab.seq.00328.out" FT misc_feature complement(796397..796410) FT /colour=6 FT /note="ctaatcataactag, splice branch and acceptor" FT misc_feature complement(796480..796485) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS join(797385..799424,799488..799766) FT /colour=7 FT /gene="SPAC4G8.04" FT /label=SPAC4G8.04 FT /note="SPAC4G8.04, len:772, SIMILARITY:Caenorhabditis FT elegans., O62462, y45f10a.6 protein., (1270 aa), fasta FT scores: opt: 551, E():7.2e-25, (34.8% identity in 247 aa)" FT /product="TBC domain protein; putative GTPase activating FT protein of Rab-like GTPase" FT /fasta_file="fasta/c4G8.tab.seq.00329.out" FT misc_feature join(798885..799424,799488..799592) FT /note="Match to PF00566 TBC, TBC domain Score 313.45" FT misc_feature 799425..799430 FT /colour=2 FT /note="splice donor sequence, gtacga" FT misc_feature 799468..799487 FT /colour=2 FT /note="splice branch and acceptor sequence, FT tactaactacttttt tttag" FT CDS 800299..801999 FT /colour=7 FT /gene="SPAC4G8.05" FT /label=SPAC4G8.05 FT /note="SPAC4G8.05, len:566, SIMILARITY:Neurospora crassa., FT NRC2_NEUCR, serine/threonine-protein kinase nrc-2, (623 FT aa), fasta scores: opt: 1873, E():0, (59.9% identity in FT 501 aa)" FT /product="putative serine/threonine protein kinase" FT /fasta_file="fasta/c4G8.tab.seq.00330.out" FT misc_feature 800881..801753 FT /colour=9 FT /note="Pfam match to entry PF00069 pkinase, Eukaryotic FT prot ein kinase domain" FT misc_feature 801244..801282 FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT CDS complement(802349..803605) FT /colour=10 FT /gene="SPAC4G8.06c" FT /label=SPAC4G8.06c FT /note="SPAC4G8.06c, len:418, SIMILARITY:Saccharomyces FT cerevisiae, YMA5_YEAST, hypothetical 52.7 kD protein in FT pdr4-glo1 intergenic region., (462 aa), fasta scores: opt: FT 474, E():2.7e-24, (32.7% identity in 355 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YML005W; Pfam-B_36882" FT /fasta_file="fasta/c4G8.tab.seq.00331.out" FT CDS complement(join(803676..803699,803831..804079, FT 804129..804966,805090..805189,805317..805689)) FT /colour=7 FT /gene="SPAC4G8.07c" FT /label=SPAC4G8.07c FT /note="SPAC4G8.07c, len:527, SIMILARITY:Saccharomyces FT cerevisiae, RNC1_YEAST, endo-exonuclease nucr, (617 aa), FT fasta scores: opt: 553, E():2.4e-29, (37.9% identity in FT 523 aa)" FT /product="putative Uridine methyltransferase; possibly FT catalyzes the formation of ribothymidine in tRNAs; FT similar to S. cerevisiae TRM2" FT /fasta_file="fasta/c4G8.tab.seq.00332.out" FT misc_feature complement(803700..803713) FT /colour=2 FT /note="splice branch and acceptor sequence, ttctaacattttag" FT misc_feature complement(803825..803830) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature complement(804080..804096) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctgacacattaaaat ag" FT misc_feature complement(804123..804128) FT /colour=2 FT /note="splice donor sequence, gtaagg" FT misc_feature complement(804967..804980) FT /colour=2 FT /note="splice branch and acceptor sequence, tattaaccgattag" FT misc_feature complement(805084..805089) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature complement(805190..805208) FT /colour=2 FT /note="splice branch and acceptor sequence, FT aactaaccaactata g" FT misc_feature complement(805311..805316) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT CDS join(806935..806963,807014..807407,807567..807959) FT /colour=7 FT /gene="SPAC4G8.08" FT /label=SPAC4G8.08 FT /note="SPAC4G8.08, len:271, SIMILARITY:Ashbya gossypii, FT O60029, agpet8 protein., (271 aa), fasta scores: opt: 340, FT E():6.6e-17, (27.0% identity in 281 aa)" FT /product="MC transporter of unknown specificity" FT /fasta_file="fasta/c4G8.tab.seq.00333.out" FT misc_feature 806963..806969 FT /colour=2 FT /note="splice donor sequence, gtacat" FT misc_feature 806995..807013 FT /colour=2 FT /note="splice branch and acceptor sequence, FT tactaacattgataa aaag" FT misc_feature 807084..807146 FT /colour=8 FT /note="PS00079 Multicopper oxidases signature 1" FT misc_feature 807123..807401 FT /note="Match to PF00153 mito_carr, Mitochondrial carrier FT proteins Score 38.83" FT misc_feature 807408..807413 FT /colour=2 FT /note="splice donor sequence, gtatgt" FT misc_feature 807551..807566 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacttaaattata g" FT misc_feature 807603..807944 FT /note="Match to PF00153 mito_carr, Mitochondrial carrier FT proteins Score 53.09" FT misc_feature 807720..807746 FT /colour=8 FT /note="PS00215 Mitochondrial energy transfer proteins FT signa ture" FT CDS 808208..810832 FT /EC_number="6.1.1.4" FT /colour=7 FT /gene="SPAC4G8.09" FT /label=SPAC4G8.09 FT /note="SPAC4G8.09, leucyl tRNA synthetase, len: 874, FT contai ns PS00178 Aminoacyl-transfer RNA synthetases class- FT I signa ture, eg similar to SW:SYL_ECOLI P07813 leucyl- FT tRNA synthet ase, (33.4% identity in 863 aa overlap)" FT /product="leucyl-tRNA synthetase, mitochondrial" FT /fasta_file="fasta/c4G8.tab.seq.00334.out" FT misc_feature 808325..810403 FT /colour=9 FT /note="Pfam match to entry PF00133 tRNA-synt_1, tRNA FT synthe tases class I" FT misc_feature 808412..808441 FT /colour=8 FT /note="PS00178 Aminoacyl-transfer RNA synthetases class-I FT s ignature" FT CDS 811163..811711 FT /colour=2 FT /gene="gos1" FT /gene="SPAC4G8.10" FT /label=gos1 FT /note="SPAC4G8.10, len:182, SIMILARITY:Mus musculus, FT O88630, 28 kDa cis-golgi snare., (250 aa), fasta scores: FT opt: 201, E():1e-05, (26.8% identity in 138 aa)" FT /product="V snare-like protein" FT /fasta_file="fasta/c4G8.tab.seq.00335.out" FT CDS complement(join(811818..812012,812114..812380, FT 812479..812820)) FT /colour=7 FT /gene="atp10" FT /gene="SPAC4G8.11c" FT /label=atp10 FT /note="SPAC4G8.11c, len:267, SIMILARITY:Saccharomyces FT cerevisiae, ATPY_YEAST, atp10 protein., (264 aa), fasta FT scores: opt: 145, E():0.0092, (26.2% identity in 260 aa)" FT /product="putative mitochondrial F1-F0 ATPase assembly FT protein; similar to S. cerevisiae ATP10" FT /fasta_file="fasta/c4G8.tab.seq.00336.out" FT misc_feature complement(812013..812023) FT /colour=2 FT /note="splice branch and acceptor sequence, ctaactagcag" FT misc_feature complement(812108..812113) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature complement(812381..812396) FT /colour=2 FT /note="splice branch and acceptor sequence, FT tattgacacgtttta g" FT misc_feature complement(812473..812478) FT /colour=2 FT /note="splice donor sequence, gtatga" FT CDS complement(join(814351..815308,815374..815531, FT 815572..815738,815837..815905,815950..816075, FT 816116..816239)) FT /colour=10 FT /gene="SPAC4G8.12c" FT /label=SPAC4G8.12c FT /note="SPAC4G8.12c, len:533, SIMILARITY:Saccharomyces FT cerevisiae, SMP3_YEAST, smp3 protein., (516 aa), fasta FT scores: opt: 616, E():4.4e-32, (27.9% identity in 513 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT SMP3; Pfam-B_28558" FT /fasta_file="fasta/c4G8.tab.seq.00337.out" FT misc_feature complement(815309..815323) FT /colour=2 FT /note="splice branch and acceptor sequence, FT cactaactggattag" FT misc_feature complement(815368..815373) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature complement(815532..815547) FT /colour=2 FT /note="splice branch and acceptor sequence, FT aactaacaagaatca g" FT misc_feature complement(815566..815571) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature complement(815739..815751) FT /colour=2 FT /note="splice branch and acceptor sequence, ctaattttggcag" FT misc_feature complement(815831..815836) FT /colour=2 FT /note="splice donor sequence, gtatgt" FT misc_feature complement(815906..815923) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ttcttacatatccaa aag" FT misc_feature complement(815944..815949) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature complement(816041..816067) FT /colour=8 FT /note="PS00075 Dihydrofolate reductase signature" FT misc_feature complement(816076..816086) FT /colour=2 FT /note="splice branch and acceptor sequence, ctaatataaag" FT misc_feature complement(816110..816115) FT /colour=2 FT /note="splice donor sequence, gtatat" FT CDS complement(816795..818840) FT /colour=7 FT /gene="SPAC4G8.13c" FT /label=SPAC4G8.13c FT /note="SPAC4G8.13c, len:681, FT SIMILARITY:Schizosaccharomyces pombe, O14258, hypothetical FT 59.8 kD zinc finger protein c6g10.12c in chromosome i., FT (533 aa), fasta scores: opt: 353, E():3.7e-12, (22.2% FT identity in 500 aa)" FT /product="putative transcriptional regulator; zinc finger FT protein; zf-C2H2 type (3); similar to S. cerevisiae CRZ1" FT /fasta_file="fasta/c4G8.tab.seq.00338.out" FT misc_feature complement(816894..816959) FT /note="Match to PF00096 zf-C2H2, zinc finger, C2H2 type FT Score 23.84" FT misc_feature complement(816975..817043) FT /note="Match to PF00096 zf-C2H2, zinc finger, C2H2 type FT Score 29.62" FT misc_feature complement(817059..817133) FT /note="Match to PF00096 zf-C2H2, zinc finger, C2H2 type FT Score 38.65" FT misc_feature complement(821528..821547) FT /colour=2 FT /note="splice branch and acceptor sequence, FT aattaacacattatt ttcag" FT misc_feature 821589..821698 FT /note="nominal overlap with SPAC16C9, EM:Z54366 S. pombe FT chromosome 1" FT misc_feature complement(821684..821689) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature 821589..821698 FT /note="nominal overlap with cosmid SPAC4G8, EM:Z56276 FT S.pombe chromosome 1" FT misc_feature complement(821768..821781) FT /colour=6 FT /note="ctaacgaatgcaag, splice branch and acceptor" FT misc_feature complement(821799..821804) FT /colour=6 FT /note="gtaaaa, splice donor sequence" FT CDS complement(join(822365..822625,822725..823285, FT 823335..823436)) FT /colour=7 FT /gene="SPAC16C9.02c" FT /label=SPAC16C9.02c FT /note="SPAC16C9.02c, len:306, SIMILARITY:Saccharomyces FT cerevisiae, YL17_YEAST, hypothetical 37.9 kD protein in FT ppr1-snf7 intergenic region., (337 aa), fasta scores: opt: FT 919, E():0, (48.5% identity in 305 aa)" FT /product="putative Methylthioadenosine phosphorylase" FT /fasta_file="fasta/c16C9.tab.seq.01668.out" FT misc_feature complement(822626..822639) FT /colour=6 FT /note="ttaacaaaaaatag, splice branch and acceptor" FT misc_feature complement(822719..822724) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(join(822725..823285,823335..823409)) FT /note="Match to PF00896 Mtap_PNP, phosphorylases family 2 FT Score 370.63" FT misc_feature complement(823286..823301) FT /colour=6 FT /note="ctaacgttttattcag, splice branch and acceptor" FT misc_feature complement(823329..823334) FT /colour=6 FT /note="gtatga, splice donor sequence" FT CDS 824760..826256 FT /colour=7 FT /gene="SPAC16C9.03" FT /label=SPAC16C9.03 FT /note="SPAC16C9.03, len:497, SIMILARITY:Saccharomyces FT cerevisiae, NMD3_YEAST, nonsense-mediated mRNA decay FT protein 3, (518 aa), fasta scores: opt: 1735, E():0, FT (55.0% identity in 504 aa)" FT /product="putative nonsense-mediated mRNA decay protein" FT /fasta_file="fasta/c16C9.tab.seq.01669.out" FT CDS complement(join(826669..827905,827994..828173, FT 828224..828276)) FT /colour=7 FT /gene="SPAC16C9.04c" FT /label=SPAC16C9.04c FT /note="SPAC16C9.04c, len:488, SIMILARITY:Mus musculus, FT AAD00181, potential transcriptional repressor not4hp., FT (575 aa), fasta scores: opt: 891, E():0, (44.5% identity FT in 328 aa)" FT /product="putative basal transcriptional regulator; zinc FT finger protein; zf-CCCH type; putative CCR4-Not complex; FT similar to S. cerevisiae NOT4; contains rrm RNA FT recognition motif" FT /fasta_file="fasta/c16C9.tab.seq.01670.out" FT misc_feature complement(827551..827784) FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 27.22" FT misc_feature complement(827906..827918) FT /colour=6 FT /note="ctaatgtttttag, splice branch and acceptor" FT misc_feature complement(827988..827993) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(828174..828189) FT /colour=6 FT /note="ctgacaattgcaacag, splice branch and acceptor" FT misc_feature complement(828218..828223) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS 829226..830440 FT /colour=10 FT /gene="SPAC16C9.05" FT /label=SPAC16C9.05 FT /note="SPAC16C9.05, len:403" FT /product="zinc finger protein; zf-PHD finger" FT /fasta_file="fasta/c16C9.tab.seq.01671.out" FT misc_feature 829574..829723 FT /note="Match to PF00628 PHD, PHD-finger Score 75.39" FT CDS complement(830986..833763) FT /colour=7 FT /gene="SPAC16C9.06c" FT /label=SPAC16C9.06c FT /note="SPAC16C9.06c, len:934, SIMILARITY:Homo sapiens, FT O43343, pnorf1, (1118 aa), fasta scores: opt: 3436, E():0, FT (57.8% identity in 872 aa)" FT /product="putative regulator of nonsense transcript FT stability" FT /fasta_file="fasta/c16C9.tab.seq.01672.out" FT misc_feature complement(832501..832524) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 835551..835659 FT /note="nominal overlap with cosmid SPAC2G11, EM:Z54354 FT S.pombe chromosome 1" FT misc_feature 835551..835659 FT /note="nominal overlap with cosmid SPAC16C9, EM:Z54366 S. FT pombe chromosome 1" FT misc_feature 836223..837113 FT /colour=9 FT /note="Pfam match to entry PF00069 pkinase, Eukaryotic FT prot ein kinase domain" FT misc_feature 836241..836267 FT /colour=8 FT /note="PS00107 protein kinases ATP-binding region FT signature" FT misc_feature 836589..836627 FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT CDS join(837704..837873,837932..841718) FT /colour=10 FT /gene="SPAC2G11.02" FT /label=SPAC2G11.02 FT /note="SPAC2G11.02, len:1318, FT SIMILARITY:Schizosaccharomyces pombe, CUT1_SCHPO, cut1 FT protein.cut1 protein., (1828 aa), fasta scores: opt: 141, FT E():0.28, (21.0% identity in 1163 aa)" FT /product="hypothetical protein; similar to S. pombe cut1" FT /fasta_file="fasta/c2G11.tab.seq.01857.out" FT misc_feature 837874..837879 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 837918..837931 FT /colour=6 FT /note="ttaacaagtattag, splice branch and acceptor" FT CDS complement(join(841783..841815,841868..843148, FT 843235..843442,843492..843646)) FT /colour=2 FT /gene="vps45" FT /gene="SPAC2G11.03c" FT /label=vps45 FT /note="SPAC2G11.03c, len:558, SIMILARITY:Homo sapiens, FT Q9Y4Z6, vacuolar protein sorting., (570 aa), fasta scores: FT opt: 1464, E():0, (42.8% identity in 554 aa)" FT /product="vacuolar sorting protein; Sec1 family" FT /fasta_file="fasta/c2G11.tab.seq.01858.out" FT misc_feature complement(841816..841827) FT /colour=6 FT /note="ctaaccatttag, splice branch and acceptor" FT misc_feature complement(841862..841867) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(join(841865..843148,843235..843342)) FT /note="Match to PF00995 Sec1, Sec1 family Score 614.90" FT misc_feature complement(843149..843164) FT /colour=6 FT /note="ctaacacgtattttag, splice branch and acceptor" FT misc_feature complement(843229..843234) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature complement(843443..843452) FT /colour=6 FT /note="ttgactttag, splice branch and acceptor" FT misc_feature complement(843486..843491) FT /colour=6 FT /note="gtacag, splice donor sequence" FT CDS 844127..845032 FT /colour=10 FT /gene="SPAC2G11.04" FT /label=SPAC2G11.04 FT /note="SPAC2G11.04, len:301" FT /product="G-patch domain protein" FT /fasta_file="fasta/c2G11.tab.seq.01859.out" FT misc_feature 844880..845002 FT /colour=9 FT /note="Pfam match to entry PF01585 G-patch, G-patch domain, FT score 66.50, E-value 5.5e-16" FT CDS complement(845191..847296) FT /colour=7 FT /gene="SPAC2G11.05c" FT /label=SPAC2G11.05c FT /note="SPAC2G11.05c, len:701, predicted to contain coiled- FT coil regions, LOW SIMILARITY:Emericella nid ulans, P79020, FT ph signal transduction pathway protein pala, (798 aa), FT fasta scores: opt: 353, E():1e-16, (29.2% identi ty in 312 FT aa)" FT /product="putative signal transduction pathway component FT by similar to A nidulans pala; MAP kinase pathway" FT /fasta_file="fasta/c2G11.tab.seq.01860.out" FT CDS join(847793..847816,847883..847994,848105..848591, FT 848651..849326) FT /colour=7 FT /gene="vps4" FT /gene="SPAC2G11.06" FT /label=vps4 FT /note="SPAC2G11.06, len:432, SIMILARITY:Saccharomyces FT cerevisiae, EN13_YEAST, end13 protein., (437 aa), fasta FT scores: opt: 1807, E():0, (62.2% identity in 436 aa)" FT /product="putative vacuolar AAA-family ATPase; involved in FT vacuolar protein sorting; bam1/bed5 supressor; similar to FT S. cerevisiae VPS4" FT /fasta_file="fasta/c2G11.tab.seq.01861.out" FT misc_feature 847817..847822 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 847870..847882 FT /colour=6 FT /note="ctaactactgtag, splice branch and acceptor" FT misc_feature 847995..848000 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 848093..848104 FT /colour=6 FT /note="ctaatatttcag, splice branch and acceptor" FT misc_feature join(848458..848591,848651..849071) FT /note="Match to PF00004 AAA, ATPases associated with FT various cellular activities (AAA) Score 288.32" FT misc_feature 848473..848496 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 848592..848597 FT /colour=6 FT /note="gtttgt, splice donor sequence" FT misc_feature 848639..848650 FT /colour=6 FT /note="ctaacattatag, splice branch and acceptor" FT misc_feature 848823..848879 FT /colour=8 FT /note="PS00674 AAA-protein family signature" FT CDS complement(join(849839..850681,850721..850794, FT 851053..851380)) FT /EC_number="3.1.3.16" FT /colour=2 FT /gene="ptc3" FT /gene="SPAC2G11.07c" FT /label=ptc3 FT /note="SPAC2G11.07c, len:414" FT /product="protein phosphatase 2c homolog 3" FT /fasta_file="fasta/c2G11.tab.seq.01862.out" FT misc_feature complement(850259..850681) FT /note="Match to PF00481 PP2C, protein phosphatase 2C Score FT 242.13" FT misc_feature complement(850682..850693) FT /colour=6 FT /note="ctaattgtgtag, splice branch and acceptor" FT misc_feature complement(join(850688..850794,851053..851317)) FT /note="Match to PF00481 PP2C, protein phosphatase 2C Score FT 123.23" FT misc_feature complement(850715..850720) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(850795..850810) FT /colour=6 FT /note="ctaactattttgacag, splice branch and acceptor" FT misc_feature complement(851047..851052) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(851186..851212) FT /colour=8 FT /note="PS01032 protein phosphatase 2C signature" FT CDS complement(join(852008..852105,852165..852525)) FT /colour=2 FT /gene="smn1" FT /gene="yab8" FT /gene="SPAC2G11.08c" FT /label=smn1 FT /note="SPAC2G11.08c, len:152" FT /product="orthologue of the human SMN protein; novel FT factor involved in mRNA processing and snRNP biogenesis; FT no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c2G11.tab.seq.01863.out" FT misc_feature complement(852106..852122) FT /colour=6 FT /note="ttaacataatgatttag, splice branch and acceptor" FT misc_feature complement(852159..852164) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS join(853431..853460,853545..855905) FT /colour=10 FT /gene="SPAC2G11.09" FT /label=SPAC2G11.09 FT /note="SPAC2G11.09, len:796, SIMILARITY:Saccharomyces FT cerevisiae, Q06538, chromosome xii cosmid 9672., (782 aa), FT fasta scores: opt: 1002, E():0, (34.7% identity in 786 aa)" FT /product="conserved protein (eukaryotic); similar to S. FT cerevisiae RSN1 which is involved in tunicamycin FT sensitivity; Pfam DUF221; contains ? predicted FT transmembrane helices; predicted N-terminal signal FT sequence" FT /fasta_file="fasta/c2G11.tab.seq.01864.out" FT misc_feature 853461..853466 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 853532..853544 FT /colour=6 FT /note="ttaattcctacag, splice branch and acceptor" FT CDS complement(join(856214..857096,857141..857354, FT 857579..857687)) FT /colour=7 FT /gene="SPAC2G11.10c" FT /label=SPAC2G11.10c FT /note="SPAC2G11.10c, len:401, SIMILARITY:Saccharomyces FT cerevisiae, YHR1_YEAST, hypothetical 49.4 kD protein in FT cdc12-orc6 intergenic region., (440 aa), fasta scores: FT opt: 959, E():0, (40.7% identity in 413 aa)" FT /product="similar to S. cerevisiae YHR111W; putative FT molybdopterin synthase sulfurylase" FT /fasta_file="fasta/c2G11.tab.seq.01865.out" FT misc_feature complement(856241..856513) FT /note="Match to PF00581 Rhodanese, Rhodanese-like domain FT Score 63.33" FT misc_feature complement(join(856886..857096,857141..857340)) FT /note="Match to PF00899 ThiF_family, ThiF family Score FT 193.49" FT misc_feature complement(857097..857107) FT /colour=6 FT /note="ctaacgcttag, splice branch and acceptor" FT misc_feature complement(857135..857140) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(857355..857365) FT /colour=6 FT /note="ctaaccaatag, splice branch and acceptor" FT misc_feature complement(857573..857578) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS complement(join(858890..858988,859032..859100, FT 859184..861175)) FT /colour=2 FT /gene="prh1" FT /gene="SPAC2G11.11c" FT /label=prh1 FT /note="SPAC2G11.11c, len:719" FT /product="putative ATP-dependent RNA helicase" FT /fasta_file="fasta/c2G11.tab.seq.01866.out" FT misc_feature complement(858989..859000) FT /colour=6 FT /note="ctaatcattcag, splice branch and acceptor" FT misc_feature complement(859026..859031) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(859101..859114) FT /colour=6 FT /note="ctaatccaaattag, splice branch and acceptor" FT misc_feature complement(859178..859183) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(859898..860203) FT /note="Pfam match to entry PF00271 helicase_C, Helicases FT co nserved C-terminal domain/colour=9" FT misc_feature complement(860516..860545) FT /colour=8 FT /note="PS00690 DEAH-box subfamily ATP-dependent helicases FT s ignature" FT misc_feature complement(860798..860821) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS 861703..865689 FT /colour=2 FT /gene="hus2" FT /gene="rqh1" FT /gene="rad12" FT /gene="SPAC2G11.12" FT /label=hus2 FT /note="SPAC2G11.12, len:1328" FT /product="ATP-dependent RecQ type DNA helicase; meiotic FT recombination protein; checkpoint-dependent DNA damage FT response during S phase; similar to S. cerevisiae SGS1" FT /fasta_file="fasta/c2G11.tab.seq.01867.out" FT misc_feature 863233..863808 FT /note="Match to PF00270 DEAD, DEAD/DEAH box helicase Score FT 131.74" FT misc_feature 863638..863667 FT /colour=8 FT /note="PS00690 DEAH-box subfamily ATP-dependent helicases FT s ignature" FT misc_feature 863968..864216 FT /colour=9 FT /note="Pfam match to entry PF00271 helicase_C, Helicases FT co nserved C-terminal domain" FT misc_feature 865045..865287 FT /colour=9 FT /note="Pfam match to entry PF00570 HRDC, HRDC (Helicase FT and RNase D C-terminal) domain" FT CDS 866059..867648 FT /colour=7 FT /gene="SPAC2G11.13" FT /label=SPAC2G11.13 FT /note="SPAC2G11.13, len:529, SIMILARITY:Saccharomyces FT cerevisiae, YCD8_YEAST, hypothetical 58.8 kD protein in FT glk1-sro9 intergenic region., (528 aa), fasta scores: opt: FT 366, E():4.8e-17, (23.1% identity in 524 aa)" FT /product="MFS transporter of unknown specificity" FT /fasta_file="fasta/c2G11.tab.seq.01868.out" FT CDS join(867996..868058,868101..868671,868720..868868, FT 868907..871063) FT /colour=7 FT /gene="SPAC2G11.14" FT /label=SPAC2G11.14 FT /note="SPAC2G11.14, len:979, SIMILARITY:Saccharomyces FT cerevisiae, T145_YEAST, transcription initiation factor FT tfiid 145 kD subunit, (1066 aa), fasta scores: opt: 1531, FT E():0, (34.4% identity in 1046 aa)" FT /product="putative transcription initiation factor TFIID FT subunit; zinc finger protein; zf-CCHC type (zinc knuckle); FT similar to S. cerevisiae TAF145" FT /fasta_file="fasta/c2G11.tab.seq.01869.out" FT misc_feature 868059..868064 FT /colour=6 FT /note="gtaggt, splice donor sequence" FT misc_feature 868088..868100 FT /colour=6 FT /note="ctaacgaatgtag, splice branch and acceptor" FT misc_feature 868672..868677 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 868707..868719 FT /colour=6 FT /note="ctgacatgttaag, splice branch and acceptor" FT misc_feature 868869..868874 FT /colour=6 FT /note="gtatgg, splice donor sequence" FT misc_feature 868896..868906 FT /colour=6 FT /note="ctaaccgaaag, splice branch and acceptor" FT misc_feature 870828..870887 FT /colour=9 FT /note="Pfam match to entry PF00098 zf-CCHC, zinc finger, FT CC HC class" FT misc_feature complement(871482..871505) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature complement(871536..871552) FT /colour=6 FT /note="ttaacaatattttctag, splice branch and acceptor" FT intron complement(871536..871583) FT /note="intron confirmed by EST" FT misc_feature complement(871578..871583) FT /colour=6 FT /note="gtatag, splice donor sequence" FT misc_feature 871610..871712 FT /note="nominal overlap with cosmid SPAC2G11, EM:Z54354 S. FT pombe chromosome 1" FT misc_feature complement(871730..871747) FT /colour=6 FT /note="ttaacgcttttgtttcag, splice branch and acceptor" FT intron complement(871730..871801) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(871796..871801) FT /colour=6 FT /note="gttcgt, splice donor sequence" FT misc_feature complement(871918..871935) FT /colour=6 FT /note="ctgacaaattataattag, splice branch and acceptor" FT intron complement(871918..871996) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(871991..871996) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS 872909..873760 FT /colour=7 FT /gene="SPAC521.02" FT /label=SPAC521.02 FT /note="SPAC521.02, len:284, signal sequence predicted 1-20 FT aa, SIMILARITY:Saccharomyces cerevisiae, YHT4_YEAST, FT hypothetical 30.6 kD protein in act5-yck1 intergenic FT region., (269 aa), fasta scores: opt: 194, E():2.9e-06, FT (28.0% identity in 189 aa)" FT /product="putative zinc metallopeptidase; similar to S. FT cerevisiae YHR134W" FT /fasta_file="fasta/c521.tab.seq.02198.out" FT misc_feature 873248..873277 FT /colour=8 FT /note="PS00142 Neutral zinc metallopeptidases, zinc FT binding region signature," FT CDS 874821..875600 FT /colour=7 FT /gene="SPAC521.03" FT /label=SPAC521.03 FT /note="SPAC521.03, len:260, SIMILARITY:Saccharomyces FT cerevisiae, YM71_YEAST, hypothetical oxidoreductase in FT mrpl44-mtf1 intergenic region(ec 1.-.-.-)., (267 aa), FT fasta scores: opt: 858, E():0, (49.8% identity in 257 aa)" FT /product="putative short chain dehydrogenase" FT /fasta_file="fasta/c521.tab.seq.02199.out" FT misc_feature 874839..875402 FT /note="Match to PF00106 adh_short, short chain FT dehydrogenase Score 180.12" FT CDS complement(876007..878652) FT /colour=7 FT /gene="SPAC521.04c" FT /label=SPAC521.04c FT /note="SPAC521.04c, len:882, SIMILARITY:Saccharomyces FT cerevisiae, YN61_YEAST, hypothetical 102.5 kD protein in FT kre1-hxt14 intergenic region., (908 aa), fasta scores: FT opt: 807, E():0, (36.6% identity in 936 aa)" FT /product="putative calcium permeasE" FT /fasta_file="fasta/c521.tab.seq.02200.out" FT misc_feature complement(876442..876489) FT /colour=8 FT /note="PS00038 Myc-type, 'helix-loop-helix' dimerization FT domain signature" FT CDS 879196..879798 FT /colour=2 FT /gene="rps8-2" FT /gene="SPAC521.05" FT /label=rps8-2 FT /note="SPAC521.05, len:201" FT /product="40S ribosomal protein S8" FT /fasta_file="fasta/c521.tab.seq.02201.out" FT misc_feature 879202..879576 FT /note="Match to PF01201 Ribosomal_S8e, Ribosomal protein FT S8e Score 274.45" FT misc_feature 880368..880373 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 880391..880405 FT /colour=6 FT /note="ttaacaccataatag, splice branch and acceptor" FT misc_feature 880684..882564 FT /note="Match to PF00562 RNA_pol_B, RNA polymerase beta FT subunit Score 501.71" FT misc_feature 882466..882573 FT /note="nominal overlap with cosmid SPAC23G3, EM:AL138854 FT S. pombe chromosome 1" FT CDS complement(join(884199..892600,892831..899203)) FT /colour=7 FT /gene="SPAC23G3.02c" FT /label=SPAC23G3.02c FT /note="putative FRAMESHIFT; base-check of problem region FT in progress" FT /note="SPAC23G3.02c, len:4924, SIMILARITY:Aureobasidium FT pullulans., O94116, peptide synthetase., (10797 aa), fasta FT scores: opt: 2220, E():0, (26.3% identity in 4855 aa)" FT /product="putative peptide synthetase; with 3 FT Phosphopantetheine attachment sites; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c23G3.tab.seq.00341.out" FT misc_feature complement(884997..885116) FT /note="Match to PF00668 DUF4, Domain of unknown function FT Score 22.19" FT misc_feature complement(885552..885749) FT /note="Match to PF00550 pp-binding, Phosphopantetheine FT attachment site Score 44.69" FT misc_feature complement(886518..886715) FT /note="Match to PF00668 DUF4, Domain of unknown function FT Score 21.47" FT misc_feature complement(886860..887381) FT /note="Match to PF00668 DUF4, Domain of unknown function FT Score 43.34" FT misc_feature complement(889014..889199) FT /note="Match to PF00550 pp-binding, Phosphopantetheine FT attachment site Score 23.21" FT misc_feature complement(889551..890717) FT /note="Match to PF00501 AMP-binding, AMP-binding enzyme FT Score 319.23" FT misc_feature complement(892248..892430) FT /note="Match to PF00550 pp-binding, Phosphopantetheine FT attachment site Score 25.68" FT misc_feature complement(892601..892616) FT /colour=6 FT /note="ttgactattgagacag, splice branch and acceptor" FT misc_feature 892610..892663 FT /note="poor quality region, gone for PCR verification, may FT have caused frameshift in SPAC23G3.02c, which may result FT in a single ORF for this gene" FT misc_feature complement(892825..892830) FT /colour=6 FT /note="gtagag, splice donor sequence" FT misc_feature complement(895973..896452) FT /note="Match to PF00668 DUF4, Domain of unknown function FT Score 59.50" FT misc_feature complement(897299..898450) FT /note="Match to PF00501 AMP-binding, AMP-binding enzyme FT Score 213.72" FT CDS 900701..901996 FT /colour=7 FT /gene="SPAC23G3.03" FT /label=SPAC23G3.03 FT /note="SPAC23G3.03, len:431, SIMILARITY:Streptomyces FT coelicolor., CAB53328, putative peptide monooxygenase., FT (451 aa), fasta scores: opt: 651, E():0, (30.6% identity FT in 425 aa)" FT /product="putative peptide monooxygenase; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c23G3.tab.seq.00342.out" FT CDS 902843..903427 FT /colour=8 FT /gene="SPAC23G3.04" FT /label=SPAC23G3.04 FT /note="SPAC23G3.04, len:194, SIMILARITY low to :Candida FT albicans, O94024, hypothetical 18.6 kD protein., (172 aa), FT fasta scores: opt: 132, E():0.33, (27.1% identity in 155 FT aa)" FT /product="hypothetical protein; sequence orphan; FT similarity to C. albicans CA49C10.10 (possibly spurious)" FT /fasta_file="fasta/c23G3.tab.seq.00055.out" FT CDS complement(904208..905239) FT /colour=7 FT /gene="SPAC23G3.05c" FT /label=SPAC23G3.05c FT /note="SPAC23G3.05c, len:343, LOW SIMILARITY:Saccharomyces FT cerevisiae, Q08760, chromosome xv reading frame orf FT yor301w., (435 aa), fasta scores: opt: 129, E():0.17, FT (22.0% identity in 418 aa)" FT /product="similar to S. cerevisiae RAX1- bud pattern FT determination protein; putative cell polarity protein" FT /fasta_file="fasta/c23G3.tab.seq.00344.out" FT CDS join(906623..906638,906680..906782,906851..908258) FT /colour=7 FT /gene="SPAC23G3.06" FT /label=SPAC23G3.06 FT /note="SPAC23G3.06, len:508, SIMILARITY:Saccharomyces FT cerevisiae, NOP5_YEAST, nucleolar protein nop5., (511 aa), FT fasta scores: opt: 1901, E():0, (59.6% identity in 507 aa)" FT /product="similar to S. cerevisiae NOP5; putative FT nucleolar protein; possibly involved in the synthesis of FT the 40S ribosomal subunit; putative snoRNA-binding protein" FT /fasta_file="fasta/c23G3.tab.seq.00345.out" FT misc_feature 906639..906644 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 906665..906679 FT /colour=6 FT /note="ctaacaacataatag, splice branch and acceptor" FT misc_feature 906783..906788 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 906835..906850 FT /colour=6 FT /note="ctaacactgaatttag, splice branch and acceptor" FT misc_feature 907491..907943 FT /note="Match to PF01798 Nop, putative snoRNA-binding FT domain Score 301.36" FT CDS complement(join(908890..909511,909663..909865)) FT /colour=8 FT /gene="SPAC23G3.07c" FT /label=SPAC23G3.07c FT /note="SPAC23G3.07c, len:274" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c23G3.tab.seq.00346.out" FT misc_feature complement(909512..909527) FT /colour=6 FT /note="ctaattcatttactag, splice branch and acceptor" FT misc_feature complement(909657..909662) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS complement(910699..913326) FT /colour=7 FT /gene="SPAC23G3.08c" FT /label=SPAC23G3.08c FT /note="SPAC23G3.08c, len:875, SIMILARITY:Mus musculus, FT O88623, ubiquitin-specific protease ubp41., (353 aa), FT fasta scores: opt: 225, E():2.1e-06, (36.9% identity in FT 130 aa)" FT /product="ubiquitin carboxyl-terminal hydrolase" FT /fasta_file="fasta/c23G3.tab.seq.00347.out" FT misc_feature complement(910705..910950) FT /note="Match to PF00443 UCH-2, Ubiquitin carboxyl-terminal FT hydrolase family 2 Score 90.99" FT misc_feature complement(912610..912705) FT /colour=9 FT /note="Pfam match to entry PF00442 UCH-1, Ubiquitin FT carboxyl-terminal hydrolases family 2, score 36.70, E- FT value 5.3e-07" FT CDS 914121..915218 FT /colour=7 FT /gene="SPAC23G3.09" FT /label=SPAC23G3.09 FT /note="SPAC23G3.09, len:365, predicted to contain coiled- FT coil regions, LOW SIMILARITY:Saccharomyces cerevisiae, FT MPT1_YEAST, mpt1 protein., (388 aa), fasta scores: opt: FT 193, E():0.00019, (21.9% identity in 351 aa)" FT /product="putative RNA polymerase II general transcription FT factor TFIID component; similar to S. cerevisiae MPT1" FT /fasta_file="fasta/c23G3.tab.seq.00348.out" FT CDS complement(915571..916848) FT /colour=7 FT /gene="SPAC23G3.10c" FT /label=SPAC23G3.10c FT /note="SPAC23G3.10c, len:425, SIMILARITY:Homo sapiens, FT Q92925, swi/snf complex 60 kDa subunit., (475 aa), fasta FT scores: opt: 844, E():0, (34.3% identity in 399 aa)" FT /product="putative SWI/SNF global activator complex; FT involved in chromatin remodeling; transcriptional FT activator complex; similar to S. cerevisiae SNF12" FT /fasta_file="fasta/c23G3.tab.seq.00349.out" FT CDS join(917337..917512,917575..917657,917703..918709) FT /colour=2 FT /gene="rpn6" FT /gene="SPAC23G3.11" FT /label=rpn6 FT /note="SPAC23G3.11, len:421, SIMILARITY:Homo sapiens, FT O00231, proteasome subunit p44.5., (422 aa), fasta scores: FT opt: 1481, E():0, (56.3% identity in 407 aa)" FT /product="19S proteasome regulatory subunit" FT /fasta_file="fasta/c23G3.tab.seq.00350.out" FT misc_feature 917513..917518 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 917556..917574 FT /colour=6 FT /note="ctaacatttatttctctag, splice branch and acceptor" FT misc_feature 917658..917663 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 917688..917702 FT /colour=6 FT /note="ctaacaccattttag, splice branch and acceptor" FT misc_feature 918401..918640 FT /note="Match to PF01399 PCI, PCI domain Score 97.64" FT CDS complement(918806..921796) FT /colour=7 FT /gene="SPAC23G3.12c" FT /label=SPAC23G3.12c FT /note="SPAC23G3.12c, len:996, SIMILARITY:Saccharomyces FT cerevisiae, YNM3_YEAST, hypothetical 110.9 kD protein in FT spc98-tom70 intergenic region., (997 aa), fasta scores: FT opt: 2916, E():0, (49.6% identity in 915 aa)" FT /product="signalling-associated PDZ domain containing FT similar to serine proteases" FT /fasta_file="fasta/c23G3.tab.seq.00351.out" FT misc_feature complement(919319..919624) FT /colour=9 FT /note="Pfam match to entry PF00595 PDZ, PDZ domain (Also FT known as DHR or GLGF)., score 5.20, E-value 0.39" FT misc_feature complement(920726..920968) FT /note="Match to PF00595 PDZ, PDZ domain (Also known as DHR FT or GLGF). Score 22.33" FT misc_feature 923548..923646 FT /note="nominal overlap with cosmid SPAC22H12 AL034565 FT S.pombe chromosome I cosmid c22H12." FT misc_feature 923548..923646 FT /note="nominal overlap with cosmid SPAC23G3, S. pombe FT chromosome 1" FT CDS join(925042..925083,925273..925441,925499..925650, FT 925715..926077) FT /colour=7 FT /gene="SPAC22H12.02" FT /label=SPAC22H12.02 FT /note="SPAC22H12.02, len:241, SIMILARITY:Saccharomyces FT cerevisiae, T2FC_YEAST, transcription initiation factor FT tfiif small subunit, (244 aa), fasta scores: opt: 632, FT E():6.4e-31, (42.7% identity in 246 aa)" FT /product="putative transcription initiation factor tfiif FT small subunit; putative component of RNA polymerase FT holoenzyme, Kornberg's mediator (SRB) subcomplex; putative FT SWI/SNF complex; similar to S. cerevisiae ANC1" FT /fasta_file="fasta/c22H12.tab.seq.01941.out" FT misc_feature 925084..925089 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 925259..925272 FT /colour=6 FT /note="cttacaatatttag, splice branch and acceptor" FT misc_feature 925442..925447 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 925486..925498 FT /colour=6 FT /note="ctaatttttttag, splice branch and acceptor" FT misc_feature 925651..925656 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 925700..925714 FT /colour=6 FT /note="ctaactgagtcttag, splice branch and acceptor" FT CDS join(926553..926839,926918..927443) FT /colour=7 FT /gene="SPAC22H12.03" FT /label=SPAC22H12.03 FT /note="SPAC22H12.03, len:270, SIMILARITY:Saccharomyces FT cere visiae, YG1L_YEAST, hypothetical 38.5 kD protein, FT (342 aa), fasta scores: opt: 341, E():0, (35.4% identity FT in 263 aa)" FT /product="putative esterase/lipase" FT /fasta_file="fasta/c22H12.tab.seq.01942.out" FT misc_feature join(926697..926839,926918..927434) FT /note="Match to PF00561 abhydrolase, alpha/beta hydrolase FT fold Score 41.37" FT misc_feature 926840..926845 FT /colour=6 FT /note="gtgagt, splice donor sequence" FT misc_feature 926900..926917 FT /colour=6 FT /note="ctaactttgctgacttag, splice branch and acceptor" FT CDS complement(927867..928625) FT /colour=7 FT /gene="rps3a-2" FT /gene="rps1-2" FT /gene="SPAC22H12.04c" FT /label=SPAC22H12.04c FT /note="SPAC22H12.04c, len:252, SIMILARITY:Oryza sativa, FT RS3A_ORYSA, 40S ribosomal protein S3a, (261 aa), fasta FT scores: opt: 1103, E():0, (66.7% identity in 243 aa)" FT /product="40S ribosomal protein S3a.2/S1B" FT /fasta_file="fasta/c22H12.tab.seq.01943.out" FT misc_feature complement(927960..928595) FT /colour=9 FT /note="Pfam match to entry PF01015 Ribosomal_S3Ae, FT Ribosoma l S3Ae family" FT CDS complement(929243..931429) FT /colour=10 FT /gene="SPAC22H12.05c" FT /label=SPAC22H12.05c FT /note="SPAC22H12.05c, len:728, signal sequence predicted 1- FT 21aa, SIMILARITY:Saccharomyces cer evisiae, Q07895, FT chromosome xii reading frame orf ylr001c., (862 aa), fasta FT scores: opt: 151, E():2.6e-06, (23.9% iden tity in 685 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YLR001c; predicted N-terminal signal sequence" FT /fasta_file="fasta/c22H12.tab.seq.01944.out" FT misc_feature 932508..932614 FT /note="nominal overlap with small insert clone SPAPYUL23, FT EM:AL096845 S. pombe chromosome 1" FT misc_feature 932508..932614 FT /note="nominal overlap with cosmid SPAC22H12, EM:AL034565 FT S. pombe chromosome 1" FT misc_feature 932849..932854 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT intron 932849..932921 FT /note="Confirmed Intron by EST data" FT misc_feature 932906..932921 FT /colour=6 FT /note="ctaactaaagttatag, splice branch and acceptor" FT misc_feature 932925..933020 FT /note="Match to PF01193 RNA_pol_L, RNA polymerases L / 13 FT to 16 kDa subunit Score 34.91" FT misc_feature 932940..933037 FT /note="nominal overlap with cosmid SPAC1687, EM:AL035064 FT S. pombe chromosome 1" FT misc_feature 932940..933037 FT /note="nominal overlap with small insert clone SPAPYUL23, FT EM:AL096845 S. pombe chromosome 1" FT misc_feature join(932943..933019,933068..933144,933222..933310) FT /note="Match to PF01193 RNA_pol_L, RNA polymerases L / 13 FT to 16 kDa subunit Score 143.39" FT misc_feature 933020..933025 FT /note="gtaaat, splice donor sequence" FT misc_feature 933049..933067 FT /note="ttaacactaatgttttcag, splice branch and acceptor" FT misc_feature 933145..933150 FT /note="gtaagt, splice donor sequence" FT misc_feature 933208..933221 FT /note="ctaacgaattcaag, splice branch and acceptor" FT CDS join(933942..934304,934356..934808) FT /colour=7 FT /gene="SPAC1687.02" FT /label=SPAC1687.02 FT /note="SPAC1687.02, len:271, SIMILARITY:Saccharomyces FT cerev isiae, RCE1_YEAST, caax prenyl protease 2, (315 aa), FT fasta scores: opt: 204, E():1.8e-05, (22.8% identity in FT 294 aa)" FT /product="caax prenyl protease 2" FT /fasta_file="fasta/c1687.tab.seq.01319.out" FT misc_feature 934305..934310 FT /note="gtaagt, splice donor sequence" FT misc_feature 934339..934355 FT /note="ctcacaagtctttttag, splice branch and acceptor" FT CDS complement(join(934805..935653,935709..935820, FT 935964..936031)) FT /colour=2 FT /gene="rfc4" FT /gene="SPAC1687.03c" FT /label=rfc4 FT /note="SPAC1687.03c, len:343, SIMILARITY:Gallus gallus, FT AC1 4_CHICK, activator 1 40 kD subunit, (359 aa), fasta FT scores: opt: 1408, E():0, (65.8% identity in 319 aa)" FT /product="replication factor C (activator 1) subunit; FT activator of DNA polymerases" FT /fasta_file="fasta/c1687.tab.seq.01320.out" FT misc_feature complement(935069..935101) FT /note="PS00013 Prokaryotic membrane lipoprotein lipid FT attac hment site" FT misc_feature complement(935630..935653) FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature complement(935654..935670) FT /note="ctgacttatatttatag, splice branch and acceptor" FT misc_feature complement(935703..935708) FT /note="gtaacc, splice donor sequence" FT misc_feature complement(935821..935839) FT /note="ctgatctataaacttatag, splice branch and acceptor" FT misc_feature complement(935958..935963) FT /note="gtatgt, splice donor sequence" FT CDS join(936560..936721,936766..938109) FT /colour=10 FT /gene="SPAC1687.04" FT /label=SPAC1687.04 FT /note="SPAC1687.04, len:501, SIMILARITY:Arabidopsis FT thalian a, O22880, t2p4.10 protein., (550 aa), fasta FT scores: opt: 3 79, E():3.1e-10, (25.8% identity in 532 aa)" FT /product="conserved protein; PB024427; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c1687.tab.seq.01321.out" FT misc_feature 936722..936727 FT /note="gtttgt, splice donor sequence" FT misc_feature 936748..936765 FT /note="ttgacactgaatatttag, splice branch and acceptor" FT CDS join(938515..938547,938600..940750) FT /colour=7 FT /gene="SPAC1687.05" FT /label=SPAC1687.05 FT /note="SPAC1687.05, len:727, SIMILARITY:Saccharomyces FT cerev isiae, NFI1_YEAST, nfi1 protein; interacts with FT CDC12, (726 aa), fasta scores: opt: 576, E():1.1e-25, FT (25.4% identity in 733 aa)" FT /product="septin interacting protein homolog" FT /fasta_file="fasta/c1687.tab.seq.01322.out" FT misc_feature 938548..938553 FT /note="gtaagc, splice donor sequence" FT misc_feature 938580..938599 FT /note="ctaacaaaatgaatgtttag, splice branch and acceptor" FT CDS complement(940950..941354) FT /colour=2 FT /gene="rpl44" FT /gene="rpl28" FT /gene="SPAC1687.06c" FT /label=rpl28 FT /note="SPAC1687.06c, len:134" FT /product="60S ribosomal protein L28/L44; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c1687.tab.seq.01323.out" FT rRNA complement(941906..942072) FT /note="SPRG5SB K00769 Yeast (s.pombe) 5s rRNA gene and FT flanks" FT CDS 943333..943707 FT /colour=8 FT /gene="SPAC1687.07" FT /label=SPAC1687.07 FT /note="SPAC1687.07, len:124" FT /product="hypothetical protein; sequence orphan; has FT transcipt profile on microarray" FT /fasta_file="fasta/c1687.tab.seq.01324.out" FT CDS 944004..944294 FT /colour=9 FT /gene="SPAC1687.08" FT /label=SPAC1687.08 FT /note="SPAC1687.08, len:96" FT /product="very hypothetical protein" FT /fasta_file="fasta/c1687.tab.seq.01325.out" FT CDS 944768..948907 FT /colour=8 FT /gene="SPAC1687.09" FT /label=SPAC1687.09 FT /note="SPAC1687.09, len:1379, SIMILARITY:at the C terminal FT to Saccharomyces cerevisiae, YKZ9_YEAST, hypothetical 68.9 FT kD protein in ypt52-dbp7 intergenic region, (615 aa), FT fasta scores: opt: 296, E():8.4e-09, (23.8% identity in FT 604 aa)" FT /product="hypothetical protein; sequence orphan; serine- FT rich protein" FT /fasta_file="fasta/c1687.tab.seq.01326.out" FT CDS join(949649..950392,950445..951686) FT /colour=8 FT /gene="SPAC1687.10" FT /label=SPAC1687.10 FT /note="SPAC1687.10, len:661" FT /product="hypothetical protein; sequence orphan; predicted FT coiled-coil" FT /fasta_file="fasta/c1687.tab.seq.01327.out" FT misc_feature 950393..950398 FT /note="gtaaga, splice donor sequence" FT misc_feature 950433..950444 FT /note="ctaacaatatag, splice branch and acceptor" FT CDS join(951990..952059,952101..952194,952247..952423, FT 952569..954636) FT /colour=2 FT /gene="pmt2" FT /gene="SPAC1687.11" FT /label=pmt2 FT /note="SPAC1687.11, len:802" FT /product="pmt2 methyltransferase" FT /fasta_file="fasta/c1687.tab.seq.01328.out" FT misc_feature 952060..952065 FT /note="gtattt, splice donor sequence" FT misc_feature 952090..952100 FT /note="ttaacgtttag, splice branch and acceptor" FT misc_feature 952195..952200 FT /note="gtaagt, splice donor sequence" FT misc_feature 952231..952246 FT /note="ctgaccgtcaaaacag, splice branch and acceptor" FT misc_feature 952424..952429 FT /note="gtaagt, splice donor sequence" FT misc_feature 952553..952568 FT /note="ttaatgcattgagcag, splice branch and acceptor" FT CDS complement(join(954888..955122,955179..955533, FT 955638..955742,955798..955921)) FT /colour=7 FT /gene="coq4" FT /gene="SPAC1687.12c" FT /label=coq4 FT /note="SPAC1687.12c, len:273, SIMILARITY:Saccharomyces FT cere visiae, COQ4_YEAST, ubiquinone biosynthesis protein FT coq4., (306 aa), fasta scores: opt: 713, E():0, (42.6% FT identity in 244 aa)" FT /product="putative coenzyme Q (ubiquinone) biosynthesis FT protein" FT /fasta_file="fasta/c1687.tab.seq.01329.out" FT misc_feature complement(955123..955134) FT /note="ctaacaatttag, splice branch and acceptor" FT misc_feature complement(955173..955178) FT /note="gtatag, splice donor sequence" FT misc_feature complement(955534..955543) FT /note="ctaatgctag, splice branch and acceptor, branch too FT c lose to acceptor" FT misc_feature complement(955632..955637) FT /note="gtatga, splice donor sequence" FT misc_feature complement(955743..955755) FT /note="ctaaagaaattag, splice branch and acceptor" FT misc_feature complement(955792..955797) FT /note="gtaaga, splice donor sequence" FT CDS complement(join(956177..956347,956412..957057, FT 957165..957247)) FT /colour=7 FT /gene="csn5" FT /gene="SPAC1687.13c" FT /label=csn5 FT /note="SPAC1687.13c, len:300, SIMILARITY:Caenorhabditis FT ele gans., P91001, similar to the c6.1a/pad1/f37a4.5 FT family., ( 368 aa), fasta scores: opt: 799, E():0, (45.3% FT identity in 254 aa)" FT /product="putative COP9/signalosome complex subunit 5" FT /fasta_file="fasta/c1687.tab.seq.01330.out" FT misc_feature complement(join(956189..956324,956440..957047)) FT /note="Match to PF01398 Mov34, Mov34 family Score 182.06" FT misc_feature complement(956348..956363) FT /note="ctaacaagcaatatag, splice branch and acceptor" FT misc_feature complement(956406..956411) FT /note="gtaaga, splice donor sequence" FT misc_feature complement(957058..957070) FT /note="ctaacaataacag, splice branch and acceptor" FT intron complement(957058..957164) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(957159..957164) FT /note="gtaagt, splice donor sequence" FT CDS complement(957889..958119) FT /colour=7 FT /gene="SPAC1687.14c" FT /label=SPAC1687.14c FT /note="SPAC1687.14c, len:76, LOW SIMILARITY:Dunaliella FT sali na., CATR_DUNSA, caltractin, (169 aa), fasta scores: FT opt: 1 61, E():8.6e-09, (42.9% identity in 70 aa)" FT /product="low similar to caltractin; centrin; EF-hand FT motif; possibly involved in microtubule organising centre FT structure and function; centrosome" FT /fasta_file="fasta/c1687.tab.seq.01331.out" FT misc_feature complement(957997..958083) FT /note="Pfam match to entry PF00036 efhand, EF hand" FT CDS complement(958835..959149) FT /colour=9 FT /gene="SPAC1687.23c" FT /label=SPAC1687.23c FT /note="SPAC1687.23c, len:116" FT /product="very hypothetical protein" FT /fasta_file="fasta/c1687.tab.seq.01332.out" FT CDS join(959615..959633,959682..959872,960354..961307) FT /colour=2 FT /gene="skp1" FT /gene="SPAC1687.15" FT /label=skp1 FT /note="SPAC1687.15, len:387" FT /product="serine/threonine protein kinase; glycogen FT synthase kinase 3 (GSK-3) family; involved in cytokinesis; FT interacts with Cdc14p; possible role in the initiation and FT completion of mitosis" FT /fasta_file="fasta/c1687.tab.seq.01333.out" FT misc_feature 959634..959639 FT /note="gtaagt, splice donor sequence" FT misc_feature 959666..959681 FT /note="ctaaccgtataaatag, splice branch and acceptor" FT misc_feature 959873..959878 FT /note="gtatgt, splice donor sequence" FT misc_feature 960337..960353 FT /note="ctaacacttaattttag, splice branch and acceptor" FT misc_feature 960354..961091 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 261.35" FT CDS complement(962728..963630) FT /colour=7 FT /gene="SPAC1687.16c" FT /label=SPAC1687.16c FT /note="SPAC1687.16c, len:300, FT SIMILARITY:Schizosaccharomyce spombe, O13666, c-5 sterol FT desaturase., (329 aa), fasta sc ores: opt: 1130, E():0, FT (57.2% identity in 278 aa)" FT /product="c-5 sterol desaturase" FT /fasta_file="fasta/c1687.tab.seq.01334.out" FT tRNA complement(964341..964414) FT /note="tRNA Ala anticodon AGC, Cove score 67.24" FT CDS complement(join(964925..965344,965536..965575, FT 965619..965665)) FT /colour=7 FT /gene="SPAC1687.17c" FT /label=SPAC1687.17c FT /note="SPAC1687.17c, len:165, SIMILARITY:Caenorhabditis FT ele gans., Q21997, cosmid r151., (227 aa), fasta scores: FT opt: 2 95, E():1.1e-23, (30.4% identity in 135 aa)" FT /product="predicted N-terminal signal sequence; contains 4 FT predicted transmembrane helices; Pfam-B_8099 domain; FT putative cytochrome oxidase; no apparent S. cerevisiae FT ortholog" FT /fasta_file="fasta/c1687.tab.seq.01335.out" FT misc_feature complement(965345..965362) FT /note="ttaacaagatttatttag, splice branch and acceptor" FT misc_feature complement(965530..965535) FT /note="gtatgt, splice donor sequence" FT misc_feature complement(965576..965590) FT /note="ctaatttttatgcag, splice branch and acceptor" FT misc_feature complement(965613..965618) FT /note="gtaaga, splice donor sequence" FT CDS complement(join(965947..966047,966129..967395, FT 967436..967567,967604..967783)) FT /colour=8 FT /gene="SPAC1687.18c" FT /label=SPAC1687.18c FT /note="SPAC1687.18c, len:560" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c1687.tab.seq.01336.out" FT misc_feature complement(966048..966062) FT /note="ttaactttattttag, splice branch and acceptor" FT misc_feature complement(966123..966128) FT /note="gtatta, splice donor sequence" FT misc_feature complement(967396..967408) FT /note="ttgacattattag, splice branch and acceptor" FT misc_feature complement(967430..967435) FT /note="gtatgg, splice donor sequence" FT misc_feature complement(967568..967578) FT /note="ctaaattttag, splice branch and acceptor" FT misc_feature complement(967598..967603) FT /note="gtaata, splice donor sequence" FT CDS complement(join(968124..968634,968678..969251, FT 969306..969435)) FT /EC_number="2.4.2.29" FT /colour=7 FT /gene="SPAC1687.19c" FT /label=SPAC1687.19c FT /note="SPAC1687.19c, len:405, SIMILARITY:Bacillus FT subtilis. , TGT_BACSU, queuine tRNA-ribosyltransferase, FT (381 aa), fas ta scores: opt: 1090, E():0, (42.2% identity FT in 384 aa)" FT /product="queuine tRNA-ribosyltransferase; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c1687.tab.seq.01337.out" FT misc_feature complement(968635..968654) FT /note="ctaatctaacaatattttag, splice branch and acceptor" FT misc_feature complement(968672..968677) FT /note="gtaaga, splice donor sequence" FT misc_feature complement(969252..969270) FT /note="ttaacaaattgtaatttag, splice branch and acceptor" FT misc_feature complement(969300..969305) FT /note="gtaagt, splice donor sequence" FT CDS complement(969547..971565) FT /colour=2 FT /gene="mis6" FT /gene="SPAC1687.20c" FT /label=mis6 FT /note="SPAC1687.20c, len:672" FT /product="inner centromere protein; required for sister FT chromatid segregation during G1/S phase following mitosis; FT similar to S. cerevisiae CTF3 (PMID: 11782448)" FT /fasta_file="fasta/c1687.tab.seq.01338.out" FT misc_feature 971925..972191 FT /note="Pfam match to entry PF00300 PGAM, Phosphoglycerate FT m utase family" FT misc_feature 971973..971978 FT /note="gtaagt, splice donor sequence" FT misc_feature 972108..972126 FT /note="cttaccatcttaattgcag, splice branch and acceptor" FT misc_feature 972250..972255 FT /note="gtgagt, splice donor sequence" FT misc_feature 972275..972290 FT /note="ttaacaaaaaaattag, splice branch and acceptor" FT misc_feature 972357..972362 FT /note="gtacgt, splice donor sequence" FT misc_feature 972385..972402 FT /note="ctaatattgtctaaaaag, splice branch and acceptor" FT misc_feature 972415..974696 FT /note="nominal overlap with cosmid SPAC222, EM:AL132798 S. FT pombe chromosome 1" FT misc_feature 972425..972430 FT /note="gtatga, splice donor sequence" FT misc_feature 972469..972480 FT /note="ctaatgaaatag, splice branch and acceptor" FT misc_feature complement(973369..973384) FT /note="ctaattattatgatag, splice branch and acceptor" FT misc_feature complement(973411..973416) FT /note="gtaagt, splice donor sequence" FT misc_feature complement(973481..973564) FT /note="Match to PF00806 PUF, Pumilio-family RNA-binding FT domains (aka PUM-HD, Pumilio homology domain), Score 44.43" FT misc_feature complement(973537..973641) FT /note="Pfam match to entry PF00806 PUF, Pumilio-family RNA FT binding domains (aka PUM-HD, Pumilio homology domain)" FT misc_feature complement(973581..973594) FT /note="ctaatttcgttaag, splice branch and acceptor" FT misc_feature complement(973631..973636) FT /note="gtaagt, splice donor sequence" FT misc_feature complement(973666..973770) FT /note="Pfam match to entry PF00806 PUF, Pumilio-family RNA FT binding domains (aka PUM-HD, Pumilio homology domain)" FT misc_feature complement(973774..973878) FT /note="Pfam match to entry PF00806 PUF, Pumilio-family RNA FT binding domains (aka PUM-HD, Pumilio homology domain)" FT misc_feature complement(973882..973983) FT /note="Pfam match to entry PF00806 PUF, Pumilio-family RNA FT binding domains (aka PUM-HD, Pumilio homology domain)" FT misc_feature complement(973987..974091) FT /note="Pfam match to entry PF00806 PUF, Pumilio-family RNA FT binding domains (aka PUM-HD, Pumilio homology domain)" FT misc_feature complement(974092..974199) FT /note="Pfam match to entry PF00806 PUF, Pumilio-family RNA FT binding domains (aka PUM-HD, Pumilio homology domain)" FT misc_feature complement(974203..974307) FT /note="Pfam match to entry PF00806 PUF, Pumilio-family RNA FT binding domains (aka PUM-HD, Pumilio homology domain)" FT misc_feature complement(974314..974418) FT /note="Pfam match to entry PF00806 PUF, Pumilio-family RNA FT binding domains (aka PUM-HD, Pumilio homology domain)" FT misc_feature 972415..974696 FT /note="nominal overlap with cosmid SPAC1687, EM:AL035064 FT S. pombe chromosome 1" FT misc_feature 972425..972430 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 972469..972480 FT /colour=6 FT /note="ctaatgaaatag, splice branch and acceptor" FT misc_feature complement(973369..973384) FT /colour=6 FT /note="ctaattattatgatag, splice branch and acceptor" FT misc_feature complement(973411..973416) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(973481..973561) FT /note="Match to PF00806 PUF, Pumilio-family RNA-binding FT domains (aka PUM-HD, Pumilio homology domain) Score 36.04" FT misc_feature complement(973581..973594) FT /colour=6 FT /note="ctaatttcgttaag, splice branch and acceptor" FT misc_feature complement(973631..973636) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(973666..973767) FT /note="Match to PF00806 PUF, Pumilio-family RNA-binding FT domains (aka PUM-HD, Pumilio homology domain) Score 31.89" FT misc_feature complement(973774..973878) FT /note="Match to PF00806 PUF, Pumilio-family RNA-binding FT domains (aka PUM-HD, Pumilio homology domain) Score 48.01" FT misc_feature complement(973882..973980) FT /note="Match to PF00806 PUF, Pumilio-family RNA-binding FT domains (aka PUM-HD, Pumilio homology domain) Score 38.86" FT misc_feature complement(973987..974091) FT /note="Match to PF00806 PUF, Pumilio-family RNA-binding FT domains (aka PUM-HD, Pumilio homology domain) Score 38.10" FT misc_feature complement(974095..974199) FT /note="Match to PF00806 PUF, Pumilio-family RNA-binding FT domains (aka PUM-HD, Pumilio homology domain) Score 40.87" FT misc_feature complement(974203..974301) FT /note="Match to PF00806 PUF, Pumilio-family RNA-binding FT domains (aka PUM-HD, Pumilio homology domain) Score 31.29" FT misc_feature complement(974314..974415) FT /note="Match to PF00806 PUF, Pumilio-family RNA-binding FT domains (aka PUM-HD, Pumilio homology domain) Score 33.00" FT CDS complement(join(977640..977808,978157..978257)) FT /colour=7 FT /gene="SPAC222.03c" FT /label=SPAC222.03c FT /note="SPAC222.03c, len:89, SIMILARITY:Emericella nidulans, FT AAD40003, small zinc finger-like protein., (93 aa), FT fasta scores: opt: 287, E():5e-15, (53.0% identity in 83 FT aa)" FT /product="putative mitochondrial intermembrane protein; FT Tim10/DDP zing finger; possibly involved in mitochondrial FT protein import; similar to S. cerevisiae MRS11" FT /fasta_file="fasta/c222.tab.seq.00031.out" FT misc_feature complement(977809..977825) FT /colour=6 FT /note="ctaacattcctttctag, splice branch and acceptor" FT misc_feature complement(978151..978156) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT CDS complement(979974..980327) FT /colour=10 FT /gene="SPAC222.04c" FT /label=SPAC222.04c FT /note="SPAC222.04c, len:117, SIMILARITY:Saccharomyces FT cerevisiae, YEF4_YEAST, hypothetical 18.5 kD protein in FT gly1-gda1 intergenic region., (166 aa), fasta scores: opt: FT 263, E():7.1e-11, (42.0% identity in 119 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YEL044W" FT /fasta_file="fasta/c222.tab.seq.00032.out" FT CDS complement(join(980730..982070,982130..982279)) FT /colour=7 FT /gene="SPAC222.05c" FT /label=SPAC222.05c FT /note="SPAC222.05c, len:496, SIMILARITY:Saccharomyces FT cerevisiae, MSS1_YEAST, mitochondrial GTPase mss1 ., (526 FT aa), fasta scores: opt: 834, E():0, (36.9% identity in 531 FT aa)" FT /product="putative era/thdf family GTP-binding protein" FT /fasta_file="fasta/c222.tab.seq.00033.out" FT misc_feature complement(982071..982080) FT /colour=6 FT /note="ctaatattag, splice branch and acceptor" FT misc_feature complement(982124..982129) FT /colour=6 FT /note="gtaagg, splice donor sequence" FT CDS join(982789..982850,982904..983750) FT /colour=7 FT /gene="SPAC222.06" FT /label=SPAC222.06 FT /note="SPAC222.06, len:302, SIMILARITY:Saccharomyces FT cerevisiae, MK16_YEAST, mak16 protein., (306 aa), fasta FT scores: opt: 1098, E():0, (55.9% identity in 297 aa)" FT /product="putative Nuclear HMG-like acidic protein; FT possibly required for propagation of M1 double-stranded FT RNA; similar to S. cerevisiae MAK16" FT /fasta_file="fasta/c222.tab.seq.00034.out" FT misc_feature 982851..982856 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT intron 982851..982903 FT /colour=2 FT /note="confirmed intron" FT misc_feature 982888..982903 FT /colour=6 FT /note="ctaacacaatttttag, splice branch and acceptor" FT CDS complement(join(984031..985261,985326..985860, FT 985910..985948,986036..986150)) FT /colour=7 FT /gene="SPAC222.07c" FT /label=SPAC222.07c FT /note="SPAC222.07c, len:639, SIMILARITY:Mus musculus, FT HRI_MOUSE, heme-regulated eukaryotic initiation factor eif- FT 2-alpha kinase(ec 2.7.1.-), (619 aa), fasta scores: opt: FT 455, E():1.1e-20, (27.2% identity in 624 aa)" FT /product="putative heme regulated eukaryotic initiation FT factor by similar to mouse HRI and others; EIF-2-alpha FT kinase; putative serine/threonine protein kinase" FT /fasta_file="fasta/c222.tab.seq.00035.out" FT misc_feature complement(984202..984876) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 79.22" FT misc_feature complement(985262..985276) FT /colour=6 FT /note="ctaacatcggcttag, splice branch and acceptor" FT misc_feature complement(985320..985325) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature complement(985328..985504) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 53.37" FT misc_feature complement(985861..985874) FT /colour=6 FT /note="cttacttattaaag, splice branch and acceptor" FT misc_feature complement(985904..985909) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(985949..985964) FT /colour=6 FT /note="ctaatgtatttattag, splice branch and acceptor" FT misc_feature complement(986030..986035) FT /colour=6 FT /note="gtagga, splice donor sequence" FT tRNA 986859..986930 FT /note="tRNA Glu anticodon TTC, Cove score 62.18" FT CDS complement(987322..988026) FT /colour=7 FT /gene="SPAC222.08c" FT /label=SPAC222.08c FT /note="SPAC222.08c, len:234, SIMILARITY:Saccharomyces FT cerevisiae, YMY5_YEAST, hypothetical 24.9 kD protein in FT ctf13-snz1 intergenic region., (224 aa), fasta scores: FT opt: 369, E():8.5e-19, (38.9% identity in 229 aa)" FT /product="putative pyridoxine (vitamin B6) biosynthetic FT enzyme; similar to glutamine aminotransferases by similar FT to S. cerevisiae sno1,2 and 3" FT /fasta_file="fasta/c222.tab.seq.00036.out" FT misc_feature complement(987346..987951) FT /note="Match to PF01174 UPF0030, Uncharacterized protein FT family UPF0030 Score 194.14" FT snRNA complement(988981..989446) FT /note="S. pombe snu2 gene for U2 snRNA" FT CDS join(989737..990093,990284..991789) FT /colour=7 FT /gene="SPAC222.09" FT /label=SPAC222.09 FT /note="SPAC222.09, len:620, SIMILARITY:Saccharomyces FT cerevisiae, NRD1_YEAST, nrd1 protein., (575 aa), fasta FT scores: opt: 606, E():1e-22, (29.9% identity in 622 aa)" FT /product="possibly controls transcriptional elongation, FT interacts with the C-terminal domain of RNA polymerase II FT large subunit and binds DNA through a RNA recognition FT (RRM) domain; similar to S. cerevisiae NRD1" FT /fasta_file="fasta/c222.tab.seq.00037.out" FT misc_feature 990094..990099 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 990268..990283 FT /colour=6 FT /note="ctaactaagcatgtag, splice branch and acceptor" FT misc_feature 991148..991345 FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 34.56" FT CDS complement(992113..994110) FT /colour=2 FT /gene="byr4" FT /gene="SPAC222.10c" FT /label=byr4 FT /note="SPAC222.10c, len:665" FT /product="putative spindle assembly checkpoint pathway; FT negative regulation of cytokinesis; two-component GEF for FT the GTPase spg1 (with cdc16)" FT /fasta_file="fasta/c222.tab.seq.00038.out" FT CDS 996106..997044 FT /EC_number="1.3.3.3" FT /colour=7 FT /gene="SPAC222.11" FT /label=SPAC222.11 FT /note="SPAC222.11, len:312, SIMILARITY:Drosophila FT melanogaster, AAD46837, bcDNA.gm14838., (390 aa), fasta FT scores: opt: 1222, E():0, (55.5% identity in 308 aa)" FT /product="putative coproporphyrinogen III oxidase" FT /fasta_file="fasta/c222.tab.seq.00039.out" FT misc_feature 996127..997038 FT /note="Match to PF01218 Coprogen_oxidas, FT Coproporphyrinogen III oxidase Score 581.39" FT CDS complement(998459..1000036) FT /EC_number="3.6.3.14" FT /colour=2 FT /gene="atp2" FT /gene="SPAC222.12c" FT /label=atp2 FT /note="SPAC222.12c, len:525" FT /product="Mitochondrial F1-ATPase (beta subunit)" FT /fasta_file="fasta/c222.tab.seq.00040.out" FT misc_feature complement(998471..998767) FT /note="Match to PF00306 ATP-synt_ab_C, ATP synthase ab C FT terminal Score 194.21" FT misc_feature complement(998831..999859) FT /note="Match to PF00006 ATP-synt_ab, ATP synthase alpha FT and beta subunits Score 660.41" FT CDS complement(join(1000934..1001080,1001123..1001944, FT 1001996..1002320,1002433..1002917)) FT /EC_number="2.7.1.105" FT /colour=7 FT /gene="SPAC222.13c" FT /label=SPAC222.13c FT /note="SPAC222.13c, len:592, SIMILARITY:Saccharomyces FT cerevisiae, 6P21_YEAST, 6-phosphofructo-2-kinase 1, (827 FT aa), fasta scores: opt: 1375, E():0, (38.3% identity in FT 588 aa)" FT /product="putative 6-phosphofructo-2-kinase 1; similar to FT S. cerevisiae PFK26" FT /fasta_file="fasta/c222.tab.seq.00041.out" FT misc_feature complement(1001081..1001093) FT /colour=6 FT /note="ttaacaaatttag, splice branch and acceptor" FT misc_feature complement(1001117..1001122) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1001153..1001674) FT /note="Match to PF00300 PGAM, Phosphoglycerate mutase FT family Score 110.41" FT misc_feature complement(1001847..1002527) FT /colour=9 FT /note="Pfam match to entry PF01591 6PF2K, 6-phosphofructo- FT 2-kinase," FT misc_feature complement(1001945..1001960) FT /colour=6 FT /note="ctaacctttttatcag, splice branch and acceptor" FT misc_feature complement(1001990..1001995) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1002321..1002334) FT /colour=6 FT /note="ctaacttggtttag, splice branch and acceptor" FT misc_feature complement(1002427..1002432) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS complement(join(1003843..1005813,1005921..1006006, FT 1006065..1006139,1006253..1006409)) FT /colour=10 FT /gene="SPAC222.14c" FT /label=SPAC222.14c FT /note="SPAC222.14c, len:762, SIMILARITY:Saccharomyces FT cerevisiae, Q99287, chromosome xv reading frame orf FT yor165w., (776 aa), fasta scores: opt: 1104, E():0, (36.9% FT identity in 754 aa)" FT /product="GTP-binding protein; similar to S. cerevisiae FT YOR165W - similarity in the C-terminal region to human FT GBP1, an interferon-induced GTP-binding protein" FT /fasta_file="fasta/c222.tab.seq.00042.out" FT misc_feature complement(1005814..1005826) FT /colour=6 FT /note="ctaaccaacctag, splice branch and acceptor" FT misc_feature complement(1005915..1005920) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature complement(1006007..1006020) FT /colour=6 FT /note="ctaatttttgttag, splice branch and acceptor" FT misc_feature complement(1006059..1006064) FT /colour=6 FT /note="gtaaat, splice donor sequence" FT misc_feature complement(1006140..1006155) FT /colour=6 FT /note="ttaactctatgattag, splice branch and acceptor" FT misc_feature complement(1006247..1006252) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1006941..1010055 FT /note="nominal overlap with cosmid SPAC821, EM:AL121770 S. FT pombe chromosome 1" FT misc_feature complement(1009703..1009720) FT /colour=6 FT /note="ctaaccatcttgaattag, splice branch and acceptor" FT misc_feature complement(1009763..1009768) FT /colour=6 FT /note="gttggt, splice donor sequence" FT misc_feature complement(1009916..1009933) FT /colour=6 FT /note="ctaattctttcgattcag, splice branch and acceptor" FT misc_feature complement(1009959..1009964) FT /colour=6 FT /note="gtatct, splice donor sequence" FT misc_feature 1006941..1010055 FT /note="nominal overlap with cosmid SPAC222, EM:AL132798 S. FT pombe chromosome 1" FT misc_feature 1007434..1007439 FT /colour=6 FT /note="gtataa, splice donor sequence" FT misc_feature 1007466..1007479 FT /colour=6 FT /note="ctaatcaatcgcag, splice branch and acceptor" FT misc_feature 1007534..1007539 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 1007562..1007580 FT /colour=6 FT /note="ctgacaattttgttaaaag, splice branch and acceptor" FT misc_feature 1007683..1007688 FT /colour=6 FT /note="gtactg, splice donor sequence" FT misc_feature 1007710..1007724 FT /colour=6 FT /note="ctaacgattactgag, splice branch and acceptor" FT /note="this gene is flagged as pseudo, as acceptor which FT conserves homology is gag" FT misc_feature 1007996..1008008 FT /colour=6 FT /note="ctaactctaaaag, splice branch and acceptor" FT misc_feature complement(1009703..1009720) FT /colour=6 FT /note="ctaaccatcttgaattag, splice branch and acceptor" FT misc_feature complement(1009763..1009768) FT /colour=6 FT /note="gttggt, splice donor sequence" FT misc_feature complement(1009916..1009933) FT /colour=6 FT /note="ctaattctttcgattcag, splice branch and acceptor" FT misc_feature complement(1009959..1009964) FT /colour=6 FT /note="gtatct, splice donor sequence" FT misc_feature complement(1010055..1010070) FT /colour=6 FT /note="ctaatgcgttaattag, splice branch and acceptor" FT misc_feature complement(1010104..1010109) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1010209..1010221) FT /colour=6 FT /note="ctaaccaattcag, splice branch and acceptor" FT misc_feature complement(1010298..1010303) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1010451..1010463) FT /colour=6 FT /note="ctaactaaaaaag, splice branch and acceptor" FT misc_feature complement(1010516..1010521) FT /colour=6 FT /note="gtaggt, splice donor sequence" FT misc_feature complement(1010575..1010587) FT /colour=6 FT /note="ctaacttgtttag, splice branch and acceptor" FT misc_feature complement(1010614..1010619) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS complement(1011474..1012931) FT /colour=8 FT /gene="SPAC821.03c" FT /label=SPAC821.03c FT /note="SPAC821.03c, len:485" FT /product="hypothetical serine-rich protein; sequence FT orphan" FT /fasta_file="fasta/c821.tab.seq.00248.out" FT CDS complement(1014687..1016423) FT /colour=2 FT /function="non-essential" FT /gene="cid13" FT /gene="SPAC821.04c" FT /label=cid13 FT /note="SPAC821.04c, len:578, FT SIMILARITY:Schizosaccharomyces pombe, O74326, hypothetical FT 54.5 kD protein., (478 aa), fasta scores: opt: 970, E():0, FT (38.7% identity in 429 aa)" FT /product="cid1-related; putative nucleotidyl transferase" FT /fasta_file="fasta/c821.tab.seq.00249.out" FT snRNA complement(1017307..1017942) FT /gene="U3snRNA" FT /note="U3 small nuclear RNA" FT CDS join(1018073..1018098,1018138..1018244,1018424..1019364) FT /colour=7 FT /gene="SPAC821.05" FT /label=SPAC821.05 FT /note="SPAC821.05, len:357, SIMILARITY:Drosophila FT melanogaster, AAD46836, bcDNA.gm14618., (309 aa), fasta FT scores: opt: 234, E():4.3e-08, (25.4% identity in 323 aa)" FT /product="putative eIF3 p40 eIF/signalosome component; MOV FT domain; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c821.tab.seq.00250.out" FT misc_feature 1018099..1018104 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 1018126..1018137 FT /colour=6 FT /note="ctaattcagtag, splice branch and acceptor" FT misc_feature 1018245..1018250 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1018409..1018423 FT /colour=6 FT /note="ctaactttcgttcag, splice branch and acceptor" FT CDS join(1019926..1019965,1020015..1020089,1020148..1020276, FT 1020388..1020469,1020532..1021201) FT /colour=2 FT /gene="spn2" FT /gene="SPAC821.06" FT /label=spn2 FT /note="SPAC821.06, len:331" FT /product="septin homolog" FT /fasta_file="fasta/c821.tab.seq.00251.out" FT misc_feature 1019966..1019971 FT /colour=6 FT /note="gtatga, splice donor sequence" FT intron 1019966..1020014 FT /note="Confirmed Intron" FT misc_feature 1020002..1020014 FT /colour=6 FT /note="ctaatgtttatag, splice branch and acceptor" FT misc_feature join(1020059..1020089,1020148..1020276,1020388..1020469, FT 1020532..1021117) FT /note="Match to PF00735 GTP_CDC, cell division protein FT Score 479.36" FT misc_feature 1020090..1020095 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT intron 1020090..1020147 FT /note="Confirmed Intron" FT misc_feature 1020131..1020147 FT /colour=6 FT /note="ttaacagtttcaaatag, splice branch and acceptor" FT misc_feature 1020277..1020282 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT intron 1020277..1020387 FT /note="Confirmed Intron" FT misc_feature 1020376..1020387 FT /colour=6 FT /note="ctaaccacatag, splice branch and acceptor" FT misc_feature 1020470..1020475 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT intron 1020470..1020531 FT /note="Confirmed Intron" FT misc_feature 1020519..1020531 FT /colour=6 FT /note="ctaactataatag, splice branch and acceptor" FT CDS complement(1021428..1022921) FT /colour=7 FT /gene="SPAC821.07c" FT /label=SPAC821.07c FT /note="SPAC821.07c, len:497, SIMILARITY:Nectria FT haematococca., Q00881, negative acting factor, (455 aa), FT fasta scores: opt: 268, E():9.4e-09, (32.9% identity in FT 173 aa)" FT /product="putative transcriptional regulator; zinc finger FT protein; fungal Zn(2)-Cys(6) binuclear cluster domain; FT subcellular localization of GFP fusion- Nucleus" FT /fasta_file="fasta/c821.tab.seq.00252.out" FT misc_feature complement(1022715..1022822) FT /note="Match to PF00172 Zn_clus, fungal Zn(2)-Cys(6) FT binuclear cluster domain Score 53.12" FT CDS complement(1025152..1026618) FT /colour=2 FT /gene="slp1" FT /gene="SPAC821.08c" FT /label=slp1 FT /note="SPAC821.08c, len:488" FT /product="WD repeat protein; spindle assembly checkpoint FT protein; interacts with Mad2p; APC activator (fizzy); FT similar to S. cerevisiae CDC20" FT /fasta_file="fasta/c821.tab.seq.00253.out" FT misc_feature complement(1025623..1025727) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 40.18" FT CDS 1028629..1031679 FT /colour=2 FT /gene="eng1" FT /gene="SPAC821.09" FT /label=eng1 FT /note="SPAC821.09, len:1016, FT SIMILARITY:Schizosaccharomyces pombe, YAEA_SCHPO, FT hypothetical 77.9 kD protein c23d3.10c in chromosome i, FT (706 aa), fasta scores: opt: 1525, E():0, (41.3% identity FT in 700 aa)" FT /product="endo-1,3-beta-glucanase" FT /fasta_file="fasta/c821.tab.seq.00254.out" FT CDS complement(1032675..1033139) FT /EC_number="1.15.1.1" FT /colour=2 FT /gene="sod1" FT /gene="SPAC821.10c" FT /label=sod1 FT /note="SPAC821.10c, len:154" FT /product="Cu,Zn-superoxide dismutase" FT /fasta_file="fasta/c821.tab.seq.00255.out" FT misc_feature complement(1032681..1033139) FT /note="Match to PF00080 sodcu, Copper/zinc superoxide FT dismutase (SODC) Score 351.21" FT LTR 1034568..1034925 FT /note="TF1-type lone LTR" FT CDS 1036070..1037425 FT /EC_number="1.2.1.41" FT /colour=7 FT /gene="pro1" FT /gene="SPAC821.11" FT /label=SPAC821.11 FT /note="SPAC821.11, len:451, SIMILARITY:Synechocystis sp., FT PROA_SYNY3, putative gamma-glutamyl phosphate reductase, FT (433 aa), fasta scores: opt: 1302, E():0, (48.9% identity FT in 436 aa)" FT /product="putative gamma-glutamyl phosphate reductase" FT /fasta_file="fasta/c821.tab.seq.00256.out" FT misc_feature 1036238..1036864 FT /note="Match to PF00696 aakinase, Aspartate kinases, FT Glutamate kinases and Gamma glutamate phospho-reductases FT Score 193.73" FT CDS join(1038115..1038257,1038525..1038699,1038745..1039836) FT /EC_number="2.7.1.37" FT /colour=2 FT /gene="orb6" FT /gene="SPAC821.12" FT /label=orb6 FT /note="SPAC821.12, len:469" FT /product="serine/threonine protein kinase; involved in FT maintenance of cell polarity" FT /fasta_file="fasta/c821.tab.seq.00257.out" FT misc_feature 1038258..1038263 FT /colour=6 FT /note="gtacga, splice donor sequence" FT misc_feature 1038511..1038524 FT /colour=6 FT /note="ctaattctctttag, splice branch and acceptor" FT misc_feature 1038700..1038705 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 1038733..1038744 FT /colour=6 FT /note="ctaattaaatag, splice branch and acceptor" FT misc_feature 1038745..1039602 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 201.08" FT misc_feature complement(1041642..1041815) FT /note="Match to PF00122 E1-E2_ATPase, E1-E2 ATPases Score FT 24.32" FT misc_feature 1042179..1042392 FT /note="nominal overlap with cosmid SPAC821, EM:AL121770 S. FT pombe chromosome 1" FT misc_feature complement(1042935..1042955) FT /colour=8 FT /note="PS00154 E1-E2 ATPases phosphorylation site" FT misc_feature complement(1046346..1046358) FT /colour=6 FT /note="ctaaccaatttag, splice branch and acceptor" FT intron complement(1046346..1046405) FT /note="confirmed by mRNA" FT misc_feature complement(1046400..1046405) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 1047907..1048136 FT /note="nominal overlap with cosmid SPAC139, EM:AL132667 S. FT pombe chromosome 1" FT misc_feature complement(1048225..1048551) FT /colour=9 FT /note="Pfam match to entry PF00752 XPG_N, XPG N-terminal FT domain," FT misc_feature complement(1048504..1048515) FT /colour=6 FT /note="ctaattttttag, splice branch and acceptor" FT misc_feature complement(1048539..1048544) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS complement(1049288..1050250) FT /colour=7 FT /gene="SPAC139.02c" FT /label=SPAC139.02c FT /note="SPAC139.02c, len:320, SIMILARITY:Saccharomyces FT oviformis, CAB52216, mitochondrial oxaloacetate transport FT protein., (324 aa), fasta scores: opt: 1060, E():0, (54.8% FT identity in 301 aa)" FT /product="MC oxaloacetate transporter" FT /fasta_file="fasta/c139.tab.seq.01579.out" FT misc_feature complement(1049309..1050187) FT /colour=9 FT /note="Pfam match to entry PF00153 mito_carr, FT Mitochondrial carrier proteins," FT CDS join(1051593..1052483,1052523..1053470,1053512..1053550) FT /colour=7 FT /gene="SPAC139.03" FT /label=SPAC139.03 FT /note="SPAC139.03, len:625, SIMILARITY:Schizosaccharomyces FT pombe, O14130, putative 88.0 kD transcriptional regulatory FT protein c3c7.04 inchromosome i., (783 aa), fasta scores: FT opt: 297, E():5.5e-12, (23.6% identity in 585 aa)" FT /product="putative transcriptional regulator; zinc finger FT protein; fungal binuclear cluster domain" FT /fasta_file="fasta/c139.tab.seq.01580.out" FT misc_feature 1051653..1051775 FT /colour=9 FT /note="Pfam match to entry PF00172 Zn_clus, fungal Zn(2)- FT Cys(6) binuclear cluster domain," FT misc_feature 1052484..1052489 FT /colour=6 FT /note="gtttgt, splice donor sequence" FT misc_feature 1052509..1052522 FT /colour=6 FT /note="ctaactcaatttag, splice branch and acceptor" FT misc_feature 1053471..1053476 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1053498..1053511 FT /colour=6 FT /note="ctaacaactgctag, splice branch and acceptor" FT CDS complement(1053852..1055153) FT /colour=7 FT /gene="SPAC139.04c" FT /label=SPAC139.04c FT /note="SPAC139.04c, len:433, SIMILARITY:Penicillium FT janthinellum, Q92261, fructosyl amino acid oxidase., (437 FT aa), fasta scores: opt: 695, E():0, (30.7% identity in 420 FT aa)" FT /product="putative fructosyl amino acid oxidase; no FT apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c139.tab.seq.01581.out" FT CDS 1057992..1059473 FT /colour=7 FT /gene="SPAC139.05" FT /label=SPAC139.05 FT /note="SPAC139.05, len:493, SIMILARITY:Rattus norvegicus, FT SSDH_RAT, succinate semialdehyde dehydrogenase, (488 aa), FT fasta scores: opt: 1522, E():0, (47.5% identity in 484 aa)" FT /product="putative succinate semialdehyde dehydrogenase" FT /fasta_file="fasta/c139.tab.seq.01582.out" FT misc_feature 1058064..1059467 FT /colour=9 FT /note="Pfam match to entry PF00171 aldedh, Aldehyde FT dehydrogenase," FT misc_feature 1059964..1059969 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 1060000..1060013 FT /colour=6 FT /note="ttaacacctgtcag, splice branch and acceptor" FT misc_feature 1060118..1060123 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 1060152..1060178 FT /colour=6 FT /note="ttgattgcaaatagtaacagttattag, splice branch and FT acceptor" FT misc_feature 1060398..1060403 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1060463..1060486 FT /colour=6 FT /note="ctaataatcgtaatgtattaatag, splice branch and FT acceptor" FT misc_feature 1060577..1060676 FT /note="nominal overlap with cosmid SPAC23C4, EM:Z99753 S. FT pombe chromosome 1" FT misc_feature 1060603..1060608 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1060660..1060673 FT /colour=6 FT /note="ttaacaaaaataag, splice branch and acceptor" FT misc_feature 1060577..1060676 FT /note="nominal overlap with cosmid SPAC139, EM:AL132667 S. FT pombe chromosome 1" FT misc_feature 1061038..1061043 FT /note="gttcgt, splice donor sequence" FT misc_feature 1061076..1061093 FT /note="ctaattgtctttttttag, splice branch and acceptor" FT CDS join(1061858..1061891,1061934..1061986,1062035..1062262, FT 1062304..1062392,1062442..1063843) FT /colour=2 FT /gene="crn1" FT /gene="SPAC23C4.02" FT /label=crn1 FT /note="SPAC23C4.02, len:601, SIMILARITY:Saccharomyces FT cerevisiae, CORO_YEAST, coronin-like protein., (651 aa), FT fasta scores: opt: 1784, E():0, (50.5% identity in 566 aa)" FT /product="coronin homolog; similar to S. cerevisiae CRN1" FT /fasta_file="fasta/c23C4.tab.seq.01419.out" FT misc_feature 1061892..1061897 FT /note="gtacgc, splice donor sequence" FT misc_feature 1061924..1061933 FT /note="ctgacgttag, splice branch and acceptor" FT misc_feature 1061987..1061992 FT /note="gttggt, splice donor sequence" FT misc_feature 1062018..1062034 FT /note="ctaattgtcttcaatag, splice branch and acceptor" FT misc_feature 1062176..1062265 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 22.99" FT misc_feature 1062263..1062268 FT /note="gtatcc, splice donor sequence" FT misc_feature 1062292..1062303 FT /note="ttaacgaattag, splice branch and acceptor" FT misc_feature 1062393..1062398 FT /note="gtatgt, splice donor sequence" FT misc_feature 1062425..1062441 FT /note="ctgacttttttgtatag, splice branch and acceptor" FT misc_feature 1062440..1062526 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 23.21" FT misc_feature 1062485..1062529 FT /colour=8 FT /note="PS00678 Beta-transducin family Trp-Asp repeats FT signa ture" FT misc_feature 1062572..1062649 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 22.80" FT CDS 1063972..1065438 FT /colour=7 FT /gene="SPAC23C4.03" FT /label=SPAC23C4.03 FT /note="SPAC23C4.03, len:488, SIMILARITY to C FT term:Caenorhabditis elegans., Q94191, similar to s. FT cerevisiae DNA damage-response protein alk1., (340 aa), FT fasta scores: opt: 294, E():9.5e-12, (31.0% identity in FT 316 aa)" FT /product="putative DNA damage response protein; similar to FT S. cerevisiae ALK1" FT /fasta_file="fasta/c23C4.tab.seq.01420.out" FT misc_feature 1065703..1066020 FT /note="was entry SPAC23C4.04c but now thought to be not FT coding" FT CDS complement(join(1066509..1067737,1067792..1067858)) FT /colour=8 FT /gene="SPAC23C4.05c" FT /label=SPAC23C4.05c FT /note="SPAC23C4.05c, len:431, FT SIMILARITY:Schizosaccharomyces pombe, CAB44764, FT hypothetical 75.7 kD protein., (684 aa), fasta scores: FT opt: 207, E():1.3e-05, (22.4% identity in 357 aa)" FT /product="hypothetical protein; sequence orphan; predicted FT N-terminal signal sequence" FT /fasta_file="fasta/c23C4.tab.seq.01421.out" FT misc_feature complement(1067738..1067756) FT /note="ctgacccggcattgtctag, splice branch and acceptor" FT misc_feature complement(1067786..1067791) FT /note="gtaagt, splice donor sequence" FT CDS complement(1068342..1069325) FT /colour=7 FT /gene="SPAC23C4.06c" FT /label=SPAC23C4.06c FT /note="SPAC23C4.06c, len:327, SIMILARITY to C FT term:Caenorhabditis elegans., YNE4_CAEEL, hypothetical FT 46.7 kD protein r08d7.4 in chromosome iii., (409 aa), FT fasta scores: opt: 178, E():0.00013, (30.0% identity in FT 150 aa)" FT /product="possibly involved in stress response by FT similarity to S. pombe uvi22" FT /fasta_file="fasta/c23C4.tab.seq.01422.out" FT CDS 1069917..1070522 FT /colour=8 FT /gene="SPAC23C4.07" FT /label=SPAC23C4.07 FT /note="SPAC23C4.07, len:201" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c23C4.tab.seq.01423.out" FT CDS join(1071063..1071079,1071219..1071274,1071349..1071421, FT 1071746..1072226) FT /colour=2 FT /gene="rho3" FT /gene="SPAC23C4.08" FT /label=rho3 FT /note="SPAC23C4.08, len:208, SIMILARITY:Saccharomyces FT cerevisiae, RHO3_YEAST, rho3 protein., (231 aa), fasta FT scores: opt: 675, E():0, (62.1% identity in 235 aa)" FT /product="Rho family; RAS small GTPase; guanine nucleotide FT exchange factor; involved in morphogenesis and septation; FT similar to S. cerevisiae RHO3" FT /fasta_file="fasta/c23C4.tab.seq.01424.out" FT misc_feature 1071080..1071085 FT /note="gtaagc, splice donor sequence" FT misc_feature 1071199..1071218 FT /note="ctcattgaaagtatgtcaag, splice branch and acceptor" FT misc_feature join(1071253..1071274,1071349..1071421,1071746..1072220) FT /note="Match to PF00071 ras, Ras family Score 226.39" FT misc_feature 1071275..1071280 FT /note="gtaagg, splice donor sequence" FT misc_feature 1071332..1071348 FT /note="ctaaccgtaaattatag, splice branch and acceptor" FT misc_feature 1071422..1071427 FT /note="gtaagt, splice donor sequence" FT misc_feature 1071729..1071745 FT /note="ctaacacctaaaaatag, splice branch and acceptor" FT CDS complement(join(1072896..1072940,1073058..1073188, FT 1073272..1073347,1073396..1073465,1073677..1073750)) FT /colour=7 FT /gene="SPAC23C4.09c" FT /label=SPAC23C4.09c FT /note="SPAC23C4.09c, len:131, SIMILARITY:Mus musculus, FT AAD45607, tf-1 apoptosis related protein 19., (126 aa), FT fasta scores: opt: 346, E():2e-15, (46.6% identity in 131 FT aa)" FT /product="putative apoptosis related protein by similarity FT to human and mouse tfar19" FT /fasta_file="fasta/c23C4.tab.seq.01425.out" FT misc_feature complement(1072941..1072956) FT /note="ttaactgtttaattag, splice branch and acceptor" FT misc_feature complement(1073052..1073057) FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1073189..1073201) FT /note="ctaatttgtgtag, splice branch and acceptor" FT misc_feature complement(1073266..1073271) FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1073348..1073363) FT /note="ctaacaatttcataag, splice branch and acceptor" FT misc_feature complement(1073390..1073395) FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1073466..1073478) FT /note="ttaacaaatctag, splice branch and acceptor" FT misc_feature complement(1073671..1073676) FT /note="gtatgt, splice donor sequence" FT LTR 1074198..1074536 FT /note="Tf2-type LTR" FT CDS 1074671..1076254 FT /colour=7 FT /gene="sec2" FT /gene="SPAC23C4.10" FT /label=sec2 FT /note="SPAC23C4.10, len:527, SIMILARITY:Saccharomyces FT cerevisiae, SEC2_YEAST, protein transport protein sec2., FT (759 aa), fasta scores: opt: 252, E():4.7e-07, (31.0% FT identity in 200 aa)" FT /product="predicted coiled-coil domain; possibly required FT for vesicular transport to the plasma membrane; similar to FT S. cerevisiae SEC2" FT /fasta_file="fasta/c23C4.tab.seq.01426.out" FT CDS join(1076992..1077061,1077111..1077161,1077206..1077267) FT /EC_number="3.6.3.14" FT /colour=7 FT /gene="atp18" FT /gene="SPAC23C4.11" FT /label=atp18 FT /note="SPAC23C4.11, len:60, SIMILARITY:Saccharomyces FT cerevisiae, AT18_YEAST, atp synthase j chain, FT mitochondrial, (59 aa), fasta scores: opt: 181, E():2.2e- FT 08, (51.9% identity in 52 aa)" FT /product="putative F-type ATPase subunit j; mitochondrial; FT similar to S. cerevisiae ATP18" FT /fasta_file="fasta/c23C4.tab.seq.01427.out" FT misc_feature 1077062..1077067 FT /note="gtatgt, splice donor sequence" FT intron 1077062..1077110 FT /colour=2 FT /note="confirmed intron" FT misc_feature 1077094..1077110 FT /note="ttaacatgtcttgacag, splice branch and acceptor" FT misc_feature 1077162..1077167 FT /note="gtacgt, splice donor sequence" FT intron 1077162..1077205 FT /colour=2 FT /note="confirmed intron" FT misc_feature 1077192..1077205 FT /note="ttaactctatgtag, splice branch and acceptor" FT CDS join(1078711..1078874,1079041..1079764,1079851..1080165) FT /colour=2 FT /gene="hhp2" FT /gene="SPAC23C4.12" FT /label=hhp2 FT /note="SPAC23C4.12, len:400" FT /product="serine/threonine protein kinase; casein kinase I FT homolog" FT /fasta_file="fasta/c23C4.tab.seq.01428.out" FT misc_feature 1078744..1078833 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 35.30" FT misc_feature 1078762..1078833 FT /note="PS00107 protein kinases ATP-binding region FT signature" FT misc_feature 1078875..1078880 FT /note="gtaagt, splice donor sequence" FT misc_feature 1079030..1079040 FT /note="ctaacatttag, splice branch and acceptor" FT misc_feature 1079078..1079563 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 74.87" FT misc_feature 1079255..1079293 FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT misc_feature 1079765..1079770 FT /note="gtaagt, splice donor sequence" FT misc_feature 1079837..1079850 FT /note="ctaactattattag, splice branch and acceptor" FT CDS join(1081405..1081415,1081459..1081597,1081647..1081850) FT /colour=2 FT /gene="bet1" FT /gene="SPAC23C4.13" FT /label=bet1 FT /note="SPAC23C4.13, len:117, SIMILARITY:Saccharomyces FT cerevisiae, BET1_YEAST, protein transport protein bet1, FT (142 aa), fasta scores: opt: 187, E():7.4e-06, (31.1% FT identity in 103 aa)" FT /product="putative ER-golgi SNARE; similar to S. FT cerevisiae BET1" FT /fasta_file="fasta/c23C4.tab.seq.01429.out" FT misc_feature 1081416..1081421 FT /note="gtatgt, splice donor sequence" FT misc_feature 1081444..1081458 FT /note="ctaactaatcattag, splice branch and acceptor" FT misc_feature 1081598..1081603 FT /note="gtaaga, splice donor sequence" FT misc_feature 1081634..1081646 FT /note="ctaattttaatag, splice branch and acceptor" FT CDS join(1082660..1082843,1082920..1083352,1083396..1083930, FT 1084022..1084144) FT /colour=7 FT /gene="SPAC23C4.14" FT /label=SPAC23C4.14 FT /note="SPAC23C4.14, len:424, SIMILARITY:Saccharomyces FT cerevisiae, ALG1_YEAST, beta-mannosyltransferase, (449 aa), FT fasta scores: opt: 654, E():0, (38.0% identity in 450 FT aa)" FT /product="putative beta-mannosyltransferase; similar to S. FT cerevisiae ALG1" FT /fasta_file="fasta/c23C4.tab.seq.01430.out" FT misc_feature 1082844..1082849 FT /note="gtaagt, splice donor sequence" FT misc_feature 1082871..1082889 FT /note="ttaatctataccacattag, splice branch and acceptor" FT misc_feature 1083353..1083358 FT /note="gtaagt, splice donor sequence" FT misc_feature 1083382..1083395 FT /note="ctaacattttcaag, splice branch and acceptor" FT misc_feature 1083496..1083900 FT /note="Match to PF00534 Glycos_transf_1, Glycosyl FT transferases group 1 Score 35.93" FT misc_feature 1083931..1083936 FT /note="gtatga, splice donor sequence" FT misc_feature 1084009..1084021 FT /note="ctaactgttttag, splice branch and acceptor" FT CDS join(1084411..1084485,1084550..1084632,1084844..1085318) FT /EC_number="2.7.7.6" FT /colour=2 FT /gene="rpb5" FT /gene="SPAC23C4.15" FT /label=rpb5 FT /note="SPAC23C4.15, len:210" FT /product="DNA-directed RNA polymerase I, II and III 24 kD FT subunit" FT /fasta_file="fasta/c23C4.tab.seq.01431.out" FT misc_feature 1084486..1084491 FT /note="gtatgt, splice donor sequence" FT intron 1084486..1084549 FT /colour=2 FT /note="confirmed intron" FT misc_feature 1084529..1084549 FT /note="ttaacaactattataacttag, splice branch and acceptor" FT misc_feature 1084633..1084638 FT /note="gtatgt, splice donor sequence" FT intron 1084633..1084843 FT /colour=2 FT /note="confirmed intron" FT misc_feature 1084831..1084843 FT /note="ctaatgcgtttag, splice branch and acceptor" FT misc_feature 1084890..1084913 FT /colour=8 FT /note="PS00030 Eukaryotic putative RNA-binding region RNP- FT 1 signature" FT misc_feature 1085094..1085315 FT /note="Match to PF01191 RNA_pol_H, RNA polymerases H / 23 FT kDa subunit Score 172.00" FT misc_feature 1085109..1085147 FT /note="PS01110 RNA polymerases H / 23 Kd subunits FT signature" FT CDS complement(1085817..1087091) FT /colour=7 FT /gene="SPAC23C4.16c" FT /label=SPAC23C4.16c FT /note="SPAC23C4.16c, len:424, SIMILARITY:Candida albicans, FT O94004, conserved protein, (597 aa), fasta scores: opt: FT 1117, E():0, (45.7% identity in 368 aa)" FT /product="very putative phospholipase" FT /fasta_file="fasta/c23C4.tab.seq.01432.out" FT misc_feature complement(1086234..1086263) FT /note="PS00120 Lipases, serine active site" FT misc_feature complement(1087534..1087830) FT /note="Corresponds to AB016220 AB016220 FT Schizosaccharomyces pombe mRNA but no associated CDS" FT CDS join(1088071..1088091,1088141..1088190,1088299..1089453, FT 1089514..1089780,1089819..1090350) FT /colour=7 FT /gene="SPAC23C4.17" FT /label=SPAC23C4.17 FT /note="SPAC23C4.17, len:674, SIMILARITY:Arabidopsis FT thaliana, AAD22359, f14m13.20 protein., (837 aa), fasta FT scores: opt: 988, E():0, (34.5% identity in 733 aa)" FT /product="putative Methyltransferase; NOL1/NOP2/sun FT family; possibly methylates cytidine to 5-methyl-cytidine FT (m5C) at several positions in different tRNAs; similar to FT S. cerevisiae NCL1" FT /fasta_file="fasta/c23C4.tab.seq.01433.out" FT misc_feature 1088092..1088097 FT /note="gtatga, splice donor sequence" FT misc_feature 1088128..1088140 FT /note="ttaacaaagatag, splice branch and acceptor" FT misc_feature 1088191..1088196 FT /note="gtaagt, splice donor sequence" FT misc_feature 1088288..1088298 FT /note="ctaacatgcag, splice branch and acceptor" FT misc_feature 1088516..1089328 FT /note="Match to PF01189 Nol1_Nop2_Sun, NOL1/NOP2/sun FT family Score 43.38" FT misc_feature 1089017..1089058 FT /colour=8 FT /note="PS01153 NOL1/NOP2/fmu family signature" FT misc_feature 1089454..1089459 FT /note="gtaggt, splice donor sequence" FT misc_feature 1089499..1089513 FT /note="ctaatctcttaatag, splice branch and acceptor" FT misc_feature 1089781..1089786 FT /note="gtaagt, splice donor sequence" FT misc_feature 1089808..1089818 FT /note="ctaacccatag, splice branch and acceptor" FT CDS complement(join(1090468..1092240,1092307..1092414, FT 1092472..1092537)) FT /colour=2 FT /gene="rad4" FT /gene="cut5" FT /gene="SPAC23C4.18c" FT /label=rad4 FT /note="SPAC23C4.18c, len:648" FT /product="DNA replication protein; S-M checkpoint control FT protein Rad4p" FT /fasta_file="fasta/c23C4.tab.seq.01434.out" FT misc_feature complement(1090954..1091232) FT /note="Match to PF00533 BRCT, BRCA1 C Terminus (BRCT) FT domain Score 69.77" FT misc_feature complement(1091263..1091523) FT /note="Match to PF00533 BRCT, BRCA1 C Terminus (BRCT) FT domain Score 75.79" FT misc_feature complement(1091860..1092126) FT /note="Match to PF00533 BRCT, BRCA1 C Terminus (BRCT) FT domain Score 97.37" FT misc_feature complement(join(1092136..1092218,1092267..1092414, FT 1092472..1092534)) FT /note="Match to PF00533 BRCT, BRCA1 C Terminus (BRCT) FT domain Score 26.62" FT misc_feature complement(1092241..1092259) FT /note="ctgacattcttttcaatag, splice branch and acceptor" FT misc_feature complement(1092301..1092306) FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1092415..1092426) FT /note="ctaacttgacag, splice branch and acceptor" FT misc_feature complement(1092466..1092471) FT /note="gtaaga, splice donor sequence" FT CDS 1093543..1096515 FT /colour=2 FT /gene="spt5" FT /gene="SPAC23C4.19" FT /label=spt5 FT /note="SPAC23C4.19, len:990, SIMILARITY:Saccharomyces FT cerevisiae, SPT5_YEAST, transcription initiation protein FT spt5., (1063 aa), fasta scores: opt: 1143, E():0, (35.5% FT identity in 1056 aa)" FT /product="possibly involved in chromatin remodeling; FT putative global transcription factor A; similar to S. FT cerevisiae SPT5; contains nonopeptide repeat TPAWNSGSK - FT necessary and sufficient for binding to the capping FT enzymes in vivo (in a 2-hybrid assay) and in vitro (PMID: FT 11893740); essential (PMID: 11893740)" FT /fasta_file="fasta/c23C4.tab.seq.01435.out" FT misc_feature complement(1097395..1097408) FT /note="ctaatcttaattag, splice branch and acceptor" FT misc_feature complement(1097443..1097448) FT /note="gtaagt, splice donor sequence" FT misc_feature 1097827..1098845 FT /note="nominal overlap with SPAC1A6, EM:Z99258 S. pombe FT chromosome 1" FT misc_feature 1097827..1098845 FT /note="nominal overlap with cosmid SPAC23C4, EM:Z99753 S. FT pombe chromosome 1" FT CDS complement(1099815..1101689) FT /EC_number="3.1.1.5" FT /colour=7 FT /gene="SPAC1A6.03c" FT /label=SPAC1A6.03c FT /note="SPAC1A6.03c, len:624, FT SIMILARITY:Schizosaccharomyces pombe, CAB40176, putative FT lysophospholipase ., (623 aa), fasta scores: opt: 2588, FT E():0, (61.9% identity in 583 aa)" FT /product="putative lysophospholipase" FT /fasta_file="fasta/c1A6.tab.seq.00854.out" FT CDS 1103210..1103530 FT /colour=9 FT /gene="SPAC1A6.11" FT /label=SPAC1A6.11 FT /note="SPAC1A6.11, len:106" FT /product="very hypothetical protein" FT /fasta_file="fasta/c1A6.tab.seq.00855.out" FT BLASTN_HIT complement(1104009..1105417) FT /note="7045 (-1) 1 1409 SPAB5603 AB005603 FT Schizosaccharomyces pombe mRNA for phospholipase B, FT partial cds." FT CDS complement(1104453..1106294) FT /EC_number="3.1.1.5" FT /colour=7 FT /gene="SPAC1A6.04c" FT /label=SPAC1A6.04c FT /note="SPAC1A6.04c, len:613, FT SIMILARITY:Schizosaccharomyces pombe, O13857, putative FT lysophospholipase , (624 aa), fasta scores: opt: 1601, FT E():0, (41.3% identity in 566 aa)" FT /product="putative lysophospholipase" FT /fasta_file="fasta/c1A6.tab.seq.00856.out" FT CDS complement(join(1109697..1110282,1110335..1111109, FT 1111147..1111237)) FT /colour=10 FT /gene="SPAC1A6.05c" FT /label=SPAC1A6.05c FT /note="SPAC1A6.05c, len:483, SIMILARITY:Saccharomyces FT cerevisiae, YK69_YEAST, hypothetical 102.7 kD protein in FT prp16-srp40 intergenic region., (910 aa), fasta scores: FT opt: 988, E():0, (39.2% identity in 497 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YKR089C" FT /fasta_file="fasta/c1A6.tab.seq.00857.out" FT misc_feature complement(1110283..1110299) FT /note="ctaataagcccttttag, splice branch and acceptor" FT misc_feature complement(1110329..1110334) FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1111110..1111122) FT /note="ctaatggaaccag, splice branch and acceptor" FT misc_feature complement(1111141..1111146) FT /note="gtaaga, splice donor sequence" FT CDS complement(join(1112459..1112818,1112870..1113067)) FT /colour=2 FT /gene="meu31" FT /gene="SPAC1A6.06c" FT /label=meu31 FT /note="SPAC1A6.06c, len:185," FT /product="meiotic expression upregulated; no apparent FT orthologs" FT /fasta_file="fasta/c1A6.tab.seq.00022.out" FT misc_feature complement(1112819..1112833) FT /note="ttaactaatgtaaag, splice branch and acceptor FT sequence" FT misc_feature complement(1112864..1112869) FT /note="gtaaga, splice donor sequence" FT CDS 1113851..1115761 FT /colour=8 FT /gene="SPAC1A6.07" FT /label=SPAC1A6.07 FT /note="SPAC1A6.07, len:636," FT /product="hypothetical proline-rich protein; sequence FT orphan; subcellular localization of GFP fusion- putative FT cell wall filament" FT /fasta_file="fasta/c1A6.tab.seq.00859.out" FT CDS complement(1116052..1116909) FT /colour=8 FT /gene="SPAC1A6.08c" FT /label=SPAC1A6.08c FT /note="SPAC1A6.08c, len:285," FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c1A6.tab.seq.00860.out" FT CDS complement(1117495..1118667) FT /colour=2 FT /gene="lag1" FT /gene="SPAC1A6.09c" FT /label=lag1 FT /note="SPAC1A6.09c, len:390" FT /product="longevity-assurance protein 1" FT /fasta_file="fasta/c1A6.tab.seq.00861.out" FT misc_feature 1120726..1121139 FT /colour=9 FT /note="Pfam match to entry PF00899 ThiF_family, ThiF FT family," FT misc_feature complement(1121725..1121826) FT /note="nominal overlap with cosmid SPAC30D11, EM:Z67961 S. FT pombe chromosome 1" FT misc_feature 1121725..1121826 FT /note="nominal overlap with SPAC1A6, EM:Z99258 S. pombe FT chromosome 1" FT CDS 1122117..1123721 FT /colour=10 FT /gene="SPAC30D11.14c" FT /label=SPAC30D11.14c FT /note="SPAC30D11.14, len: 534" FT /note="SPAC30D11.14, len:533, SIMILARITY:Homo sapiens, FT O94981, kiaa0907 protein., (564 aa), fasta scores: opt: FT 372, E():2.9e-11, (25.8% identity in 461 aa)" FT /product="hypothetical protein; Pfam-B_23815; no apparent FT S. cerevisiae ortholog" FT /fasta_file="fasta/c30D11.tab.seq.01875.out" FT CDS complement(join(1124176..1124236,1124292..1124371, FT 1124421..1124530,1124573..1124596,1124818..1124950, FT 1125004..1125069)) FT /EC_number="6.3.2.19" FT /colour=2 FT /gene="hus5" FT /gene="ubc9" FT /gene="SPAC30D11.13" FT /label=hus5 FT /note="SPAC30D11.13, len: 157" FT /product="ubiquitin conjugating enzyme; necessary for FT mitosis" FT /fasta_file="fasta/c30D11.tab.seq.01876.out" FT misc_feature complement(1124237..1124250) FT /colour=6 FT /note="ttaacctcgtttag, splice branch and acceptor" FT misc_feature complement(1124286..1124291) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1124372..1124385) FT /colour=6 FT /note="ttaaccatttctag, splice branch and acceptor" FT misc_feature complement(1124415..1124420) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature complement(join(1124421..1124530,1124573..1124596, FT 1124818..1124950,1125004..1125072)) FT /note="Match to PF00179 UQ_con, Ubiquitin-conjugating FT enzyme Score 179.79" FT misc_feature complement(1124466..1124510) FT /colour=8 FT /note="PS00183 Ubiquitin-conjugating enzymes active site" FT misc_feature complement(1124531..1124547) FT /colour=6 FT /note="ctaatgcttttgtacag, splice branch and acceptor" FT misc_feature complement(1124567..1124572) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature complement(1124597..1124612) FT /colour=6 FT /note="ctaactgcaatcacag, splice branch and acceptor" FT misc_feature complement(1124812..1124817) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1124951..1124971) FT /colour=6 FT /note="ctaacaacttctcttacttag, splice branch and acceptor" FT misc_feature complement(1124998..1125003) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1125794..1125806) FT /colour=9 FT /note="S. pombe ARS element (pFL201.2) EMBL:SPARS201 FT X0789 4" FT tRNA 1126045..1126142 FT /label=tRNA Ser FT /note="tRNA Ser anticodon CGA, Cove score 77.58" FT intron 1126082..1126097 FT /note="intron tRNA Ser anticodon CGA" FT tRNA 1126150..1126221 FT /gene="sup12" FT /label=tRNA-Met FT /note="tRNA Met anticodon CAT, Cove score 69.52" FT CDS complement(join(1126566..1126600,1126688..1126874, FT 1126924..1126926)) FT /colour=2 FT /gene="rpl38-2" FT /gene="SPAC30D11.12" FT /label=rpl38 FT /note="SPAC30D11.12, len:74" FT /product="60S ribosomal protein L38" FT /fasta_file="fasta/c30D11.tab.seq.01877.out" FT misc_feature complement(1126601..1126610) FT /colour=6 FT /note="ttgattatag, splice branch and acceptor" FT intron complement(1126601..1126687) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1126682..1126687) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1126875..1126889) FT /colour=6 FT /note="ctgacttagtattag, splice branch and acceptor" FT misc_feature complement(1126918..1126923) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT promoter complement(1126994..1127002) FT /colour=4 FT /note="Homol D box" FT CDS complement(1127712..1129040) FT /colour=10 FT /gene="SPAC30D11.11" FT /label=SPAC30D11.11 FT /note="SPAC30D11.11, len:441, SIMILARITY:Saccharomyces FT cerevisiae, Q07959, chromosome xii reading frame orf FT ylr023c., (543 aa), fasta scores: opt: 570, E():2.2e-29, FT (36.4% identity in 261 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YLR023C; predicted transmembrane" FT /fasta_file="fasta/c30D11.tab.seq.01878.out" FT misc_feature complement(1128759..1128782) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A" FT CDS complement(1129804..1131213) FT /colour=2 FT /gene="rad22" FT /gene="SPAC30D11.10" FT /label=rad22 FT /note="SPAC30D11.10, len:469" FT /note="SPAC30D11.10, len:468" FT /product="DNA repair and recombination protein; involved FT in mating type switching; similar to S. cerevisiae RAD52" FT /fasta_file="fasta/c30D11.tab.seq.01879.out" FT CDS complement(join(1131417..1131655,1131699..1131966, FT 1132011..1133423)) FT /colour=8 FT /gene="SPAC30D11.09" FT /label=SPAC30D11.09 FT /note="SPAC30D11.09, len: 639, some similar to WP:B0361. 1 FT CE00754 (30.1% identity in 123 aa overlap)" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c30D11.tab.seq.01880.out" FT misc_feature complement(1131656..1131666) FT /colour=6 FT /note="ctaatgattag, splice branch and acceptor" FT misc_feature complement(1131693..1131698) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1131967..1131983) FT /colour=6 FT /note="ctaacaaacctttttag, splice branch and acceptor" FT misc_feature complement(1132005..1132010) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS join(1134540..1135879,1135929..1136205) FT /colour=7 FT /gene="SPAC30D11.08c" FT /label=SPAC30D11.08c FT /note="SPAC30D11.08c, len:537, FT SIMILARITY:Schizosaccharomyces pombe, P87233, hypothetical FT 51.3 kD protein c4g3.07c in chromosome iii., (461 aa), FT fasta scores: opt: 582, E():6.2e-28, (29.0% identity in FT 473 aa)" FT /product="zinc finger protein; zf-PHD finger" FT /fasta_file="fasta/c30D11.tab.seq.01881.out" FT misc_feature 1135242..1135403 FT /note="Match to PF00628 PHD, PHD-finger Score 83.43" FT misc_feature 1135880..1135885 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1135917..1135928 FT /colour=6 FT /note="ctaatattctag, splice branch and acceptor" FT CDS complement(1136449..1137516) FT /EC_number="4.2.99.18" FT /colour=2 FT /gene="nth1" FT /gene="SPAC30D11.07" FT /label=nth1 FT /note="SPAC30D11.07, len:354" FT /product="endonuclease III homolog" FT /fasta_file="fasta/c30D11.tab.seq.01882.out" FT misc_feature complement(1136836..1137372) FT /note="Match to PF00730 Endonuclease_3, Endonuclease III FT Score 368.25" FT CDS join(1138243..1138379,1138435..1138522,1138731..1139786) FT /colour=10 FT /gene="SPAC30D11.06c" FT /label=SPAC30D11.06c FT /note="SPAC30D11.06c, len: 426, similar to SW:YK31_YEAST FT P3 6142 hypothetical protein (37.0% identity in 365 aa FT overla p)" FT /note="SPAC30D11.06c, len:425, SIMILARITY:Saccharomyces FT cerevisiae, YK31_YEAST, hypothetical 48.8 kD protein in FT trk2-mrs4 intergenic region., (418 aa), fasta scores: opt: FT 595, E():1.2e-31, (38.0% identity in 355 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YKR051W" FT /fasta_file="fasta/c30D11.tab.seq.01883.out" FT misc_feature 1138380..1138385 FT /colour=6 FT /note="gttcgt, splice donor sequence" FT misc_feature 1138420..1138434 FT /colour=6 FT /note="ctaatgctttgctag, splice branch and acceptor" FT misc_feature 1138523..1138528 FT /colour=6 FT /note="gtaggt, splice donor sequence" FT misc_feature 1138716..1138730 FT /colour=6 FT /note="ctaacaataaattag, splice branch and acceptor" FT CDS complement(join(1139793..1139969,1140432..1140485, FT 1140528..1140794)) FT /colour=2 FT /gene="aps3" FT /gene="SPAC30D11.05" FT /label=aps3 FT /note="SPAC30D11.05, len:164, SIMILARITY:Mus musculus, FT O88670, adaptor protein complex-3 sigma3a subunit isoform., FT (193 aa), fasta scores: opt: 605, E():0, (60.9% identity FT in 151 aa)" FT /product="putative small subunit of the clathrin- FT associated protein (AP) complex" FT /fasta_file="fasta/c30D11.tab.seq.01884.out" FT misc_feature complement(join(1139883..1139969,1140432..1140485, FT 1140528..1140794)) FT /note="Match to PF01217 Clat_adaptor_s, Clathrin adaptor FT complex small chain Score 252.09" FT misc_feature complement(1139970..1139983) FT /colour=6 FT /note="ctaacacaatatag, splice branch and acceptor" FT misc_feature complement(1140426..1140431) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1140486..1140498) FT /colour=6 FT /note="ctaactattaaag, splice branch and acceptor" FT misc_feature complement(1140522..1140527) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1140582..1140614) FT /colour=8 FT /note="PS00989 Clathrin adaptor complexes small chain FT signa ture" FT CDS join(1141890..1142140,1142184..1145412) FT /colour=2 FT /gene="nup124" FT /gene="SPAC30D11.04c" FT /label=nup124 FT /note="SPAC30D11.4c, len:1158, SIMILARITY: low to Rattus FT norvegicus, N121_RAT, nuclear envelope pore membrane FT protein pom 121, (1199 aa), fasta scores: opt: 430, FT E():2.2e-13, (22.4% identity in 1092 aa)" FT /product="nuclear pore factor" FT /fasta_file="fasta/c30D11.tab.seq.01885.out" FT misc_feature 1142141..1142146 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1142170..1142183 FT /colour=6 FT /note="ttaacattaaatag, splice branch and acceptor" FT CDS complement(join(1145733..1145878,1145923..1146043, FT 1146091..1148088)) FT /colour=7 FT /gene="SPAC30D11.03" FT /label=SPAC30D11.03 FT /note="SPAC30D11.03, len:753, SIMILARITY:Saccharomyces FT cerevisiae, DRS1_YEAST, putative ATP-dependent RNA FT helicase drs1., (752 aa), fasta scores: opt: 1900, E():0, FT (45.3% identity in 741 aa)" FT /product="ATP-dependent RNA helicase" FT /fasta_file="fasta/c30D11.tab.seq.01886.out" FT misc_feature complement(1145879..1145890) FT /colour=6 FT /note="ctaacattatag, splice branch and acceptor" FT misc_feature complement(1145917..1145922) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1146044..1146056) FT /colour=6 FT /note="ctaacaaatgtag, splice branch and acceptor" FT misc_feature complement(1146085..1146090) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1146292..1146537) FT /note="Match to PF00271 helicase_C, Helicases conserved C- FT terminal domain Score 125.47" FT misc_feature complement(1146652..1147275) FT /note="Match to PF00270 DEAD, DEAD/DEAH box helicase Score FT 212.02" FT misc_feature complement(1146835..1146861) FT /colour=8 FT /note="PS00039 DEAD-box subfamily ATP-dependent helicases FT s ignature" FT misc_feature complement(1147159..1147182) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A" FT LTR 1148110..1148466 FT /colour=4 FT /label=LTR FT /note="lone tf1 type LTR" FT CDS join(1149054..1149296,1149425..1149439) FT /colour=9 FT /gene="SPAC30D11.02c" FT /label=SPAC30D11.02c FT /note="SPAC30D11.02c, len:85" FT /product="very hypothetical protein" FT /fasta_file="fasta/c30D11.tab.seq.01887.out" FT misc_feature 1151277..1151377 FT /note="nominal overlap with SPAC56F8, EM:Z69728 S. pombe FT chromosome 1" FT misc_feature 1151277..1151377 FT /note="nominal overlap with cosmid SPAC30D11, EM:Z67961 S. FT pombe chromosome 1" FT misc_feature 1151280..1153088 FT /note="Match to PF01055 Glyco_hydro_31, Glycosyl FT hydrolases family 31 Score 977.93" FT CDS 1153843..1158396 FT /colour=10 FT /gene="SPAC56F8.02" FT /label=SPAC56F8.02 FT /note="SPAC56F8.02, len:1517, FT SIMILARITY:Schizosaccharomyces pombe, YA84_SCHPO, FT hypothetical 162.4 kD protein c22f3.04 in chromosome i., FT (1428 aa), fasta scores: opt: 1491, E():0, (30.0% identity FT in 1372 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT XXX; Pfam-B_17607; predicted integral membrane protein" FT CDS 1159224..1162463 FT /colour=7 FT /gene="SPAC56F8.03" FT /label=SPAC56F8.03 FT /note="SPAC56F8.03, len:1079, SIMILARITY:Saccharomyces FT cerevisiae, IF2P_YEAST, translation initiation factor if- FT 2., (1002 aa), fasta scores: opt: 3165, E():0, (52.8% FT identity in 1015 aa)" FT /product="putative translation initiation factor if-2; FT similar to S. cerevisiae FUN12" FT /fasta_file="fasta/c56F8.tab.seq.01618.out" FT misc_feature 1159764..1160444 FT /note="Match to PF00992 Troponin, Troponin Score 22.61" FT misc_feature 1160694..1160717 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A" FT CDS complement(1162902..1163978) FT /colour=2 FT /gene="coq2" FT /gene="ppt1" FT /gene="SPAC56F8.04c" FT /label=coq2 FT /note="SPAC56F8.04c, len:358, SIMILARITY:Saccharomyces FT cerevisiae, COQ2_YEAST, para-hydroxybenzoate-- FT polyprenyltransferase, mitochondrial (ec 2.5.1.-), (372 FT aa), fasta scores: opt: 909, E():0, (48.3% identity in 296 FT aa)" FT /product="para-hydroxybenzoate--polyprenyltransferase; FT coenzyme Q (ubiquinone) biosynthesis pathway; FT mitochondrial; diruption causes defects in ubiquinone FT production" FT /fasta_file="fasta/c56F8.tab.seq.01619.out" FT misc_feature complement(1162929..1163747) FT /note="Match to PF01040 COX10_ctaB_cyoE, Cytochrome c FT oxidase assembly factor Score 444.71" FT CDS complement(join(1164373..1164737,1164871..1165078, FT 1165193..1165360,1165405..1165452,1165608..1165646, FT 1165787..1165846)) FT /colour=10 FT /gene="SPAC56F8.05c" FT /label=SPAC56F8.05c FT /note="SPAC56F8.05c, len:295, N-terminal splicing FT uncertain, SIMILARITY:Saccharomyces cerevisiae, YIE1_YEAST, FT YIL041W, 36.7 kD protein in cbr5-not3 intergenic region., FT (326 aa), fasta scores: opt: 360, E():8.3e-15, (24.2% FT identity in 297 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YPR148C and YIL041W; possibly fungal specific" FT /fasta_file="fasta/c56F8.tab.seq.01620.out" FT misc_feature complement(1164738..1164752) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacctgtacgcag" FT misc_feature complement(1164865..1164870) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature complement(1165079..1165099) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaactatttgttaa atgcag" FT misc_feature complement(1165187..1165192) FT /colour=2 FT /note="splice donor sequence, gtaaga" FT misc_feature complement(1165361..1165378) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ttaacattttttcaa tag" FT misc_feature complement(1165602..1165607) FT /colour=2 FT /note="splice donor sequence, gtaaga" FT CDS complement(join(1166028..1166430,1166473..1167407)) FT /colour=7 FT /gene="SPAC56F8.06c" FT /label=SPAC56F8.06c FT /note="SPAC56F8.06c, len:445, SIMILARITY:Saccharomyces FT cerevisiae, DIE2_YEAST, die2 protein., (525 aa), fasta FT scores: opt: 605, E():6.9e-33, (32.7% identity in 511 aa)" FT /product="putative transcriptional activator; similar to FT S. cerevisiae DIE2" FT /fasta_file="fasta/c56F8.tab.seq.01621.out" FT misc_feature complement(1166431..1166441) FT /colour=2 FT /note="splice branch and acceptor sequence, ctaacgtttag" FT misc_feature complement(1166467..1166472) FT /colour=2 FT /note="splice donor sequence, gtacgt" FT CDS 1168242..1168793 FT /colour=9 FT /gene="SPAC56F8.07" FT /label=SPAC56F8.07 FT /product="very hypothetical protein" FT /fasta_file="fasta/c56F8.tab.seq.01622.out" FT misc_feature join(1168242..1168785,1168825..1169009,1169124..1169918) FT /colour=2 FT /fasta_file="fasta/c56F8.tab.seq.00039.out" FT /gene="ddi1" FT /gene="SPAC56F8.07" FT /label=ddi1 FT /note="SPAC56F8.08, len:332, possibly spliced upstream to FT SPAC56F8.11c, SIMILARITY:Saccharomyces oviformis, AAC18522, FT v-snare-master 1, (428 aa), fasta scores: opt: 678, FT E():0, (37.1% identity in 340 aa)" FT /product="putative v-snare binding protein; UBA domain; N FT terminal exon possibly incorrect" FT CDS join(1168806..1169009,1169124..1169918) FT /colour=2 FT /gene="ddi1" FT /gene="SPAC56F8.08" FT /label=ddi1 FT /note="SPAC56F8.08, len:332, possibly spliced upstream to FT SPAC56F8.11c, SIMILARITY:Saccharomyces oviformis, AAC18522, FT v-snare-master 1, (428 aa), fasta scores: opt: 678, FT E():0, (37.1% identity in 340 aa)" FT /product="putative v-snare binding protein; UBA domain; N FT terminal exon possibly incorrect" FT /fasta_file="fasta/c56F8.tab.seq.01623.out" FT misc_feature 1169010..1169015 FT /colour=2 FT /note="splice donor sequence, gtacgt" FT intron 1169010..1169123 FT /note="Intron confirmed by cDNA- Colin Gordon pers comm" FT misc_feature 1169109..1169123 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacatttttgtag" FT misc_feature 1169790..1169915 FT /note="Match to PF00627 UBA, UBA-domain Score 58.78" FT CDS 1170297..1171253 FT /colour=7 FT /gene="SPAC56F8.09" FT /label=SPAC56F8.09 FT /note="SPAC56F8.09, len:318, SIMILARITY:Homo sapiens, FT O43159, kiaa0409, (464 aa), fasta scores: opt: 464, FT E():3.6e-21, (37.7% identity in 316 aa)" FT /product="possibly involved in cleavage at site A2 in pre- FT rRNA; ribosomal RNA processing pathway; similar to S. FT cerevisiae RRP8" FT /fasta_file="fasta/c56F8.tab.seq.01624.out" FT LTR 1172295..1172641 FT /label=LTR FT /note="Tf1-type LTR" FT CDS 1172791..1174602 FT /EC_number="1.5.1.20" FT /colour=7 FT /gene="SPAC56F8.10" FT /label=SPAC56F8.10 FT /note="SPAC56F8.10, len:603, SIMILARITY:Saccharomyces FT cerevisiae, MTHS_YEAST, methylenetetrahydrofolate FT reductase 2, (599 aa), fasta scores: opt: 1850, E():0, FT (48.2% identity in 587 aa)" FT /product="putative methylenetetrahydrofolate reductase; FT similar to S. cerevisiae MET13" FT /fasta_file="fasta/c56F8.tab.seq.01625.out" FT CDS join(1175218..1175372,1175564..1175717,1175786..1176034) FT /colour=7 FT /gene="SPAC56F8.11" FT /label=SPAC56F8.11 FT /note="SPAC56F8.11, len:185, SIMILARITY:Gallus gallus, FT SPC2_CHICK, microsomal signal peptidase 23 kD subunit, FT (180 aa), fasta scores: opt: 299, E():1e-13, (32.6% FT identity in 178 aa)" FT /product="putative microsomal signal peptidase; similar to FT S. cerevisiae SPC3" FT /fasta_file="fasta/c56F8.tab.seq.01626.out" FT misc_feature 1175373..1175378 FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature 1175549..1175563 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ttaacactagtatag" FT misc_feature 1175718..1175723 FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature 1175772..1175785 FT /colour=2 FT /note="splice branch and acceptor sequence, ttaaccttttaaag" FT CDS 1176509..1177693 FT /colour=8 FT /gene="SPAC56F8.12" FT /label=SPAC56F8.12 FT /note="SPAC56F8.12, len:394" FT /product="hypothetical protein; sequence orphan; contains FT 7 predicted transmembrane helices" FT /fasta_file="fasta/c56F8.tab.seq.01627.out" FT LTR complement(1178287..1178470) FT /note="degraded Tf1-type LTR" FT misc_feature complement(1178494..1184398) FT /note="putative gene free region" FT CDS 1179587..1179892 FT /colour=9 FT /gene="SPAC56F8.13" FT /label=SPAC56F8.13 FT /note="SPAC56F8.13, len: 101, questionable orf" FT /product="very hypothetical protein" FT /fasta_file="fasta/c56F8.tab.seq.01628.out" FT CDS complement(1180531..1180926) FT /colour=8 FT /gene="SPAC56F8.14c" FT /label=SPAC56F8.14c FT /note="SPAC56F8.14c, len: 131, questionable orf" FT /product="hypothetical protein; sequence orphan; shows FT expression profile on microarray in otherwise apparntly FT gene free region; sequence orphan; perhaps cellular RNA?" FT /fasta_file="fasta/c56F8.tab.seq.01629.out" FT CDS 1181744..1182274 FT /colour=9 FT /gene="SPAC56F8.15" FT /label=SPAC56F8.15 FT /note="SPAC56F8.15, len: 176, questionable ORF" FT /product="very hypothetical protein" FT /fasta_file="fasta/c56F8.tab.seq.01630.out" FT CDS 1184409..1185650 FT /colour=2 FT /gene="esc1" FT /gene="SPAC56F8.16" FT /label=esc1 FT /note="SPAC56F8.16, len:413" FT /product="putative transcription factor; sexual FT differentiation protein; basic helix-loop-helix DNA- FT binding domain" FT /fasta_file="fasta/c56F8.tab.seq.01631.out" FT misc_feature 1185414..1185563 FT /note="Match to PF00010 HLH, Helix-loop-helix DNA-binding FT domain Score 75.30" FT misc_feature 1185516..1185563 FT /colour=8 FT /note="PS00038 Myc-type, 'helix-loop-helix' dimerization FT do main signature" FT misc_feature complement(1187776..1187826) FT /colour=8 FT /note="PS00743 Beta-lactamases class B signature 1" FT misc_feature complement(1188097..1188369) FT /colour=8 FT /note="PS00430 TonB-dependent receptor proteins signature FT 1" FT misc_feature 1188152..1188369 FT /note="nominal overlap with cosmid SPAC22A12, EM:Z99295 S. FT pombe chromosome 1" FT misc_feature 1188152..1188369 FT /note="nominal overlap with cosmid SPAC56F8, EM:Z69728 S. FT pombe chromosome 1" FT CDS complement(1189302..1189676) FT /colour=8 FT /fasta_file="fasta/c22A12.tab.seq.00036.out" FT /gene="SPAC22A12.02c" FT /label=SPAC22A12.02c FT /note="SPAC22A12.02c, len:124aa" FT /product="hypothetical protein; sequence orphan; has FT transcript profile on microarray" FT CDS complement(1189895..1191028) FT /colour=2 FT /fasta_file="fasta/c22A12.tab.seq.00020.out" FT /gene="csn4" FT /gene="SPAC22A12.03c" FT /label=csn4 FT /note="SPAC22A12.03c, len:377aa; similarity: some to C. FT int estinalis, P91586, COS41.8, (409aa), fasta scores, FT opt:240, E():1.6e-05, (23.3% identity in 258 aa overlap)" FT /product="COP9/signalosome complex subunit 4; PCI domain; FT no apparent S. cerevisiae ortholog" FT misc_feature complement(1189946..1190182) FT /note="Match to PF01399 PCI, PCI domain Score 88.36" FT CDS complement(1191920..1192312) FT /colour=2 FT /fasta_file="fasta/c22A12.tab.seq.00021.out" FT /gene="rps15a-1" FT /gene="rps22-1" FT /gene="SPAC22A12.04c" FT /label=rps15a-1 or rps22-1 FT /note="SPAC22A12.04c, len:130aa" FT /product="40S ribosomal protein S15A/S22A" FT misc_feature complement(1191923..1192300) FT /colour=9 FT /note="Pfam match to entry PF00410 S8, Ribosomal protein FT S8" FT misc_feature complement(1191962..1192015) FT /colour=8 FT /note="PS00053 Ribosomal protein S8 signature" FT promoter complement(1192383..1192390) FT /colour=4 FT /note="Homol D box" FT CDS 1192799..1193128 FT /EC_number="2.7.7.6" FT /colour=2 FT /fasta_file="fasta/c22A12.tab.seq.00022.out" FT /gene="rpc11" FT /gene="SPAC22A12.05" FT /label=rpc11 FT /note="SPAC22A12.05, len:109" FT /product="DNA-directed RNA polymerase III 12.5 kD subunit" FT CDS complement(1193612..1194901) FT /colour=7 FT /fasta_file="fasta/c22A12.tab.seq.00023.out" FT /gene="SPAC22A12.06c" FT /label=SPAC22A12.06c FT /note="SPAC22A12.06c, len:429, Low FT SIMILARITY:Schizosaccharomyces pombe, DYR_SCHPO, FT dihydrofolate reductase, (461 aa), fasta scores: opt: 438, FT E():3.6e-22, (23.3% identity in 455 aa)" FT /product="similar to S. pombe dihydrofolate reductase FT Dfr1p" FT CDS complement(1196498..1199179) FT /EC_number="2.4.1.109" FT /colour=7 FT /fasta_file="fasta/c22A12.tab.seq.00024.out" FT /gene="SPAC22A12.07c" FT /label=SPAC22A12.07c FT /note="SPAC22A12.07c, len:893aa, similarity: to YDL095W, FT PMT1_YEAST, P33775, dolichyl-phosphate-mannose--protein FT manno syltransferase 1, (817aa), fasta scores, opt:1505, FT E():0, ( 33.2% identity in 747 aa overlap)" FT /note="SPAC22A12.07c, len:893, SIMILARITY:Candida albicans, FT PMT1_CANAL, dolichyl-phosphate-mannose--protein FT mannosyltransferase 1(ec 2.4.1.109)., (877 aa), fasta FT scores: opt: 1558, E():0, (33.9% identity in 832 aa)" FT /product="putative dolichyl-phosphate-mannose--protein FT mannosyltransferase; similar to S. cerevisiae PMT1" FT CDS complement(join(1199872..1200137,1200180..1200946, FT 1201038..1201532,1201576..1201632,1201675..1201802)) FT /colour=7 FT /fasta_file="fasta/c22A12.tab.seq.00025.out" FT /gene="SPAC22A12.08c" FT /label=SPAC22A12.08c FT /note="SPAC22A12.08c, len:570, SIMILARITY to N-terminalof FT :Saccharomyces cerevisiae, YK50_YEAST, hypothetical 39.4 FT kD protein in met1-sis2 intergenic region., (352 aa), FT fasta scores: opt: 627, E():0, (37.4% identity in 358 aa)" FT /product="CDP-alcohol phosphatidyltransferase" FT misc_feature complement(join(1199884..1200137,1200180..1200342)) FT /note="Match to PF01066 CDP-OH_P_transf, CDP-alcohol FT phosphatidyltransferase Score 138.96" FT misc_feature complement(1200138..1200151) FT /colour=6 FT /note="ctaaccttatctag, splice branch and acceptor" FT misc_feature complement(1200174..1200179) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature complement(1200947..1200962) FT /colour=6 FT /note="ctaacagcttttatag, splice branch and acceptor" FT misc_feature complement(1201032..1201037) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1201533..1201544) FT /colour=6 FT /note="ctaacttgtaag, splice branch and acceptor" FT misc_feature complement(1201570..1201575) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature complement(1201633..1201642) FT /colour=6 FT /note="ctaaccaaag, splice branch and acceptor" FT misc_feature complement(1201669..1201674) FT /colour=6 FT /note="gtaata, splice donor sequence" FT CDS complement(join(1202146..1202465,1202509..1202883, FT 1202969..1203285,1203349..1203655,1203705..1203831)) FT /colour=2 FT /fasta_file="fasta/c22A12.tab.seq.00026.out" FT /gene="sap114" FT /gene="SPAC22A12.09c" FT /label=sap114 FT /note="SPAC22A12.09c, len:481, SIMILARITY:Caenorhabditis FT elegans., Q10577, pre-mRNA splicing factor prp21., (655 FT aa), fasta scores: opt: 636, E():7.5e-28, (30.9% identity FT in 482 aa)" FT /product="pre-mRNA splicing factor" FT misc_feature complement(1202466..1202479) FT /colour=6 FT /note="ctgaccctgtttag, splice branch and acceptor" FT misc_feature complement(1202503..1202508) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1202884..1202897) FT /colour=6 FT /note="ctaacttgtcttag, splice branch and acceptor" FT misc_feature complement(1202963..1202968) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1203286..1203305) FT /colour=6 FT /note="ctaattaaccgtgaatctag, splice branch and acceptor" FT misc_feature complement(1203343..1203348) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1203656..1203669) FT /colour=6 FT /note="ctaacgtagcttag, splice branch and acceptor" FT misc_feature complement(1203699..1203704) FT /colour=6 FT /note="gtgagt, splice donor sequence" FT CDS join(1204247..1204383,1204434..1205457) FT /EC_number="2.7.8.1" FT /colour=7 FT /fasta_file="fasta/c22A12.tab.seq.00027.out" FT /gene="SPAC22A12.10" FT /label=SPAC22A12.10 FT /note="SPAC22A12.10, len:386aa; similarity: to YHR123W, FT EPT1_YEAST, P22140, ethanolaminephosphotransferase, FT (391aa), fasta scores, opt:757, E():0, (35.8% identity in FT 386 aa overlap)" FT /product="putative aminoalcoholphosphotransferase; FT phosphatidylethanolamine biosynthesis; similar to S. FT cerevisiae EPT1" FT misc_feature 1204384..1204389 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 1204418..1204433 FT /colour=6 FT /note="ctaactctttacttag, splice branch and acceptor" FT misc_feature 1204591..1204659 FT /colour=8 FT /note="PS00379 CDP-alcohol phosphatidyltransferases FT signatu re" FT CDS 1206741..1208483 FT /EC_number="2.7.1.29" FT /colour=2 FT /fasta_file="fasta/c22A12.tab.seq.00028.out" FT /gene="dak1" FT /gene="SPAC22A12.11" FT /label=dak1 FT /note="SPAC22A12.11, len:580" FT /product="dihydroxyacetone kinase; isoenzyme I; FT subcellular localization of GFP fusion- Cytoplasmic dots FT and lines" FT CDS complement(1208885..1209607) FT /colour=7 FT /fasta_file="fasta/c22A12.tab.seq.00029.out" FT /gene="SPAC22A12.12c" FT /label=SPAC22A12.12c FT /note="SPAC22A12.12c, len:240, SIMILARITY:Saccharomyces FT cerevisiae, Q08285, chromosome xv reading frame orf FT yol142w, (240 aa), fasta scores: opt: 517, E():4.4e-28, FT (36.9% identity in 236 aa)" FT /product="putative exosome 3'-5' exonuclease complex; FT possibly involved in rRNA processing; similar to S. FT cerevisiae RRP40" FT CDS 1210155..1210517 FT /colour=10 FT /fasta_file="fasta/c22A12.tab.seq.00030.out" FT /gene="SPAC22A12.13" FT /label=SPAC22A12.13 FT /note="SPAC22A12.13, len:157aa" FT /product="human downs syndrome critical region-like; no FT apparent S. cerevisiae ortholog" FT CDS complement(join(1210905..1211798,1211843..1211893, FT 1211949..1212047)) FT /colour=10 FT /fasta_file="fasta/c22A12.tab.seq.00031.out" FT /gene="SPAC22A12.14c" FT /label=SPAC22A12.14c FT /note="SPAC22A12.14c, len:347" FT /product="conserved protein; similar to S. cerevisiae DOS2" FT misc_feature complement(1211799..1211812) FT /colour=6 FT /note="ctaaccgttcaaag, splice branch and acceptor" FT misc_feature complement(1211837..1211842) FT /colour=6 FT /note="gtgtgt, splice donor sequence" FT misc_feature complement(1211894..1211909) FT /colour=6 FT /note="ctgacattttatacag, splice branch and acceptor" FT misc_feature complement(1211943..1211948) FT /colour=6 FT /note="gtaatt, splice donor sequence" FT CDS complement(1212988..1214979) FT /colour=2 FT /fasta_file="fasta/c22A12.tab.seq.00032.out" FT /function="role in assembly of multimeric complexes inside FT the ER" FT /gene="bip1" FT /gene="bip" FT /gene="SPAC22A12.15c" FT /label=bip1 FT /note="SPAC22A12.15c, len:663aa" FT /product="78 kD glucose regulated protein homolog ; heat FT shock protein hsp70 family; involved in assembly of FT multimeric complexes in the ER" FT misc_feature complement(1213054..1214871) FT /colour=9 FT /note="Pfam match to entry PF00012 HSP70, Heat shock hsp70 FT proteins" FT CDS join(1215990..1216013,1216073..1217527) FT /EC_number="4.1.3.8" FT /colour=7 FT /fasta_file="fasta/c22A12.tab.seq.00033.out" FT /gene="SPAC22A12.16" FT /label=SPAC22A12.16 FT /note="SPAC22A12.16, len:492, SIMILARITY:Caenorhabditis FT elegans., P90731, b0365.1 protein., (1099 aa), fasta FT scores: opt: 810, E():0, (49.6% identity in 423 aa)" FT /product="putative ATP-citrate (pro-S-) lyase (EC FT 4.1.3.8); no apparent S. cerevisiae ortholog" FT misc_feature 1216014..1216019 FT /colour=6 FT /note="gtataa, splice donor sequence" FT intron 1216014..1216072 FT /colour=2 FT /note="confirmed intron" FT misc_feature 1216059..1216072 FT /colour=6 FT /note="ctaacggcatttag, splice branch and acceptor" FT CDS complement(1218001..1218786) FT /colour=7 FT /fasta_file="fasta/c22A12.tab.seq.00034.out" FT /gene="SPAC22A12.17c" FT /label=SPAC22A12.17c FT /note="SPAC22A12.17c, len:261, FT SIMILARITY:Schizosaccharomyces pombe, O74470, short chain FT dehydrogenase., (261 aa), fasta scores: opt: 855, E():0, FT (50.6% identity in 261 aa)" FT /product="short chain dehydrogenase; putative sorbitol FT utilization; no apparent S. cerevisiae ortholog" FT misc_feature complement(1218025..1218117) FT /colour=9 FT /note="Pfam match to entry PF00678 adh_short_C2, Short FT chai n dehydrogenase/reductase C-terminus" FT misc_feature complement(1218166..1218723) FT /colour=9 FT /note="Pfam match to entry PF00106 adh_short, FT Alcohol/other dehydrogenases, short chain type" FT misc_feature 1220845..1220965 FT /note="nominal overlap with cosmid SPAC4C5, EM:Z98560 FT S.pombe chromosome 1" FT misc_feature 1220845..1220965 FT /note="nominal overlap with cosmid SPAC22A12, EM:Z99295 FT S.pombe chromosome 1" FT CDS join(1222221..1222268,1222338..1222380,1222455..1222517, FT 1222592..1222686,1222738..1222851,1222912..1223289) FT /colour=7 FT /gene="SPAC4C5.01" FT /label=SPAC4C5.01 FT /note="SPAC4C5.01, len:246, SIMILARITY:Schizosaccharomyces FT pombe, O59760, hypothetical 26.5 kD protein., (236 aa), FT fasta scores: opt: 734, E():0, (45.3% identity in 232 aa)" FT /product="putative haloacid dehalogenase" FT /fasta_file="fasta/c4C5.tab.seq.01914.out" FT misc_feature 1222242..1222838 FT /colour=9 FT /note="Pfam match to entry PF00702 Hydrolase, haloacid FT dehalogenase-like hydrolase, score 75.90, E-value 8.3e-19" FT misc_feature 1222269..1222274 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1222316..1222337 FT /colour=6 FT /note="ttaacaatcactctttttacag, splice branch and acceptor" FT misc_feature 1222381..1222386 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1222433..1222454 FT /colour=6 FT /note="ctaatctttattttttttatag, splice branch and acceptor" FT misc_feature 1222518..1222523 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1222574..1222591 FT /colour=6 FT /note="ctaacttgcgatacgtag, splice branch and acceptor" FT misc_feature 1222687..1222692 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 1222723..1222737 FT /colour=6 FT /note="ctaactttctgaaag, splice branch and acceptor" FT misc_feature 1222852..1222857 FT /colour=6 FT /note="gtgtgc, splice donor sequence" FT misc_feature 1222886..1222911 FT /colour=6 FT /note="ctaataccgcaaattataatatgaag, splice branch and FT accept or" FT CDS complement(join(1223873..1224083,1224196..1224307, FT 1224387..1224546,1224590..1224712)) FT /colour=2 FT /gene="ryh1" FT /gene="hos1" FT /gene="SPAC4C5.02c" FT /label=ryh1 FT /note="SPAC4C5.02c, len:201" FT /product="GTP-binding protein; golgi rab protein; similar FT to S. cerevisiae YPT6 - necessary for osmotic stress FT response" FT /fasta_file="fasta/c4C5.tab.seq.01915.out" FT misc_feature complement(join(1223876..1224083,1224196..1224307, FT 1224387..1224554,1224586..1224676)) FT /note="Match to PF00071 ras, Ras family Score 230.40" FT misc_feature complement(1224084..1224098) FT /colour=6 FT /note="ctaacggtggtttag, splice branch and acceptor" FT misc_feature complement(1224190..1224195) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(1224308..1224321) FT /colour=6 FT /note="ctaactacttatag, splice branch and acceptor" FT misc_feature complement(1224381..1224386) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1224547..1224561) FT /colour=6 FT /note="ctaacagggtccaag, splice branch and acceptor" FT misc_feature complement(1224584..1224589) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1224638..1224661) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT tRNA complement(1225268..1225339) FT /note="tRNA Ala anticodon TGC, Cove score 68.49" FT CDS 1226671..1227579 FT /colour=8 FT /gene="SPAC4C5.03" FT /label=SPAC4C5.03 FT /note="SPAC4C5.03, len:302aa" FT /product="hypothetical protein; sequence orphan; contains FT 7 predicted transmembrane helices" FT /fasta_file="fasta/c4C5.tab.seq.01916.out" FT CDS join(1228135..1228217,1228268..1228696,1228750..1228895, FT 1228974..1229073,1229130..1229295) FT /colour=2 FT /gene="rad31" FT /gene="uba4" FT /gene="SPAC4C5.04" FT /label=rad31 FT /note="SPAC4C5.04, len:307" FT /product="DNA damage tolerance protein; ubiquitin FT activating enzyme" FT /fasta_file="fasta/c4C5.tab.seq.01917.out" FT misc_feature 1228218..1228223 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1228253..1228267 FT /colour=6 FT /note="ctgacaaaattatag, splice branch and acceptor" FT misc_feature 1228272..1228679 FT /note="Match to PF00899 ThiF_family, ThiF family Score FT 153.39" FT misc_feature 1228697..1228702 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1228737..1228749 FT /colour=6 FT /note="cttacatttttag, splice branch and acceptor" FT misc_feature 1229074..1229079 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1229116..1229129 FT /colour=6 FT /note="ctaattttatttag, splice branch and acceptor" FT snRNA 1229844..1229929 FT /gene="Sp-snR41-sno" FT /note="putative snoRNA Sp-snR41, complements Sp-18S-rRNA FT and modifies Gm1142. Yeast snR41 homolog" FT snRNA 1230070..1230177 FT /gene="Sp-snR70-sno" FT /note="putative snoRNA Sp-snR70, complements: Sp-18S-rRNA FT and modifies Cm1680. Yeast snR70 homolog" FT snRNA 1230322..1230405 FT /gene="Sp-snR51b-sno" FT /note="putative snoRNA Sp-snR51b, complements: Sp-25S-rRNA FT and modifies Um2823. Yeast snR51 homolog" FT misc_feature complement(1230810..1232492) FT /note="Match to PF01077 NIR_SIR, Nitrite and sulphite FT reductase Score 713.97" FT misc_feature 1232911..1236344 FT /note="nominal overlap with cosmid SPAC10F6, EM:AL009197 FT S.pombe chromosome 1 (NB true overlap with cosmid c10F6 is FT 23900bp)" FT misc_feature 1232911..1236344 FT /note="nominal overlap with cosmid SPAC4C5, EM:Z99295 S. FT pombe chromosome 1" FT CDS complement(join(1236601..1240034,1240088..1240160)) FT /colour=2 FT /gene="prp22" FT /gene="SPAC10F6.02c" FT /label=prp22 FT /note="SPAC10F6.02c, len:1168, SIMILARITY:Homo sapiens, FT DDX8_HUMAN, putative ATP-dependent RNA helicase hrh1, FT (1220 aa), fasta scores: opt: 3835, E():0, (52.6% identity FT in 1210 aa)" FT /product="putative pre-mRNA splicing factor; ATP-dependent FT RNA helicase; similar to S. cerevisiae PRP22" FT /fasta_file="fasta/c10F6.tab.seq.00488.out" FT misc_feature complement(1238203..1238232) FT /colour=8 FT /note="PS00690 DEAH-box subfamily ATP-dependent helicases FT s ignature" FT misc_feature complement(1238488..1238511) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature complement(1239268..1239483) FT /note="Match to PF00575 S1, S1 RNA-binding domain Score FT 49.26" FT misc_feature complement(1240035..1240048) FT /colour=6 FT /note="ttaaccaaatctag, splice branch and acceptor" FT misc_feature complement(1240082..1240087) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS complement(join(1241122..1241660,1241881..1243144)) FT /EC_number="6.3.4.2" FT /colour=7 FT /gene="SPAC10F6.03c" FT /label=SPAC10F6.03c FT /note="SPAC10F6.03c, len:600, SIMILARITY:Saccharomyces FT cerevisiae, PYRG_YEAST, ctp synthase 1, (579 aa), fasta FT scores: opt: 2652, E():0, (66.5% identity in 579 aa)" FT /product="putative CTP synthase" FT /fasta_file="fasta/c10F6.tab.seq.00489.out" FT misc_feature complement(1241661..1241673) FT /colour=6 FT /note="ctaacatttctag, splice branch and acceptor" FT misc_feature complement(1241875..1241880) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1241918..1241953) FT /colour=8 FT /note="PS00442 Glutamine amidotransferases class-I active FT s ite" FT CDS 1243402..1244457 FT /colour=7 FT /gene="SPAC10F6.04" FT /label=SPAC10F6.04 FT /note="SPAC10F6.04, len:351, SIMILARITY:Saccharomyces FT cerevisiae, ATS1_YEAST, ats1 protein, (333 aa), fasta FT scores: opt: 245, E():1.3e-09, (27.9% identity in 359 aa)" FT /product="putative alpha-tubulin supressor" FT /fasta_file="fasta/c10F6.tab.seq.00490.out" FT misc_feature 1243405..1243545 FT /colour=9 FT /note="Pfam match to entry PF00415 RCC1, Regulator of FT chromosome condensation (RCC1)," FT misc_feature 1243888..1243935 FT /colour=9 FT /note="Pfam match to entry PF00415 RCC1, Regulator of FT chromosome condensation (RCC1)," FT misc_feature 1244179..1244205 FT /colour=9 FT /note="Pfam match to entry PF00415 RCC1, Regulator of FT chromosome condensation (RCC1)," FT CDS complement(join(1244797..1245314,1245399..1245537, FT 1245578..1245604)) FT /EC_number="6.3.2.19" FT /colour=2 FT /gene="ubc6" FT /gene="SPAC10F6.05c" FT /label=ubc6 FT /note="SPAC10F6.05c, len:227, SIMILARITY:Saccharomyces FT cerevisiae, UBC6_YEAST, ubiquitin-conjugating enzyme e2- FT 28.4 kD, (250 aa), fasta scores: opt: 740, E():0, (61.1% FT identity in 167 aa)" FT /product="putative ubiquitin-conjugating enzyme (EC FT 6.3.2.19)" FT /fasta_file="fasta/c10F6.tab.seq.00491.out" FT misc_feature complement(join(1245052..1245314,1245399..1245537)) FT /note="Match to PF00179 UQ_con, Ubiquitin-conjugating FT enzyme Score 35.97" FT misc_feature complement(1245315..1245330) FT /colour=6 FT /note="ctaactttgcgtacag, splice branch and acceptor" FT intron complement(1245315..1245398) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1245393..1245398) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1245538..1245550) FT /colour=6 FT /note="ctaattattttag, splice branch and acceptor" FT misc_feature complement(1245572..1245577) FT /colour=6 FT /note="gtatgg, splice donor sequence" FT CDS 1246847..1247620 FT /colour=2 FT /gene="vip1" FT /gene="SPAC10F6.06" FT /label=vip1 FT /note="SPAC10F6.06, len:257" FT /product="vip1 protein" FT /fasta_file="fasta/c10F6.tab.seq.00492.out" FT misc_feature 1246859..1247059 FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 36.30" FT CDS complement(1247997..1248563) FT /colour=8 FT /gene="SPAC10F6.07c" FT /label=SPAC10F6.07c FT /note="SPAC10F6.07c, len:188," FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c10F6.tab.seq.00493.out" FT CDS complement(join(1249343..1250116,1250171..1250379, FT 1250431..1250473)) FT /colour=8 FT /gene="SPAC10F6.08c" FT /label=SPAC10F6.08c FT /note="SPAC10F6.08c, len:341," FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c10F6.tab.seq.00494.out" FT misc_feature complement(1250117..1250130) FT /colour=6 FT /note="ctaatcatatgtag, splice branch and acceptor" FT misc_feature complement(1250165..1250170) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1250380..1250394) FT /colour=6 FT /note="ctaatgaatactcag, splice branch and acceptor" FT misc_feature complement(1250425..1250430) FT /colour=6 FT /note="gtgaat, splice donor sequence" FT CDS complement(join(1250885..1254454,1254498..1254512)) FT /colour=2 FT /gene="smc3" FT /gene="psm1" FT /gene="SPAC10F6.09c" FT /label=smc3 FT /note="SPAC10F6.09c, len:1194, SIMILARITY:Arabidopsis FT thaliana, AAD22500, putative chromosome-associated FT polypeptide, 5' partial., (1192 aa), fasta scores: opt: FT 2671, E():0, (38.7% identity in 1204 aa)" FT /product="cohesin subunit; coiled-coil protein; SMC FT family; involved in sister chromatid cohesion; smc1 FT dimerization partner; similar to S. cerevisiae SMC3" FT /fasta_file="fasta/c10F6.tab.seq.00495.out" FT misc_feature complement(1254455..1254471) FT /colour=6 FT /note="ttaactgatttattaag, splice branch and acceptor" FT misc_feature complement(1254492..1254497) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS join(1255275..1255401,1255487..1255612,1255643..1256955) FT /colour=7 FT /gene="SPAC10F6.10" FT /label=SPAC10F6.10 FT /note="SPAC10F6.10, len:521, SIMILARITY:Emericella FT nidulans, O13330, extragenic suppressor of the bimd6 FT mutation., (558 aa), fasta scores: opt: 1271, E():0, FT (45.0% identity in 533 aa)" FT /product=" similar to Aspergillus nidulans SUDD suppressor FT of bimD6 chromosome-spindle attachment defect" FT /fasta_file="fasta/c10F6.tab.seq.00496.out" FT misc_feature 1255402..1255407 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1255468..1255486 FT /colour=6 FT /note="ttaataacatttttactag, splice branch and acceptor" FT misc_feature 1255613..1255618 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1255629..1255642 FT /colour=6 FT /note="ttaactgctcatag, splice branch and acceptor" FT misc_feature 1255858..1256412 FT /note="Match to PF01163 RIO1, RIO1/ZK632.3/MJ0444 family FT Score 288.62" FT misc_feature 1256203..1256238 FT /colour=8 FT /note="PS00436 Peroxidases active site signature" FT misc_feature 1256242..1256280 FT /colour=8 FT /note="PS00109 Tyrosine protein kinases specific active- FT sit e signature" FT CDS complement(1257092..1258537) FT /colour=10 FT /gene="SPAC10F6.11c" FT /label=SPAC10F6.11c FT /note="SPAC10F6.11c, len:481," FT /product="hypothetical protein; similar to S. cerevisiae FT APG17; Pfam-B_36869; predicted coiled-coil" FT /fasta_file="fasta/c10F6.tab.seq.00497.out" FT CDS complement(1259036..1259746) FT /EC_number="2.1.1.100" FT /colour=2 FT /gene="mam4" FT /gene="SPAC10F6.12c" FT /label=mam4 FT /note="SPAC10F6.12c, len:236" FT /product="protein-s isoprenylcysteine o-methyltransferase FT (EC 2.1.1.100)" FT /fasta_file="fasta/c10F6.tab.seq.00498.out" FT CDS complement(1260464..1261693) FT /EC_number="2.6.1.1" FT /colour=7 FT /gene="SPAC10F6.13c" FT /label=SPAC10F6.13c FT /note="SPAC10F6.13c, len:409, SIMILARITY:Saccharomyces FT cerevisiae, AATC_YEAST, aspartate aminotransferase, FT cytoplasmic, (417 aa), fasta scores: opt: 1419, E():0, FT (50.2% identity in 408 aa)" FT /product="aspartate aminotransferase" FT /fasta_file="fasta/c10F6.tab.seq.00499.out" FT misc_feature complement(1260491..1261678) FT /note="Match to PF00155 aminotran_1, Aminotransferases FT class-I Score 446.57" FT CDS complement(1261992..1263599) FT /colour=10 FT /gene="SPAC10F6.14c" FT /label=SPAC10F6.14c FT /note="SPAC10F6.14c, len:535, SIMILARITY:Caenorhabditis FT elegans., O17735, d2023.6 protein., (512 aa), fasta FT scores: opt: 591, E():2.1e-30, (27.5% identity in 447 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YLR253W" FT /fasta_file="fasta/c10F6.tab.seq.00500.out" FT misc_RNA 1264381..1264513 FT /note="mRNA from spc10292, not associated with an ORF; FT putative sno?" FT snRNA 1264639..1264721 FT /gene="Sp-Z16-sno" FT /note="S. pombe Z16 small nucleolar RNA gene (em: FT AJ010685), ; complements: Sp-25S-rRNA and modifies Um2504 FT and Am2367. Yeast snR66 and snR13 homolog" FT CDS 1265343..1266641 FT /colour=12 FT /gene="B8647-4" FT /gene="SPAC10F6.15" FT /label=B8647-4 FT /note="SPAC10F6.15, len:432, FT SIMILARITY:Schizosaccharomyces pombe, O13699, hypothetical FT 50.4 kD protein c11g7.06c in chromosome i., (430 aa), FT fasta scores: opt: 508, E():1e-26, (28.1% identity in 377 FT aa)" FT /product="Pfam-B_8647 domain; possibly S. pombe specific" FT /fasta_file="fasta/c10F6.tab.seq.00501.out" FT CDS join(1268572..1268655,1268701..1268784,1268849..1269100) FT /colour=7 FT /gene="SPAC10F6.16" FT /label=SPAC10F6.16 FT /note="SPAC10F6.16, len:139, SIMILARITY:Saccharomyces FT cerevisiae, YNP7_YEAST, hypothetical 18.1 kD protein in FT ygp1-yck2 intergenic region., (168 aa), fasta scores: opt: FT 216, E():2.8e-07, (33.1% identity in 142 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YHR132W-A and YNL157W; weak similarity to human ENSA alpha- FT endosulfine and human ARPP-19 cAMP-regulated FT phosphoprotein" FT /fasta_file="fasta/c10F6.tab.seq.00502.out" FT misc_feature 1268656..1268661 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1268688..1268700 FT /colour=6 FT /note="ttaactgaaatag, splice branch and acceptor" FT misc_feature 1268785..1268790 FT /colour=6 FT /note="gtatgg, splice donor sequence" FT misc_feature 1268829..1268848 FT /colour=6 FT /note="ctaactctacccctttttag, splice branch and acceptor" FT misc_feature complement(1270222..1270245) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature complement(1270246..1270728) FT /colour=9 FT /note="Pfam match to entry PF00481 PP2C, protein FT phosphatase 2C," FT misc_feature complement(1270906..1271049) FT /colour=9 FT /note="Pfam match to entry PF00481 PP2C, protein FT phosphatase 2C," FT misc_feature 1270996..1271049 FT /note="nominal overlap with cosmid SPAC56E4, EM:AL009197 FT S. pombe chromosome 1" FT misc_feature 1270996..1271049 FT /note="nominal overlap with cosmid SPAC10F6, EM:AL009197 FT S.pombe chromosome 1" FT CDS complement(1271971..1272459) FT /colour=10 FT /gene="SPAC56E4.02c" FT /label=SPAC56E4.02c FT /note="SPAC56E4.02c, len:162, SIMILARITY:Arabidopsis FT thaliana, O23514, hypothetical 19.6 kD protein., (176 aa), FT fasta scores: opt: 324, E():8.5e-15, (38.2% identity in FT 157 aa)" FT /product="conserved protein" FT /fasta_file="fasta/c56E4.tab.seq.01742.out" FT CDS 1273727..1275151 FT /colour=7 FT /gene="SPAC56E4.03" FT /label=SPAC56E4.03 FT /note="SPAC56E4.03, len:474, FT SIMILARITY:Schizosaccharomyces pombe, CAB42068, putative FT aminotransferase, SPCC569.07, (470 aa), fasta scores: opt: FT 1603, E():0, (49.8% identity in 474 aa)" FT /product="putative aminotransferase" FT /fasta_file="fasta/c56E4.tab.seq.01743.out" FT misc_feature 1274078..1274098 FT /colour=8 FT /note="PS00092 N-6 Adenine-specific DNA methylases FT signatur e" FT CDS complement(join(1275771..1282483,1283106..1283235)) FT /EC_number="6.3.4.14" FT /blastp_file="blastp/c56E4.tab.seq.00001.out" FT /colour=2 FT /gene="cut6" FT /gene="SPAC56E4.04c" FT /label=cut6 FT /note="SPAC56E4.04c, len:2280" FT /product="acetyl-coa carboxylase; involved in chromosome FT segregation; similar to S. cerevisiae ACC1" FT /fasta_file="fasta/c56E4.tab.seq.01744.out" FT misc_feature complement(1276092..1277816) FT /note="Match to PF01039 Carboxyl_trans, Carboxyl FT transferase domain Score 1128.51" FT misc_feature complement(1278237..1278290) FT /colour=8 FT /note="PS00216 Sugar transport proteins signature 1" FT misc_feature complement(1280283..1280483) FT /note="Match to PF00364 biotin_lipoyl, Biotin-requiring FT enzymes Score 93.93" FT misc_feature complement(1280358..1280411) FT /colour=8 FT /note="PS00188 Biotin-requiring enzymes attachment site" FT misc_feature complement(1280895..1282403) FT /note="Match to PF00289 CPSase_L_chain, Carbamoyl- FT phosphate synthase (CPSase) Score 754.09" FT misc_feature complement(1281432..1281455) FT /colour=8 FT /note="PS00867 Carbamoyl-phosphate synthase subdomain FT signa ture 2" FT misc_feature complement(1281801..1281845) FT /colour=8 FT /note="PS00866 Carbamoyl-phosphate synthase subdomain FT signa ture 1" FT CDS join(1285267..1285629,1285688..1285903) FT /colour=10 FT /gene="SPAC56E4.05" FT /label=SPAC56E4.05 FT /note="SPAC56E4.05, len:192, NOTE:may not be spliced, FT SIMILARITY:Arabidopsis thaliana, O82222, t29e15.14 FT protein., (173 aa), fasta scores: opt: 184, E():0.00018, FT (24.8% identity in 141 aa)" FT /product="hypothetical protein; similar to A. thaliana FT T29E15.14 and T4G30500, and mouse Q9CR96 (low, by multiple FT alignment)" FT /fasta_file="fasta/c56E4.tab.seq.01745.out" FT misc_feature 1285630..1285635 FT /colour=6 FT /note="gtacgc, splice donor sequence" FT misc_feature 1285672..1285687 FT /colour=6 FT /note="ctaacccttcatctag, splice branch and acceptor" FT CDS complement(1286242..1288077) FT /colour=7 FT /gene="SPAC56E4.06c" FT /label=SPAC56E4.06c FT /note="SPAC56E4.06c, len:611, SIMILARITY:Sus scrofa, FT GGT_PIG, gamma-glutamyltranspeptidase , (568 aa), fasta FT scores: opt: 1275, E():0, (38.4% identity in 578 aa)" FT /product="gamma-glutamyltranspeptidase" FT /fasta_file="fasta/c56E4.tab.seq.01746.out" FT misc_feature complement(1286257..1287792) FT /colour=9 FT /note="Pfam match to entry PF01019 G_glu_transpept, Gamma- FT g lutamyltranspeptidase" FT CDS 1289041..1289748 FT /colour=8 FT /gene="SPAC56E4.07" FT /label=SPAC56E4.07 FT /note="SPAC56E4.07, len:235" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c56E4.tab.seq.01747.out" FT misc_feature 1291156..1291785 FT /note="nominal overlap with cosmid SPAC1420, EM:AL121732 FT S. pombe chromosome 1" FT misc_feature 1291156..1291785 FT /note="nominal overlap with cosmid SPAC56E4, EM:Z99261 S. FT pombe chromosome 1" FT misc_feature complement(1292286..1292304) FT /colour=6 FT /note="ttaactcttttttttctag, splice branch and acceptor" FT intron complement(1292286..1292330) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1292325..1292330) FT /colour=6 FT /note="gtaatg, splice donor sequence" FT CDS complement(1293578..1295218) FT /colour=2 FT /gene="cct5" FT /gene="SPAC1420.02c" FT /label=cct5 FT /note="SPAC1420.02c, len:546, SIMILARITY:Homo sapiens, FT TCPE_HUMAN, t-complex protein 1, epsilon subunit, (541 aa), FT fasta scores: opt: 2569, E():0, (68.5% identity in 543 FT aa)" FT /product="t-complex protein 1, epsilon subunit" FT /fasta_file="fasta/c1420.tab.seq.00386.out" FT misc_feature complement(1293602..1295083) FT /note="Match to PF00118 cpn60_TCP1, TCP-1/cpn60 chaperonin FT family Score 694.08" FT misc_feature complement(1293989..1294885) FT /colour=3 FT /note="spliced mRNA that does not correspond to ORF" FT misc_feature complement(1294130..1294533) FT /colour=2 FT /note="confirmed intron - but ends in GAG?" FT LTR complement(1295485..1295842) FT /note="TF1 LTR" FT CDS join(1295945..1296028,1296076..1297323) FT /colour=2 FT /gene="rpn5-a" FT /gene="SPAC1420.03" FT /label=rpn5-a FT /note="SPAC1420.03, len:443, SIMILARITY:Homo sapiens, FT O00232, proteasome subunit p55., (456 aa), fasta scores: FT opt: 1248, E():0, (43.9% identity in 446 aa)" FT /product="19S proteasome regulatory subunit; Non-ATPase FT subunit; similar to S. cerevisiae RPN5; contains PCI FT domain; duplicated in S. pombe see rpn5-b" FT /fasta_file="fasta/c1420.tab.seq.00387.out" FT misc_feature 1296029..1296034 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 1296059..1296075 FT /colour=6 FT /note="ctaacttgtaattgtag, splice branch and acceptor" FT misc_feature 1296985..1297221 FT /note="Match to PF01399 PCI, PCI domain Score 62.06" FT misc_feature 1299560..1299669 FT /note="nominal overlap with pB17E12 S. pombe chromosome 1" FT misc_feature 1299560..1299669 FT /note="nominal overlap with SPAC1420 S. pombe chromosome 1" FT CDS join(1300426..1300592,1300698..1301046,1301121..1301312) FT /colour=2 FT /gene="yip1-b" FT /gene="SPAPB17E12.02" FT /product="structural similarity with SMN protein; yip1p; FT putative smn1/yab8 interacting protein; based on 2 hybrid FT data and similar to human SIP1; possibly involved in FT spliceosomal snRNP biogenesis; no apparent S. cerevisiae FT ortholog" FT /fasta_file="fasta/pB17E12.tab.seq.00034.out" FT misc_feature 1300593..1300598 FT /note="gtacga, splice donor sequence" FT /colour=6 FT misc_feature 1300685..1300697 FT /note="ctgacaagttcag, splice branch and acceptor" FT /colour=6 FT misc_feature 1301047..1301052 FT /note="gttggt, splice donor sequence" FT /colour=6 FT misc_feature 1301106..1301120 FT /note="ctaacatttttctag, splice branch and acceptor" FT /colour=6 FT CDS join(1301565..1301648,1301691..1302062,1302159..1302638) FT /colour=7 FT /gene="SPAPB17E12.03" FT /label=SPAPB17E12.03 FT /note="pB17E12.cand.2 score = 15.17" FT /product="putative peroxisomal biogenesis protein; similar FT to S. cerevisiae PEX12" FT /fasta_file="fasta/pB17E12.tab.seq.00035.out" FT misc_feature 1301649..1301654 FT /note="gtaagt, splice donor sequence" FT /colour=6 FT misc_feature 1301677..1301690 FT /note="ttaatctctttcag, splice branch and acceptor" FT /colour=6 FT misc_feature 1302063..1302068 FT /note="gtattt, splice donor sequence" FT /colour=6 FT misc_feature 1302142..1302158 FT /note="ctaatacctacttacag, splice branch and acceptor" FT /colour=6 FT CDS complement(join(1302701..1303753,1303807..1303867, FT 1303907..1303988,1304029..1304123,1304166..1304188)) FT /colour=2 FT /gene="csn2" FT /gene="SPAPB17E12.04c" FT /label=csn2 FT /note="pB17E12.C.cand.5 score = 25.59" FT /product="COP9/signalosome complex subunit 2; contains PCI FT domain; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/pB17E12.tab.seq.00036.out" FT misc_feature complement(1302743..1302949) FT /note="Match to PCI Score 45.78" FT misc_feature complement(1303754..1303772) FT /note="ctaattattgggttttaag, splice branch and acceptor" FT /colour=6 FT misc_feature complement(1303801..1303806) FT /note="gtaagt, splice donor sequence" FT /colour=6 FT misc_feature complement(1303868..1303880) FT /note="ctaactcttatag, splice branch and acceptor" FT /colour=6 FT misc_feature complement(1303901..1303906) FT /note="gtatga, splice donor sequence" FT /colour=6 FT misc_feature complement(1303989..1304003) FT /note="ctaatcgattttaag, splice branch and acceptor" FT /colour=6 FT misc_feature complement(1304023..1304028) FT /note="gtaagt, splice donor sequence" FT /colour=6 FT misc_feature complement(1304124..1304137) FT /note="ttaataataaacag, splice branch and acceptor" FT /colour=6 FT misc_feature complement(1304160..1304165) FT /note="gtaagg, splice donor sequence" FT /colour=6 FT CDS join(1305211..1305445,1305513..1305547) FT /colour=2 FT /gene="rpl37" FT /gene="SPAPB17E12.05" FT /product="60S ribosomal protein L37" FT /fasta_file="fasta/pB17E12.tab.seq.00037.out" FT misc_feature 1305214..1305375 FT /note="Match to Ribosomal_L37e Score 152.71" FT CDS_motif 1305220..1305279 FT /colour=8 FT /note="PS01077 Ribosomal protein L37e signature" FT misc_feature 1305446..1305451 FT /note="gtaagt, splice donor sequence" FT /colour=6 FT intron 1305446..1305512 FT /colour=2 FT /note="confirmed intron" FT misc_feature 1305497..1305512 FT /note="ttaacattttatttag, splice branch and acceptor" FT /colour=6 FT CDS join(1306349..1306526,1306613..1306697,1306699..1306784, FT 1306845..1306946,1306989..1307095,1307134..1307427) FT /colour=4 FT /gene="SPAPB17E12.06" FT /note="pseudo or frameshifted" FT /pseudo FT /fasta_file="fasta/pB17E12.tab.seq.02381.out" FT misc_feature 1306527..1306532 FT /note="gtgaat, splice donor sequence" FT /colour=6 FT misc_feature 1306597..1306612 FT /note="ctaattactcgattag, splice branch and acceptor" FT /colour=6 FT misc_feature 1306785..1306790 FT /note="gtataa, splice donor sequence" FT /colour=6 FT misc_feature 1306829..1306844 FT /note="ctaatgagacttaaag, splice branch and acceptor" FT /colour=6 FT misc_feature 1306947..1306952 FT /note="gtatgt, splice donor sequence" FT /colour=6 FT misc_feature 1306975..1306988 FT /note="ttgacatctttaag, splice branch and acceptor" FT /colour=6 FT misc_feature 1307096..1307101 FT /note="gtaata, splice donor sequence" FT /colour=6 FT misc_feature 1307122..1307133 FT /note="ctaaacttctag, splice branch and acceptor" FT /colour=6 FT CDS complement(join(1307461..1307768,1307816..1308650)) FT /colour=7 FT /gene="SPAPB17E12.07c" FT /label=SPAPB17E12.07c FT /note="pB17E12.C.cand.4 score = 18.48" FT /product="putative tRNA splicing endonuclease subunit" FT /fasta_file="fasta/pB17E12.tab.seq.00038.out" FT misc_feature complement(1307769..1307782) FT /note="ttaacaagaaatag, splice branch and acceptor" FT /colour=6 FT intron complement(1307769..1307815) FT /colour=7 FT /note="Intron predicted by HMM_intron, Score=19.44" FT /score=1.944 FT misc_feature complement(1307810..1307815) FT /note="gtaagt, splice donor sequence" FT /colour=6 FT intron complement(1308686..1308868) FT /colour=7 FT /note="Intron predicted by HMM_intron, Score=13.18" FT /score=1.318 FT CDS join(1309527..1309549,1309629..1310001) FT /colour=8 FT /gene="SPAPB17E12.08" FT /label=SPAPB17E12.08 FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/pB17E12.tab.seq.00039.out" FT misc_feature 1309550..1309555 FT /note="gtaagc, splice donor sequence" FT /colour=6 FT misc_feature 1309610..1309628 FT /note="ctaactatatttgtactag, splice branch and acceptor" FT /colour=6 FT CDS join(1310377..1310736,1310783..1311034) FT /colour=8 FT /gene="SPAPB17E12.09" FT /label=SPAPB17E12.09 FT /note="pB17E12.cand.5 score = 14.72" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/pB17E12.tab.seq.00040.out" FT misc_feature 1310737..1310742 FT /note="gtatga, splice donor sequence" FT /colour=6 FT misc_feature 1310766..1310782 FT /note="ctgactgctctcattag, splice branch and acceptor" FT /colour=6 FT CDS complement(join(1311090..1311749,1311793..1311843, FT 1312017..1312211)) FT /colour=7 FT /gene="SPAPB17E12.10c" FT /label=SPAPB17E12.10c FT /note="pB17E12.C.cand.3 score = 17.36" FT /product="putative SAM-dependent methyltransferase; FT putative rRNA large subunit methyltransferase; similar to FT S. cerevisiae YGL136C" FT /fasta_file="fasta/pB17E12.tab.seq.00041.out" FT misc_feature complement(1311750..1311762) FT /note="ctaatcaatttag, splice branch and acceptor" FT /colour=6 FT misc_feature complement(1311787..1311792) FT /note="gtaggt, splice donor sequence" FT /colour=6 FT misc_feature complement(1311844..1311855) FT /note="ctaactattaag, splice branch and acceptor" FT /colour=6 FT misc_feature complement(1312011..1312016) FT /note="gtaagt, splice donor sequence" FT /colour=6 FT CDS join(1312806..1313011,1313063..1313180,1313239..1313318, FT 1313435..1313781,1313828..1314006) FT /colour=7 FT /gene="SPAPB17E12.11" FT /label=SPAPB17E12.11 FT /note="pB17E12.cand.6 score = 18.62" FT /product="putative N-oligosaccharyltransferase gamma FT subunit; member of a complex of 8 ER proteins that FT transfers core oligosaccharide from dolichol carrier to FT Asn-X-Ser/Thr motif; similar to S. cerevisiae OST3; FT multiple alignment with human n33; OST family" FT /fasta_file="fasta/pB17E12.tab.seq.00042.out" FT misc_feature 1313012..1313017 FT /note="gtaagc, splice donor sequence" FT /colour=6 FT misc_feature 1313050..1313062 FT /note="ctaacgttgttag, splice branch and acceptor" FT /colour=6 FT misc_feature 1313181..1313186 FT /note="gtatgt, splice donor sequence" FT /colour=6 FT misc_feature 1313223..1313238 FT /note="ctaattgtactcatag, splice branch and acceptor" FT /colour=6 FT misc_feature 1313319..1313324 FT /note="gtaagt, splice donor sequence" FT /colour=6 FT misc_feature 1313422..1313434 FT /note="ctaacttacttag, splice branch and acceptor" FT /colour=6 FT misc_feature 1313782..1313787 FT /note="gtaagt, splice donor sequence" FT /colour=6 FT misc_feature 1313815..1313827 FT /note="ctaacatttttag, splice branch and acceptor" FT /colour=6 FT CDS complement(1314207..1315160) FT /colour=7 FT /gene="SPAPB17E12.12c" FT /label=SPAPB17E12.12c FT /note="pB17E12.C.cand.2 score = 11.19" FT /product="mitochondrial carrier protein" FT /fasta_file="fasta/pB17E12.tab.seq.00043.out" FT misc_feature complement(1314213..1314488) FT /note="Match to mito_carr Score 92.03" FT CDS_motif complement(1314396..1314425) FT /colour=8 FT /note="PS00215 Mitochondrial energy transfer proteins FT signature" FT misc_feature complement(1314492..1314812) FT /note="Match to mito_carr Score 81.05" FT misc_feature complement(1314840..1315100) FT /note="Match to mito_carr Score 100.35" FT CDS join(1315303..1315305,1315377..1315937) FT /colour=2 FT /gene="rpl18-2" FT /gene="SPAPB17E12.13" FT /note="pB17E12.cand.7 score = 21.37" FT /product="60S ribosomal protein L18" FT /fasta_file="fasta/pB17E12.tab.seq.00044.out" FT misc_feature 1315306..1315311 FT /note="gtaagt, splice donor sequence" FT /colour=6 FT misc_feature 1315361..1315376 FT /note="ctaataaatttattag, splice branch and acceptor" FT /colour=6 FT misc_feature 1315404..1315934 FT /note="Match to Ribosomal_L18e Score 461.74" FT CDS_motif 1315518..1315571 FT /colour=8 FT /note="PS01106 Ribosomal protein L18e signature" FT CDS complement(1316592..1318016) FT /colour=7 FT /gene="SPAPB17E12.14c" FT /label=SPAPB17E12.14c FT /note="pB17E12.C.cand.1 score = 43.30" FT /product="6-phosphofructo-2-kinase; fructose-2,6- FT bisphosphatase" FT /fasta_file="fasta/pB17E12.tab.seq.00050.out" FT misc_feature complement(1316664..1317383) FT /note="Match to PGAM Score 195.93" FT CDS_motif complement(1317351..1317380) FT /colour=8 FT /note="PS00175 Phosphoglycerate mutase family FT phosphohistidine signature" FT misc_feature 1317769..1318440 FT /note="PCR from cosmid" FT CDS_motif complement(1317987..1318010) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature complement(1318017..1318598) FT /note="possible N term of SPAPB17A12.14c" FT misc_feature 1318532..1318641 FT /note="nominal overlap with SPAC1565 S. pombe chromosome 1" FT misc_feature complement(1318532..1318598) FT /note="possible N term of SPAPB17E12.14c" FT CDS 1320954..1321682 FT /colour=10 FT /gene="SPAC1565.01" FT /label=SPAC1565.01 FT /note="SPAC1565.01, len:242, SIMILARITY:Saccharomyces FT cerevisiae, YN89_YEAST, hypothetical 25.3 kDa protein in FT tim23-are2 intergenic region., (224 aa), fasta scores: FT opt: 256, E():1.2e-09, (31.3% identity in 182 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YNR018W; contains 4 predicted transmembrane helices" FT /fasta_file="fasta/c1565.tab.seq.02267.out" FT CDS complement(join(1322293..1323365,1323428..1323479)) FT /colour=7 FT /gene="SPAC1565.02c" FT /label=SPAC1565.02c FT /note="SPAC1565.02c, len:374, SIMILARITY:Homo sapiens, FT BAA92629, kiaa1391 protein, (1194 aa), fasta scores: opt: FT 224, E():4.8e-07, (29.8% identity in 151 aa)" FT /product="putative rho GTPase activating protein; no FT apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c1565.tab.seq.02268.out" FT misc_feature complement(1322467..1322850) FT /note="Match to PF00620 RhoGAP, RhoGAP domain Score 31.85" FT misc_feature complement(1323366..1323387) FT /colour=6 FT /note="ctaatcaaatttataaatatag, splice branch and acceptor" FT misc_feature complement(1323422..1323427) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS 1324159..1324659 FT /colour=8 FT /gene="SPAC1565.03" FT /label=SPAC1565.03 FT /note="SPAC1565.03, len:166, SIMILARITY:Chlamydophila FT pneumoniae ar39., AAF38040, conserved protein., (181 aa), FT fasta scores: opt: 117, E():0.35, (30.1% identity in 113 FT aa)" FT /product="hypothetical protein; sequence orphan; has FT transcript profile on microarray" FT /fasta_file="fasta/c1565.tab.seq.02269.out" FT CDS complement(join(1325234..1325931,1326090..1326186)) FT /colour=2 FT /gene="ste4" FT /gene="SPAC1565.04c" FT /label=ste4 FT /note="SPAC1565.04c, len:264" FT /product="sexual differentiation protein; involved in FT mating; involved in meiosis; SAM domain (sterile alpha FT motif)" FT /fasta_file="fasta/c1565.tab.seq.02270.out" FT misc_feature complement(1325237..1325497) FT /note="Match to PF00788 RA, Ras association (RalGDS/AF-6) FT domain Score 91.66" FT misc_feature complement(join(1325816..1325931,1326090..1326162)) FT /note="Match to PF00536 SAM, SAM domain (Sterile alpha FT motif) Score 92.60" FT misc_feature complement(1326084..1326089) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS 1327066..1329387 FT /colour=8 FT /gene="SPAC1565.05" FT /label=SPAC1565.05 FT /note="SPAC1565.05, len:773, SIMILARITY:Arabidopsis FT thaliana, Q9SZH9, putative leucine-rich-repeat protein., FT (382 aa), fasta scores: opt: 135, E():0.26, (26.8% FT identity in 153 aa)" FT /product="hypothetical protein; sequence orphan; predicted FT coiled-coil region" FT /fasta_file="fasta/c1565.tab.seq.02271.out" FT CDS complement(join(1329820..1329918,1329958..1330032, FT 1330073..1330156,1330310..1330518,1330565..1330694)) FT /colour=2 FT /gene="spg1" FT /gene="sid3" FT /gene="SPAC1565.06c" FT /label=spg1 FT /note="SPAC1565.06c, len:198" FT /product="Small GTPase of the RAS family; involved in FT regulation of septation; required for septation; required FT for cytokinesis; required for mitotic exit; similar to S. FT cerevisiae TEM1" FT /fasta_file="fasta/c1565.tab.seq.02272.out" FT misc_feature complement(1329919..1329932) FT /colour=6 FT /note="ttgacgatttttag, splice branch and acceptor" FT misc_feature complement(1329952..1329957) FT /colour=6 FT /note="gtataa, splice donor sequence" FT misc_feature complement(1330033..1330045) FT /colour=6 FT /note="ttaacttggttag, splice branch and acceptor" FT misc_feature complement(1330067..1330072) FT /colour=6 FT /note="gtacaa, splice donor sequence" FT misc_feature complement(1330157..1330169) FT /colour=6 FT /note="ctaacgctttcag, splice branch and acceptor" FT misc_feature complement(1330304..1330309) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(1330519..1330531) FT /colour=6 FT /note="ttaacaaacttag, splice branch and acceptor" FT misc_feature complement(1330559..1330564) FT /colour=6 FT /note="gtaaat, splice donor sequence" FT CDS complement(join(1331593..1335218,1335257..1335293)) FT /colour=7 FT /gene="SPAC1565.07c" FT /label=SPAC1565.07c FT /note="SPAC1565.07c, len:1220, SIMILARITY:Rattus FT norvegicus, P97536, tip120., (1230 aa), fasta scores: opt: FT 630, E():3.6e-32, (22.3% identity in 1263 aa)" FT /product="putative tata binding protein interacting FT protein; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c1565.tab.seq.02273.out" FT misc_feature complement(1335219..1335231) FT /colour=6 FT /note="ctaactgttgcag, splice branch and acceptor" FT misc_feature complement(1335251..1335256) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1336189..1336194 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1336232..1336244 FT /colour=6 FT /note="ctaacaagctcag, splice branch and acceptor" FT misc_feature 1336948..1337421 FT /note="Match to PF00004 AAA, ATPases associated with FT various cellular activities (AAA) Score 268.64" FT misc_feature 1337320..1337424 FT /note="nominal overlap with SPAC6F12 S. pombe chromosome 1" FT misc_feature 1337767..1338327 FT /note="Match to PF00004 AAA, ATPases associated with FT various cellular activities (AAA) Score 345.97" FT misc_feature 1337782..1337805 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 1338076..1338132 FT /colour=8 FT /note="PS00674 AAA-protein family signature" FT CDS 1340656..1342359 FT /colour=2 FT /gene="rst2" FT /gene="SPAC6F12.02" FT /label=rst2 FT /note="SPAC6F12.02, len:567, SIMILARITY:Saccharomyces FT cerevisiae, ZMS1_YEAST, zinc finger protein zms1., (1380 FT aa), fa sta scores: opt: 321, E():1.3e-10, (24.3% identity FT in 589 a a)" FT /product="transcriptional regulator; zinc finger protein; FT zf-C2H2 type; regulator of sexual development; regulates FT ste11; subcellular localization of GFP fusion- Nucleus; FT regulator of gluconeogenesis (PMID: 11739717); FT phosphorylated by protein kinase A (PMID: 11739717); FT similar to S. cerevisiae ADR1 and YML081W" FT /fasta_file="fasta/c6F12.tab.seq.01345.out" FT misc_feature 1340863..1340931 FT /note="Match to PF00096 zf-C2H2, zinc finger, C2H2 type FT Score 35.33" FT misc_feature 1340977..1341039 FT /note="Match to PF00096 zf-C2H2, zinc finger, C2H2 type FT Score 24.22" FT misc_feature complement(1343123..1344159) FT /note="EM_FUN:SPD211 mRNA, complete cds" FT CDS complement(1343397..1344140) FT /colour=2 FT /gene="tlg1b" FT /gene="SPAC6F12.03c" FT /label=tlg1b FT /note="SPAC6F12.03c, len:247, SIMILARITY:Homo sapiens, FT O607 12, hypothetical 26.9 kD protein., (236 aa), fasta FT scores: opt: 194, E():0.00018, (23.5% identity in 221 aa)" FT /product="putative syntaxin (t-SNARE)" FT /fasta_file="fasta/c6F12.tab.seq.01346.out" FT tRNA complement(1344600..1344696) FT /note="tRNA Pro anticodon CGG, Cove score 57.28" FT intron complement(1344636..1344659) FT /note="intron tRNA Pro anticodon CGG" FT CDS 1345775..1346173 FT /colour=10 FT /gene="SPAC6F12.04" FT /label=SPAC6F12.04 FT /note="SPAC6F12.04, len:132, FT SIMILARITY:Schizosaccharomyces pombe, O14223, hypothetical FT 13.0 kD protein c6f12.04 in ch romosome i., (118 aa), FT fasta scores: opt: 515, E():2.2e-28, (89.4% identity in FT 132 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YDR100W possibly involved in vesicular transport and FT membrane fusion by 2-hybrid data; contains 4 predicted FT transmembrane helices" FT /fasta_file="fasta/c6F12.tab.seq.01347.out" FT CDS complement(1346769..1348478) FT /EC_number="2.7.6.2" FT /colour=2 FT /gene="tnr3" FT /gene="SPAC6F12.05c" FT /label=tnr3 FT /note="SPAC6F12.05c, len:569" FT /product="thiamine pyrophosphokinase (thiamine kinase); FT regulator of thiamine metabolism; regulator of phosphate FT metabolism; regulator of mating; regulator of growth; FT NUDIX hydrolase domain" FT /fasta_file="fasta/c6F12.tab.seq.01348.out" FT CDS 1349522..1350139 FT /colour=7 FT /gene="SPAC6F12.06" FT /label=SPAC6F12.06 FT /note="SPAC6F12.06, len:205, SIMILARITY:Saccharomyces FT cerevisiae, D1007070, rho gdp dissociation inhibitor., FT (202 aa), fasta scores: opt: 487, E():1.3e-26, (38.8% FT identity in 20 6 aa)" FT /product="rho gdp dissociation inhibitor; small GTPase FT mediated signal transduction" FT /fasta_file="fasta/c6F12.tab.seq.01349.out" FT CDS join(1351111..1351159,1351458..1351517,1351579..1351764, FT 1351814..1351977) FT /colour=7 FT /gene="SPAC6F12.07" FT /label=SPAC6F12.07 FT /note="SPAC6F12.07, len:152, SIMILARITY:Saccharomyces FT cerevisiae, OM20_YEAST, mitochondrial import receptor FT subunit to m20, (183 aa), fasta scores: opt: 351, E():7.6e- FT 17, (40.5% identity in 148 aa)" FT /product="mitochondrial import receptor subunit" FT /fasta_file="fasta/c6F12.tab.seq.01350.out" FT misc_feature 1351160..1351165 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1351441..1351457 FT /colour=6 FT /note="ctaatttattaaattag, splice branch and acceptor" FT misc_feature 1351518..1351523 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT intron 1351518..1351578 FT /note="confirmed by mRNA" FT misc_feature 1351563..1351578 FT /colour=6 FT /note="cttacgtttactatag, splice branch and acceptor" FT misc_feature 1351765..1351770 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 1351797..1351813 FT /colour=6 FT /note="ttaacctctgtttatag, splice branch and acceptor" FT CDS complement(join(1352115..1353631,1353675..1353816, FT 1353871..1353910,1353975..1354012)) FT /colour=8 FT /gene="SPAC6F12.08c" FT /label=SPAC6F12.08c FT /note="SPAC6F12.08c, len:578" FT /product="hypothetical protein; predicted coiled-coil FT regions; sequence orphan" FT /fasta_file="fasta/c6F12.tab.seq.01351.out" FT misc_feature complement(1353632..1353648) FT /colour=6 FT /note="ctaattttgcaaaaaag, splice branch and acceptor" FT misc_feature complement(1353669..1353674) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1353817..1353839) FT /colour=6 FT /note="ttactaaaactgctttttaaaag, splice branch and acceptor" FT misc_feature complement(1353865..1353870) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1353911..1353923) FT /colour=6 FT /note="ctaatcatttaag, splice branch and acceptor" FT misc_feature complement(1353969..1353974) FT /colour=6 FT /note="gtacgc, splice donor sequence" FT CDS 1354929..1358576 FT /colour=7 FT /gene="SPAC6F12.09" FT /label=SPAC6F12.09 FT /note="SPAC6F12.09, len:1215, SIMILARITY:Petunia x FT hybrida. , E1364057, RNA-directed RNA polymerase, (775 aa), FT fasta sc ores: opt: 1072, E():0, (30.9% identity in 764 FT aa)" FT /product="RNA-directed RNA polymerase; PTGS; no apparent FT S. cerevisiae ortholog" FT /fasta_file="fasta/c6F12.tab.seq.01352.out" FT CDS complement(1358938..1362909) FT /EC_number="6.3.5.3" FT /colour=2 FT /gene="ade3" FT /gene="min11" FT /gene="SPAC6F12.10c" FT /label=ade3 FT /note="SPAC6F12.10c, len:1323, SIMILARITY:Saccharomyces FT cer evisiae, PUR4_YEAST, phosphoribosylformylglycinamidine FT synthase, (1358 aa), fasta scores: opt: 4760, E():0, FT (56.8% ide ntity in 1294 aa)" FT /product="putative phosphoribosylformylglycinamidine FT synthase; subcellular localization of GFP fusion- FT Cytoplasm" FT /fasta_file="fasta/c6F12.tab.seq.01353.out" FT misc_feature complement(1361161..1362120) FT /note="Match to PF00586 AIRS, AIR synthase related FT proteins Score 107.52" FT CDS complement(join(1363341..1364597,1364706..1364819)) FT /colour=2 FT /gene="sfc1" FT /gene="SPAC6F12.11c" FT /label=sfc1 FT /note="SPAC6F12.11c, len:456, SIMILARITY:Saccharomyces FT cerevisiae, TFC1_YEAST, transcription factor tau 95 kD FT subunit, (649 aa), fasta scores: opt: 230, E():1.5e-07, FT (23.0% iden tity in 431 aa)" FT /product="RNA polymerase III Transcription factor TFIIIC FT subunit; A box associated binding subunit; similar to S. FT cerevisiae TFC1" FT /fasta_file="fasta/c6F12.tab.seq.01354.out" FT CDS join(1365604..1365996,1366065..1366308,1366381..1366577, FT 1366628..1367022,1367078..1367732) FT /colour=2 FT /gene="par2" FT /gene="pbp2" FT /gene="SPAC6F12.12" FT /label=par2 FT /note="SPAC6F12.12, len:627" FT /product="protein phosphatase PP2A, B' regulatory subunit, FT required for normal cytokinesis, morphogenesis, and stress FT tolerance" FT /fasta_file="fasta/c6F12.tab.seq.01355.out" FT misc_feature 1365997..1366002 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1366050..1366064 FT /colour=6 FT /note="ctaacttacttgtag, splice branch and acceptor" FT misc_feature 1366309..1366314 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 1366368..1366380 FT /colour=6 FT /note="ctaatataattag, splice branch and acceptor" FT misc_feature 1366578..1366583 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1366607..1366627 FT /colour=6 FT /note="taaaaatctaatcactatag, splice branch and acceptor" FT misc_feature 1367023..1367028 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT intron 1367023..1367077 FT /note="intron confirmed by mRNA" FT misc_feature 1367057..1367077 FT /colour=6 FT /note="tttacaaactaacttattag, splice branch and acceptor" FT CDS complement(join(1368128..1369051,1369257..1369376)) FT /EC_number="2.5.1.1" FT /colour=7 FT /gene="SPAC6F12.13c" FT /label=SPAC6F12.13c FT /note="SPAC6F12.13c, len:347, SIMILARITY:Neurospora FT crassa. , FPPS_NEUCR, farnesyl pyrophosphate synthetase, FT (347 aa), fasta scores: opt: 1434, E():0, (60.8% identity FT in 347 aa)" FT /product="farnesyl pyrophosphate synthetase" FT /fasta_file="fasta/c6F12.tab.seq.01356.out" FT misc_feature complement(1368254..1369048) FT /note="Match to PF00348 polyprenyl_synt, Polyprenyl FT synthetases Score 310.14" FT misc_feature complement(1368854..1368898) FT /colour=8 FT /note="PS00723 Polyprenyl synthetases signature 1" FT misc_feature complement(1369052..1369070) FT /colour=6 FT /note="ctaactgctgtttttgtag, splice branch and acceptor" FT misc_feature complement(1369251..1369256) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS join(1370076..1370209,1370502..1371220,1371259..1372103) FT /colour=2 FT /gene="cut23" FT /gene="SPAC6F12.14" FT /label=cut23 FT /note="SPAC6F12.14, len:517, SIMILARITY:Homo sapiens, FT O7543 3, cell division cycle protein 23., (591 aa), fasta FT scores: opt: 1173, E():0, (41.8% identity in 495 aa)" FT /product=" anaphase-promoting complex (APC); cyclosome; FT TPR domain protein; similar to S. cerevisiae CDC23" FT /fasta_file="fasta/c6F12.tab.seq.01357.out" FT misc_feature 1371221..1371226 FT /colour=6 FT /note="gtatac, splice donor sequence" FT misc_feature 1371247..1371258 FT /colour=6 FT /note="ctaactttacag, splice branch and acceptor" FT misc_feature 1371435..1371509 FT /note="Match to PF00515 TPR, TPR Domain Score 31.26" FT misc_feature 1371528..1371611 FT /note="Match to PF00515 TPR, TPR Domain Score 30.23" FT misc_feature 1371630..1371716 FT /note="Match to PF00515 TPR, TPR Domain Score 28.83" FT misc_feature 1371732..1371806 FT /note="Match to PF00515 TPR, TPR Domain Score 22.03" FT CDS complement(join(1372308..1372598,1372655..1372790, FT 1372844..1374432)) FT /colour=2 FT /gene="cut9" FT /gene="SPAC6F12.15c" FT /label=cut9 FT /note="SPAC6F12.15c, len:671" FT /product="putative component of anaphase-promoting complex FT (APC); required for cyclin degradation; required for FT metaphase-anaphase transition; putative anaphase control; FT similar to S. cerevisiae CDC16" FT /fasta_file="fasta/c6F12.tab.seq.01358.out" FT misc_feature complement(1372599..1372612) FT /colour=6 FT /note="ttaacattgattag, splice branch and acceptor" FT misc_feature complement(1372649..1372654) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1372791..1372804) FT /colour=6 FT /note="ctaacatcatttag, splice branch and acceptor" FT misc_feature complement(1372838..1372843) FT /colour=6 FT /note="gtgagg, splice donor sequence" FT misc_feature complement(1373743..1373823) FT /note="Match to PF00515 TPR, TPR Domain Score 25.22" FT CDS complement(1374765..1378118) FT /colour=7 FT /gene="SPAC6F12.16c" FT /label=SPAC6F12.16c FT /note="SPAC6F12.16c, len:1117, SIMILARITY:Saccharomyces FT cer evisiae, MTR4_YEAST, ATP-dependent RNA helicase dob1, FT (1073 aa), fasta scores: opt: 4337, E():0, (65.7% identity FT in 10 14 aa)" FT /product="required for mRNA export from nucleus, member of FT the DEAD-box RNA helicase family by similar to yeast mtr4" FT /fasta_file="fasta/c6F12.tab.seq.01359.out" FT misc_feature complement(1377054..1377533) FT /note="Match to PF00270 DEAD, DEAD/DEAH box helicase Score FT 118.72" FT misc_feature complement(1377438..1377461) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS join(1378456..1380547,1380591..1380700) FT /colour=7 FT /gene="SPAC6F12.17" FT /label=SPAC6F12.17 FT /note="SPAC6F12.17, len:733, SIMILARITY:Saccharomyces FT cerev isiae, RN14_YEAST, mRNA 3'-end processing protein FT RNA14., ( 677 aa), fasta scores: opt: 867, E():0, (29.0% FT identity in 680 aa)" FT /product="putative polyadenylation factor; similar to S. FT cerevisiae RNA14" FT /fasta_file="fasta/c6F12.tab.seq.01360.out" FT misc_feature 1380548..1380553 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1380576..1380590 FT /colour=6 FT /note="ctaactatcttttag, splice branch and acceptor" FT misc_feature 1381777..1381977 FT /note="nominal overlap with cosmid SPAC19E9, EM: Z98975 FT S.pombe chromosome 1" FT misc_feature 1381777..1381977 FT /note="nominal overlap with cosmid SPAC6F12, EM:Z98533 FT S.pombe chromosome 1" FT CDS complement(join(1382033..1382912,1383100..1383335)) FT /colour=7 FT /gene="SPAC19E9.01c" FT /label=SPAC19E9.01c FT /note="SPAC19E9.01c, len:371," FT /product="putative karyopherin docking complex ;putative FT nuclear pore complex; similar to S. cerevisiae NUP53" FT /fasta_file="fasta/c19E9.tab.seq.01474.out" FT misc_feature complement(1382913..1382930) FT /colour=6 FT /note="ctaattttctctaaatag, splice branch and acceptor" FT misc_feature complement(1383094..1383099) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS join(1384036..1384095,1384364..1384387,1384434..1386518) FT /colour=2 FT /gene="fin1" FT /gene="SPAC19E9.02" FT /label=fin1 FT /note="SPAC19E9.02, len:722, SIMILARITY:Neurospora crassa., FT NIM1_NEUCR, g2-specific protein kinase nim-1, (779 aa), FT fasta scores: opt: 874, E():0, (30.2% identity in 722 aa)" FT /product="serine/threonine protein kinase; possibly G2- FT specific; promoter of chromatin condensation" FT /fasta_file="fasta/c19E9.tab.seq.01475.out" FT misc_feature 1384045..1384878 FT /colour=9 FT /note="Pfam match to entry PF00069 pkinase, Eukaryotic FT protein kinase domain," FT misc_feature 1384063..1384143 FT /colour=8 FT /note="PS00107 protein kinases ATP-binding region FT signature" FT misc_feature 1384096..1384101 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT intron 1384096..1384363 FT /colour=2 FT /note="confirmed intron" FT misc_feature 1384351..1384363 FT /colour=6 FT /note="ctaactattatag, splice branch and acceptor" FT misc_feature 1384388..1384393 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT intron 1384388..1384433 FT /colour=2 FT /note="confirmed intron" FT misc_feature 1384420..1384433 FT /colour=6 FT /note="ttaatactttttag, splice branch and acceptor" FT misc_feature 1384788..1384826 FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT misc_feature 1386519..1392246 FT /note="low complexity gene-free region" FT misc_RNA 1387487..1387968 FT /colour=3 FT /note="mRNA not associated with an ORF" FT misc_feature 1392544..1392745 FT /note="nominal overlap with cosmid SPAC57A10, EM:Z94864 FT S.pombe chromosome 1" FT misc_feature 1392544..1392745 FT /note="nominal overlap with cosmid SPAC19E9, EM:Z98975 S. FT pombe chromosome 1" FT CDS 1394522..1396849 FT /colour=2 FT /gene="cdr2" FT /gene="SPAC57A10.02" FT /label=cdr2 FT /note="SPAC57A10.02, len:775" FT /product="serine/threonine protein kinase; regulation of FT cell cycle progression; nim1 family" FT /fasta_file="fasta/c57A10.tab.seq.01750.out" FT misc_feature 1394549..1395307 FT /colour=9 FT /note="Pfam match to entry pkinase PF00069, Eukaryotic FT prot ein kinase domain" FT misc_feature 1394906..1394944 FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT CDS join(1397887..1397916,1397957..1397998,1398064..1398117, FT 1398322..1398401,1398484..1398580,1398621..1398785) FT /EC_number="5.2.1.8" FT /colour=2 FT /gene="cyp1" FT /gene="SPAC57A10.03" FT /label=cyp1 FT /note="SPAC57A10.03, len:155, SIMILARITY:Homo sapiens, FT Q9Y3C6, cgi-124 protein, (166 aa), fasta scores: opt: 732, FT E():0, (67.3% identity in 150 aa)" FT /product="cyclophilin-1; peptidyl-prolyl cis-trans FT isomerase" FT /fasta_file="fasta/c57A10.tab.seq.01751.out" FT misc_feature 1397917..1397922 FT /colour=2 FT /note="gtaaga, splice donor sequence" FT misc_feature 1397943..1397956 FT /colour=2 FT /note="ttaacattttttag, splice branch and acceptor" FT misc_feature 1397999..1398004 FT /colour=2 FT /note="gtacgc, splice donor sequence" FT misc_feature 1398053..1398063 FT /colour=2 FT /note="ctaacttatag, splice branch and acceptor" FT misc_feature 1398118..1398123 FT /colour=2 FT /note="gtaagt, splice donor sequence" FT misc_feature 1398309..1398321 FT /colour=2 FT /note="ctaattaaattag, splice branch and acceptor" FT misc_feature join(1398322..1398401,1398484..1398580,1398621..1398782) FT /note="Match to PF00160 pro_isomerase, Cyclophilin type FT peptidyl-prolyl cis-trans isomerase Score 156.06" FT misc_feature 1398402..1398407 FT /colour=2 FT /note="gtaggc, splice donor sequence" FT misc_feature 1398472..1398483 FT /colour=2 FT /note="ttaattgattag, splice branch and acceptor" FT misc_feature 1398581..1398586 FT /colour=2 FT /note="gtatga, splice donor sequence" FT misc_feature 1398607..1398620 FT /colour=2 FT /note="ttaaccatcttcag, splice branch and acceptor" FT CDS join(1399873..1400070,1400134..1400952) FT /colour=8 FT /gene="SPAC57A10.04" FT /label=SPAC57A10.04 FT /note="SPAC57A10.04, len:338" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c57A10.tab.seq.01752.out" FT misc_feature 1400071..1400076 FT /colour=6 FT /note="gtaacg, splice donor sequence" FT misc_feature 1400122..1400133 FT /colour=6 FT /note="cttacattttag, splice branch and acceptor" FT CDS complement(1402742..1404559) FT /colour=2 FT /gene="pof1" FT /gene="SPAC57A10.05c" FT /label=pof1 FT /note="SPAC57A10.05c, len:605" FT /product="F-box protein" FT /fasta_file="fasta/c57A10.tab.seq.01753.out" FT misc_feature complement(1402949..1403056) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 28.29" FT misc_feature complement(1403063..1403170) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 26.37" FT misc_feature complement(1403180..1403287) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 34.80" FT misc_feature complement(1403300..1403416) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 44.81" FT misc_feature complement(1403426..1403530) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 35.32" FT misc_feature complement(1403543..1403650) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 42.99" FT misc_feature complement(1403660..1403704) FT /colour=8 FT /note="PS00678 Beta-transducin family Trp-Asp repeats FT signa ture" FT misc_feature complement(1403663..1403770) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 44.37" FT misc_feature complement(1404101..1404238) FT /note="Match to PF00646 F-box, F-box domain. Score 50.36" FT CDS join(1406263..1406623,1406708..1406748) FT /colour=8 FT /gene="SPAC57A10.06" FT /label=SPAC57A10.06 FT /note="SPAC57A10.06, len:133" FT /product="hypothetical protein; sequence orphan; has FT transcript profile on microarray" FT /fasta_file="fasta/c57A10.tab.seq.01754.out" FT misc_feature 1406624..1406629 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 1406691..1406707 FT /colour=6 FT /note="ttaactagaaaatttag, splice branch and acceptor" FT CDS 1406981..1407916 FT /colour=10 FT /gene="SPAC57A10.07" FT /label=SPAC57A10.07 FT /note="SPAC57A10.07, len:311, SIMILARITY:Saccharomyces FT cerevisiae, Q08634, chromosome xv reading frame orf FT yor238w., (306 aa), fasta scores: opt: 283, E():4e-12, FT (33.3% identity in 294 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YOR238W; Pfam-B_32809" FT /fasta_file="fasta/c57A10.tab.seq.01755.out" FT CDS complement(join(1408237..1408296,1408339..1408449, FT 1408499..1409422)) FT /colour=7 FT /gene="SPAC57A10.08c" FT /label=SPAC57A10.08c FT /note="SPAC57A10.08c, len:364, NOTE: C-term exons may not FT be real, LOW SIMILARITY:Mycoplasma pneumoniae., ESL2_MYCPN, FT putative esterase/lipase 2, (268 aa), fasta scores: opt: FT 169, E():0.00031, (27.0% identity in 267 aa)" FT /product="putative esterase/lipase; similar to S. FT cerevisiae PPE1" FT /fasta_file="fasta/c57A10.tab.seq.00055.out" FT misc_feature complement(1408450..1408465) FT /colour=6 FT /note="ctgacttttatcatag, splice branch and acceptor" FT misc_feature complement(1408493..1408498) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT CDS complement(join(1410514..1410651,1410944..1411002, FT 1411083..1411212)) FT /colour=7 FT /gene="SPAC57A10.09c" FT /label=SPAC57A10.09c FT /note="SPAC57A10.09c, len:108, SIMILARITY:Saccharomyces FT cerevisiae, NHPB_YEAST, nonhistone chromosomal protein 6b., FT (99 aa), fasta scores: opt: 354, E():3.2e-17, (54.0% FT identity in 87 aa)" FT /product="putative transcription factor; HMG box; possibly FT involved in establishment or maintenence of chromatin FT architecture; possibly involved in transcriptional FT regulation from PolII promoter; similar to S. cerevisiae FT NHP6B" FT /fasta_file="fasta/c57A10.tab.seq.01757.out" FT misc_feature complement(join(1410592..1410651,1410944..1411002, FT 1411083..1411167)) FT /note="Match to PF00505 HMG_box, HMG (high mobility group) FT box Score 61.38" FT misc_feature complement(1410652..1410666) FT /colour=2 FT /note="ctaacccaattttag, splice branch and acceptor" FT intron complement(1410652..1410943) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1410938..1410943) FT /colour=2 FT /note="gtaaga, splice donor and acceptor" FT misc_feature complement(1411003..1411015) FT /colour=2 FT /note="ctaacgcgttag, splice branch and acceptor" FT intron complement(1411003..1411082) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1411077..1411082) FT /colour=2 FT /note="gtatgt, splice donor sequence" FT CDS complement(join(1412218..1412900,1412976..1413189)) FT /colour=2 FT /gene="sla1" FT /gene="SPAC57A10.10c" FT /label=sla1 FT /note="SPAC57A10.10c, len:299aa" FT /product="la protein homolog; RNA binding protein; similar FT to S. cerevisiae LHP1" FT /fasta_file="fasta/c57A10.tab.seq.01758.out" FT misc_feature complement(1412446..1412604) FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 39.24" FT misc_feature complement(1412901..1412916) FT /colour=2 FT /note="ctaacagtatgaatag, splice branch and acceptor" FT intron complement(1412901..1412975) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1412970..1412975) FT /colour=2 FT /note="gtatgt, splice donor sequence" FT CDS complement(join(1413753..1414399,1414468..1414762)) FT /colour=10 FT /gene="SPAC57A10.11c" FT /label=SPAC57A10.11c FT /note="SPAC57A10.11c, len:313, SIMILARITY:Saccharomyces FT cerevisiae, YKT5_YEAST, hypothetical 47.4 kD protein in FT pas1-mst1 intergenic region., (427 aa), fasta scores: opt: FT 531, E():4.2e-24, (38.7% identity in 238 aa)" FT /product="hypothetical protein" FT /fasta_file="fasta/c57A10.tab.seq.01759.out" FT misc_feature complement(1414400..1414411) FT /colour=2 FT /note="ctaacaatatag, splice branch and acceptor sequence" FT misc_feature complement(1414462..1414467) FT /colour=2 FT /note="gtaagt, splice donor sequence" FT CDS complement(1415186..1416517) FT /EC_number="6.5.1.1" FT /colour=2 FT /gene="ura3" FT /gene="SPAC57A10.12c" FT /label=ura3 FT /note="SPAC57A10.12c, len:443" FT /product="dihydroorotate dehydrogenase" FT /fasta_file="fasta/c57A10.tab.seq.01760.out" FT misc_feature complement(1415258..1416202) FT /note="Match to PF01180 DHOdehase, Dihydroorotate FT dehydrogenase Score 579.96" FT misc_feature complement(1415312..1415374) FT /colour=8 FT /note="PS00912 Dihydroorotate dehydrogenase signature 2" FT misc_feature complement(1416038..1416082) FT /colour=8 FT /note="PS00911 Dihydroorotate dehydrogenase signature 1" FT misc_feature 1417703..1417708 FT /colour=2 FT /note="gtttgt, splice donor sequence" FT misc_feature 1417730..1417742 FT /colour=2 FT /note="ctaacccatatag, splice branch and acceptor" FT misc_feature 1418251..1418256 FT /colour=2 FT /note="gtatga, splice donor sequence" FT misc_feature 1418291..1418312 FT /colour=2 FT /note="ctaacgtctttttttacattag, splice branch and acceptor" FT misc_feature 1418940..1419143 FT /note="nominal overlap with cosmid SPAC20G8, EM:Z95334 S. FT pombe chromosome 1" FT misc_feature 1418940..1419143 FT /note="nominal overlap with cosmid SPAC57A10, EM:Z94864 FT S.pombe chromosome 1" FT misc_feature 1418943..1419911 FT /note="Match to PF01068 DNA_ligase, DNA ligase Score FT 596.02" FT misc_feature 1418961..1418987 FT /colour=8 FT /note="PS00697 ATP_dependent DNA ligase AMP_binding site" FT misc_feature 1419423..1419506 FT /colour=8 FT /note="PS00333 ATP-dependent DNA ligase signature 2" FT CDS 1420313..1422586 FT /colour=10 FT /gene="SPAC20G8.02" FT /label=SPAC20G8.02 FT /note="SPAC20G8.02, len:757, SIMILARITY:Saccharomyces FT cerevisiae, Q12204, chromosome xv reading frame orf FT yor022c., (715 aa), fasta scores: opt: 370, E():1.2e-15, FT (29.6% identity in 766 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YOR022C; contains DDHD domain, a putative metal binding FT site- seen in a family of probably phospholipases" FT /fasta_file="fasta/c20G8.tab.seq.01697.out" FT CDS 1423572..1425245 FT /colour=2 FT /gene="itr2" FT /gene="SPAC20G8.03" FT /label=itr2 FT /note="SPAC20G8.03, len:557" FT /product="MFS myo-inositol transporter" FT /fasta_file="fasta/c20G8.tab.seq.01698.out" FT misc_feature 1423821..1425173 FT /note="Match to PF00083 sugar_tr, Sugar (and other) FT transporter Score 471.91" FT misc_feature 1423989..1424039 FT /colour=8 FT /note="PS00216 Sugar transport proteins signature 1" FT misc_feature 1424724..1424777 FT /colour=8 FT /note="PS00216 Sugar transport proteins signature 1" FT CDS complement(1425701..1427599) FT /EC_number="1.5.5.1" FT /colour=7 FT /gene="SPAC20G8.04c" FT /label=SPAC20G8.04c FT /note="SPAC20G8.04c, len:632, SIMILARITY:Homo sapiens, FT ETFD_HUMAN, electron transfer flavoprotein-ubiquinone FT oxidoreductase (ec 1.5.5.1), (617 aa), fasta scores: opt: FT 2054, E():0, (54.1% identity in 556 aa)" FT /product="putative electron transfer flavoprotein- FT ubiquinone oxidoreductase" FT /fasta_file="fasta/c20G8.tab.seq.01699.out" FT LTR 1428276..1428612 FT /note="TF1" FT CDS complement(join(1429474..1429646,1429703..1432140, FT 1432332..1432423,1432482..1432562)) FT /colour=2 FT /gene="cdc15" FT /gene="SPAC20G8.05c" FT /label=cdc15 FT /note="SPAC20G8.05c, len:927" FT /product="phosphoprotein; subcellular localization of GFP FT fusion- Cytoplasm dot and septum" FT /fasta_file="fasta/c20G8.tab.seq.01700.out" FT misc_feature complement(1429477..1429647) FT /note="Match to PF00018 SH3, Src homology domain 3 Score FT 82.50" FT misc_feature complement(1429647..1429661) FT /colour=6 FT /note="ctaattataattcag, splice branch and acceptor FT sequence" FT misc_feature complement(1429697..1429702) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(join(1431984..1432140,1432332..1432435)) FT /note="Match to PF00611 FCH, Fes/CIP4 homology domain FT Score 90.39" FT misc_feature complement(1432141..1432153) FT /colour=6 FT /note="ctaactaaattag, splice branch and acceptor sequence" FT misc_feature complement(1432326..1432331) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS 1432998..1439300 FT /colour=7 FT /gene="SPAC20G8.06" FT /label=SPAC20G8.06 FT /note="SPAC20G8.06, len:2100, SIMILARITY:Arabidopsis FT thaliana, O81909, t7i23.15 protein., (1865 aa), fasta FT scores: opt: 716, E():0, (25.8% identity in 1590 aa)" FT /product="putative CCR4-Not complex; similar to S. FT cerevisiae carbon catabolite repressor protein 4 component FT CDC39" FT /fasta_file="fasta/c20G8.tab.seq.01701.out" FT CDS complement(1440152..1440811) FT /colour=7 FT /gene="SPAC20G8.07c" FT /label=SPAC20G8.07c FT /note="SPAC20G8.07c, len:219, SIMILARITY:Saccharomyces FT cerevisiae, ERG2_YEAST, c-8 sterol isomerase, (222 aa), FT fasta scores: opt: 653, E():0, (51.4% identity in 220 aa)" FT /product="putative c-8 sterol isomerase; similar to S. FT cerevisiae ERG2" FT /fasta_file="fasta/c20G8.tab.seq.00022.out" FT CDS complement(join(1441738..1441890,1441938..1442468, FT 1442512..1442913,1442952..1443086,1443125..1444738)) FT /colour=7 FT /gene="SPAC20G8.08c" FT /label=SPAC20G8.08c FT /note="SPAC20G8.08c, len:944, SIMILARITY:Mus musculus, FT Q04692, enhancer trap locus 1, (1136 aa), fasta scores: FT opt: 1615, E():0, (38.1% identity in 882 aa)" FT /product="putative helicase" FT /fasta_file="fasta/c20G8.tab.seq.00021.out" FT misc_feature complement(1441891..1441904) FT /colour=6 FT /note="ctaacgtggtatag, splice branch and acceptor sequence" FT misc_feature complement(1441932..1441937) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(1441989..1442240) FT /note="Match to PF00271 helicase_C, Helicases conserved C- FT terminal domain Score 85.84" FT misc_feature complement(1442469..1442481) FT /colour=6 FT /note="ctaactattacag, splice branch and acceptor sequence" FT misc_feature complement(1442506..1442511) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature complement(1442566..1442805) FT /note="Match to PF00176 SNF2_N, SNF2 and others N-terminal FT domain Score 60.71" FT misc_feature complement(1442914..1442927) FT /colour=6 FT /note="ctaatttttgctag, splice branch and acceptor sequence" FT misc_feature complement(1442946..1442951) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1442955..1443080) FT /note="Match to PF00176 SNF2_N, SNF2 and others N-terminal FT domain Score 53.80" FT misc_feature complement(1443087..1443098) FT /colour=6 FT /note="ctcctcttttag, splice branch and acceptor sequence" FT misc_feature complement(1443119..1443124) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature complement(1443173..1443490) FT /note="Match to PF00176 SNF2_N, SNF2 and others N-terminal FT domain Score 159.70" FT CDS complement(join(1445218..1448116,1448185..1448330, FT 1448370..1448426)) FT /colour=10 FT /gene="SPAC20G8.09c" FT /label=SPAC20G8.09c FT /note="SPAC20G8.09c, len:1033, SIMILARITY:Caenorhabditis FT elegans., O01757, similar to achlya ambisexualis FT antheridiol steroid receptor., (1043 aa), fasta scores: FT opt: 3152, E():0, (49.6% identity in 1054 aa)" FT /product="conserved protein (high); similar to S. FT cerevisiae KRE33 Killer toxin resistant null lethal- and FT induced by glucose repression" FT /fasta_file="fasta/c20G8.tab.seq.01704.out" FT misc_feature complement(1448117..1448129) FT /colour=6 FT /note="ttaacccatatag, splice branch and acceptor sequence" FT misc_feature complement(1448179..1448184) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(1448331..1448344) FT /colour=6 FT /note="ctgacaaagattag, splice branch and acceptor sequence" FT misc_feature complement(1448364..1448369) FT /colour=6 FT /note="gtaatt, splice donor sequence" FT misc_feature 1449030..1449139 FT /note="nominal overlap with cosmid SPAC3A12, EM:Z95395 S. FT pombe chromosome 1" FT misc_feature 1449030..1449139 FT /note="nominal overlap with cosmid SPAC20G8, EM:Z95334 FT S.pombe chromosome 1" FT tRNA 1450825..1450897 FT /note="tRNA Cys anticodon GCA, Cove score 70.58" FT CDS join(1451592..1451747,1451856..1452228,1452287..1452618) FT /EC_number="3.6.1.1" FT /colour=7 FT /gene="SPAC3A12.02" FT /label=SPAC3A12.02 FT /note="SPAC3A12.02, len:286, FT SIMILARITY:Schizosaccharomyces pombe, IPYR_SCHPO, FT inorganic pyrophosphatase, (288 aa), fasta scores: opt: FT 930, E():0, (48.7% identity in 277 aa)" FT /product="inorganic pyrophosphatase" FT /fasta_file="fasta/c3A12.tab.seq.01478.out" FT misc_feature 1451748..1451753 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1451835..1451855 FT /colour=6 FT /note="ctaacaatttttttcaactag, splice branch and acceptor FT se quence" FT misc_feature join(1451856..1452228,1452287..1452459) FT /note="Match to PF00719 Pyrophosphatase, Inorganic FT pyrophosphatase Score 279.29" FT misc_feature 1452063..1452083 FT /colour=8 FT /note="PS00387 Inorganic pyrophosphatase signature" FT misc_feature 1452229..1452234 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 1452274..1452286 FT /colour=6 FT /note="ctaactttcttag, splice branch and acceptor sequence" FT CDS complement(1452916..1453845) FT /colour=10 FT /gene="SPAC3A12.03c" FT /label=SPAC3A12.03c FT /note="SPAC3A12.03c, len:309, SIMILARITY:Mus musculus, FT O54965, ring zinc finger protein., (381 aa), fasta scores: FT opt: 226, E():3.8e-08, (36.4% identity in 88 aa)" FT /product="zinc finger protein; zf-C3HC4 type (RING finger)" FT /fasta_file="fasta/c3A12.tab.seq.01479.out" FT misc_feature complement(1453108..1453233) FT /note="Match to PF00097 zf-C3HC4, zinc finger, C3HC4 type FT (RING finger) Score 34.56" FT CDS complement(join(1454373..1454837,1454907..1455005, FT 1455048..1455106,1455154..1455238)) FT /EC_number="3.1.26.5" FT /colour=7 FT /gene="SPAC3A12.04c" FT /label=SPAC3A12.04c FT /note="SPAC3A12.04c, len:216, SIMILARITY:Saccharomyces FT cerevisiae, YHM2_YEAST, hypothetical 32.2 kD protein in FT vma22-rrp3 intergenic region., (293 aa), fasta scores: FT opt: 423, E():5.7e-22, (35.3% identity in 221 aa)" FT /product="putative ribonuclease subunit by similar to FT yeast rrp1" FT /fasta_file="fasta/c3A12.tab.seq.01480.out" FT misc_feature complement(1454838..1454852) FT /colour=6 FT /note="ctaacattgccttag, splice branch and acceptor FT sequence" FT misc_feature complement(1454901..1454906) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(1455006..1455018) FT /colour=6 FT /note="cttactaacttag, splice branch and acceptor sequence" FT misc_feature complement(1455042..1455047) FT /colour=6 FT /note="gtatgg, splice donor sequence" FT CDS complement(join(1455889..1456824,1456865..1459293, FT 1459385..1459512,1459558..1459589)) FT /colour=7 FT /gene="SPAC3A12.05c" FT /label=SPAC3A12.05c FT /note="SPAC3A12.05c, len:1108, SIMILARITY:Saccharomyces FT cerevisiae, T2D2_YEAST, transcription initiation factor FT tfiid 150 kD subunit, (1407 aa), fasta scores: opt: 1598, FT E():0, (31.0% identity in 1226 aa)" FT /product="transcription initiation factor TFIID subunit" FT /fasta_file="fasta/c3A12.tab.seq.01481.out" FT misc_feature complement(1456825..1456834) FT /colour=6 FT /note="ctaatattag, splice branch and acceptor sequence" FT misc_feature complement(1456859..1456864) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(1459245..1459260) FT /colour=6 FT /note="ctaactaaattttcctatag, splice donor and acceptor" FT misc_feature complement(1459314..1459319) FT /colour=6 FT /note="gtatga, splice donor sequence" FT CDS complement(1460100..1462331) FT /colour=7 FT /gene="SPAC3A12.06c" FT /label=SPAC3A12.06c FT /note="SPAC3A12.06c, len:743, SIMILARITY:Arabidopsis FT thaliana, AAD25785, f15i1.21 protein., (644 aa), fasta FT scores: opt: 412, E():1.9e-18, (26.7% identity in 703 aa)" FT /product="CaCA sodium/calcium exchanger" FT /fasta_file="fasta/c3A12.tab.seq.01482.out" FT CDS join(1463629..1463678,1463724..1463813,1463860..1464091) FT /EC_number="2.7.7.6" FT /colour=2 FT /gene="rpb11" FT /gene="SPAC3A12.07" FT /label=rpb11 FT /note="SPAC3A12.07, len:123" FT /product="DNA-directed RNA polymerase ii 14.1 kD FT polypeptide" FT /fasta_file="fasta/c3A12.tab.seq.01483.out" FT misc_feature 1463679..1463684 FT /colour=6 FT /note="gtaagg, splice donor sequence" FT intron 1463679..1463723 FT /note="confirmed by mRNA" FT misc_feature 1463711..1463723 FT /colour=6 FT /note="ttaaccagtgtag, splice branch and acceptor sequence" FT misc_feature join(1463740..1463813,1463860..1464031) FT /note="Match to PF01193 RNA_pol_L, RNA polymerases L / 13 FT to 16 kDa subunit Score 82.19" FT misc_feature 1463814..1463819 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT intron 1463814..1463859 FT /note="confirmed by mRNA" FT misc_feature 1463842..1463859 FT /colour=6 FT /note="ctaactgctttttcgaag, splice branch and acceptor FT seque nce" FT CDS 1464815..1465459 FT /colour=10 FT /gene="SPAC3A12.08" FT /label=SPAC3A12.08 FT /note="SPAC3A12.08, len:214, SIMILARITY:Saccharomyces FT cerevisiae, YE12_YEAST, hypothetical 27.7 kD protein in FT isc10 3'region., (244 aa), fasta scores: opt: 143, FT E():0.023, (27.7% identity in 206 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YER182W; possibly fungal specific; predicted N-terminal FT signal sequence" FT /fasta_file="fasta/c3A12.tab.seq.01484.out" FT CDS complement(1466266..1467138) FT /colour=7 FT /gene="SPAC3A12.09c" FT /label=SPAC3A12.09c FT /note="SPAC3A12.09c, len:290, SIMILARITY:Ureaplasma FT urealyticum., Q56563, urease., (287 aa), fasta scores: FT opt: 181, E():2.5e-05, (26.1% identity in 188 aa)" FT /product="putative urease accessory protein; no apparent FT S. cerevisiae ortholog" FT /fasta_file="fasta/c3A12.tab.seq.01485.out" FT promoter 1467978..1467985 FT /colour=4 FT /note="Homol D box" FT CDS 1468051..1468581 FT /colour=2 FT /gene="rpl20-1" FT /gene="yl17b" FT /gene="rpl18a-2" FT /gene="SPAC3A12.10" FT /label=rpl20-1 FT /note="SPAC3A12.10, len:176" FT /product="60S ribosomal protein L20a" FT /fasta_file="fasta/c3A12.tab.seq.01486.out" FT CDS complement(join(1468950..1469733,1469788..1469952, FT 1470002..1470219)) FT /colour=2 FT /gene="cwf2" FT /gene="SPAC3A12.11c" FT /label=cwf2 FT /note="SPAC3A12.11c, len:388, similar eg. to YDL209C, FT Q12046, chromosome IV orf, (339 aa), fasta scores, opt FT :346, E():1.6e-15, (37.9% identity in 272 aa overlap)" FT /product="pre-mRNA splicing component; 40S snRNP- FT containing complex; zinc finger protein; zf-CCCH type; rrm FT domain; RNP-containing protein; similar to S. cerevisiae FT YDL209C" FT /fasta_file="fasta/c3A12.tab.seq.01487.out" FT misc_feature complement(1469409..1469591) FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 40.86" FT misc_feature complement(1469953..1469964) FT /colour=6 FT /note="ctgactttttag, splice branch and acceptor sequence" FT intron complement(1469953..1470001) FT /note="confirmed by mRNA" FT misc_feature complement(1469996..1470001) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS 1470785..1471645 FT /colour=7 FT /gene="atp11" FT /gene="SPAC3A12.12" FT /label=atp11 FT /note="SPAC3A12.12, len:287aa, similar eg. to YNL315C, FT ATPS _YEAST, P32453, atp11 protein , (318 aa), fasta sc FT ores, opt:301, E():1.1e-13, (32.7% identity in 300 aa FT overl ap)" FT /product="putative mitochondrial f1-f0 ATPase assembly; FT similar to S. cerevisiae ATP11" FT /fasta_file="fasta/c3A12.tab.seq.01488.out" FT CDS complement(join(1471937..1472748,1472792..1472804)) FT /colour=10 FT /gene="SPAC3A12.13c" FT /label=SPAC3A12.13c FT /note="SPAC3A12.13c, len:270aa;" FT /product="hypothetical protein; low similar to Drosophila FT CG12131" FT /fasta_file="fasta/c3A12.tab.seq.01489.out" FT misc_feature complement(1472749..1472763) FT /colour=6 FT /note="ttaactgaaatgaag, splice branch and acceptor FT sequence" FT intron complement(1472749..1472791) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1472786..1472791) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT LTR 1473969..1474331 FT /note="611 (+1) 1 358 TF1" FT CDS join(1474606..1474608,1474735..1475184) FT /colour=2 FT /gene="cam1" FT /gene="SPAC3A12.14" FT /label=cam1 FT /note="SPAC3A12.14, len:150aa" FT /product="calmodulin" FT /fasta_file="fasta/c3A12.tab.seq.01490.out" FT misc_feature 1474609..1474614 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1474726..1474734 FT /colour=6 FT /note="ttattacag, splice branch and acceptor sequence" FT misc_feature 1474768..1474854 FT /note="Match to PF00036 efhand, EF hand Score 35.54" FT misc_feature 1474876..1474962 FT /note="Match to PF00036 efhand, EF hand Score 45.04" FT misc_feature 1474987..1475073 FT /note="Match to PF00036 efhand, EF hand Score 44.52" FT misc_feature 1475095..1475181 FT /note="Match to PF00036 efhand, EF hand Score 42.85" FT CDS 1476379..1478649 FT /colour=2 FT /gene="vps53" FT /gene="SPAC3A12.15" FT /label=vps53 FT /note="SPAC3A12.15, len:757aa, similar eg. to YJL029C, FT YJC9 _YEAST, P47061, hypothetical 95.4 kD protein, (822 FT aa), fasta scores,opt: 576, E(): 4.7e-28, (28.0% identity FT in 743 aa overlap)" FT /product="vacuolar sorting protein" FT /fasta_file="fasta/c3A12.tab.seq.01491.out" FT tRNA complement(1479074..1479145) FT /note="tRNA Pro anticodon AGG, Cove score 64.72" FT CDS complement(join(1480318..1480680,1480755..1480886)) FT /colour=7 FT /gene="SPAC3A12.16c" FT /label=SPAC3A12.16c FT /note="SPAC3A12.16c, putative tim complex subunit, len:164, FT similar eg. to YJL143W, IM17_YEAST, P39515, FT mitochondrial import inner membrane protein tim17, (158 FT aa), fasta scores , opt:663, E():0, (67.4% identity in 135 FT aa overlap)" FT /product="mitochondrial inner membrane translocase subunit FT tim17 homolog" FT /fasta_file="fasta/c3A12.tab.seq.01492.out" FT misc_feature complement(1480681..1480700) FT /colour=6 FT /note="ctaatgaaattattaattag, splice branch and acceptor FT seq uence" FT misc_feature complement(1480749..1480754) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS complement(1481633..1482820) FT /EC_number="4.2.99.8" FT /colour=7 FT /gene="SPAC3A12.17c" FT /label=SPAC3A12.17c FT /note="SPAC3A12.17c, len:395aa, similar eg. to YGR012W, FT CYS K_YEAST, P53206, putative cysteine synthase, (393 aa), FT fast a scores, opt:1200, E():0, (51.9% identity in 368 aa FT overla p)" FT /product="putative cysteine synthase" FT /fasta_file="fasta/c3A12.tab.seq.01493.out" FT misc_feature complement(1481735..1482685) FT /note="Match to PF00291 S_T_dehydratase, Pyridoxal- FT phosphate dependent enzymes Score 172.82" FT misc_feature 1483974..1486042 FT /note="nominal overlap with cosmid SPAC9, EM:AL121764 S. FT pombe chromosome 1" FT misc_feature 1484604..1484609 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1484697..1484719 FT /colour=6 FT /note="ctgaccgagctttttacttttag, splice branch and acceptor FT sequence" FT misc_feature 1484745..1486025 FT /note="Match to PF00479 G6PD, Glucose-6-phosphate FT dehydrogenase Score 768.23" FT misc_feature 1485252..1485272 FT /colour=8 FT /note="PS00069 Glucose-6-phosphate dehydrogenase active FT sit e" FT misc_feature 1483974..1486042 FT /note="nominal overlap with cosmid SPAC3A12, EM:Z95395 S. FT pombe chromosome 1" FT misc_feature 1484604..1484609 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1484697..1484719 FT /colour=6 FT /note="ctgaccgagctttttacttttag, splice branch and acceptor" FT misc_feature 1484745..1486109 FT /note="Match to PF00479 G6PD, Glucose-6-phosphate FT dehydrogenase Score 826.54" FT CDS complement(join(1486819..1487217,1487315..1487413)) FT /colour=7 FT /gene="SPAC9.02c" FT /label=SPAC9.02c FT /note="SPAC9.02c, len:165, SIMILARITY:Saccharomyces FT cerevisiae, Q12447, chromosome iv reading frame orf FT ydr071c., (191 aa), fasta scores: opt: 274, E():1.5e-12, FT (32.2% identity in 174 aa)" FT /product="putative arylalkylamine n-acetyltransferase" FT /fasta_file="fasta/c9.tab.seq.00313.out" FT misc_feature complement(1486982..1487404) FT /colour=9 FT /note="Pfam match to entry PF00583 Acetyltransf, FT Acetyltransferase (GNAT) family, score 7.60, E-value 0.16" FT misc_feature complement(1487218..1487236) FT /colour=6 FT /note="ttaactaaacgctcaatag, splice branch and acceptor" FT misc_feature complement(1487309..1487314) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS complement(1488405..1494935) FT /colour=2 FT /gene="brr2" FT /gene="SPAC9.03c" FT /label=brr2 FT /note="SPAC9.03c, len:2176, SIMILARITY:Homo sapiens, FT O75643, u5 snrnp-specific 200kD protein, (1701 aa), fasta FT scores: opt: 6154, E():0, (52.8% identity in 1702 aa)" FT /product="putative U5 snRNP-specific protein; DEAD/DEAH FT box RNA helicase; required for pre-mRNA splicing; similar FT to S. cerevisiae BRR2" FT /fasta_file="fasta/c9.tab.seq.00314.out" FT misc_feature complement(1490472..1490855) FT /note="Match to PF00270 DEAD, DEAD/DEAH box helicase Score FT 51.68" FT misc_feature complement(1492245..1492505) FT /note="Match to PF00271 helicase_C, Helicases conserved C- FT terminal domain Score 30.53" FT misc_feature complement(1492803..1493384) FT /note="Match to PF00270 DEAD, DEAD/DEAH box helicase Score FT 127.18" FT LTR 1495008..1495356 FT /note="Tf2-type LTR" FT CDS 1495523..1499524 FT /colour=9 FT /gene="tf2-7" FT /gene="SPAC9.04" FT /label=tf2-7 FT /note="SPAC9.04, len:1333" FT /product="retrotransposable element; tf2-type transposon" FT /fasta_file="fasta/c9.tab.seq.00315.out" FT misc_feature 1496828..1497367 FT /note="Match to PF00078 rvt, Reverse transcriptase (RNA- FT dependent DNA polymerase) Score 154.95" FT LTR 1499575..1499923 FT /note="Tf2-type LTR" FT CDS join(1500736..1502184,1502230..1503059,1503101..1503341) FT /colour=7 FT /gene="SPAC9.05" FT /label=SPAC9.05 FT /note="SPAC9.05, len:839, SIMILARITY:Saccharomyces FT cerevisiae, YIS2_YEAST, putative ATP-dependent RNA FT helicase yir002c., (993 aa), fasta scores: opt: 1045, FT E():0, (37.3% identity in 745 aa)" FT /product="putative ATP-dependent RNA helicase" FT /fasta_file="fasta/c9.tab.seq.00316.out" FT misc_feature 1500949..1501491 FT /note="Match to PF00270 DEAD, DEAD/DEAH box helicase Score FT 91.12" FT misc_feature join(1502071..1502184,1502230..1502385) FT /note="Match to PF00271 helicase_C, Helicases conserved C- FT terminal domain Score 32.83" FT misc_feature 1502185..1502190 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1502219..1502229 FT /colour=6 FT /note="ctaatctctag, splice branch and acceptor" FT misc_feature 1503060..1503065 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1503085..1503100 FT /colour=6 FT /note="ttaacgataattacag, splice branch and acceptor" FT CDS complement(join(1503368..1503561,1503615..1503781, FT 1503829..1503888,1503940..1504017,1504136..1504215)) FT /colour=7 FT /gene="SPAC9.06c" FT /label=SPAC9.06c FT /note="SPAC9.06c, len:192, SIMILARITY:Homo sapiens, FT AAD27738, cgi-29 protein., (242 aa), fasta scores: opt: FT 326, E():3.9e-15, (37.4% identity in 203 aa)" FT /product="similar to enterobacterial L-ribose-5-phosphate FT 4-epimerases; similar to S. cerevisiae YJR024C" FT /fasta_file="fasta/c9.tab.seq.00317.out" FT misc_feature complement(1503562..1503573) FT /colour=6 FT /note="ctgattatgtag, splice branch and acceptor" FT misc_feature complement(1503609..1503614) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1503782..1503796) FT /colour=6 FT /note="ttaacacatcaaaag, splice branch and acceptor" FT misc_feature complement(1503823..1503828) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature complement(1503889..1503904) FT /colour=6 FT /note="ctaaccttttatacag, splice branch and acceptor" FT misc_feature complement(1503934..1503939) FT /colour=6 FT /note="gtaaat, splice donor sequence" FT misc_feature complement(1504018..1504028) FT /colour=6 FT /note="ttaacatttag, splice branch and acceptor" FT misc_feature complement(1504130..1504135) FT /colour=6 FT /note="gtagcg, splice donor sequence" FT CDS complement(join(1504585..1504725,1504776..1505575, FT 1505624..1505783)) FT /colour=7 FT /gene="SPAC9.07c" FT /label=SPAC9.07c FT /note="SPAC9.07c, len:366, SIMILARITY:Saccharomyces FT cerevisiae, YAD6_YEAST, hypothetical 40.7 kD protein in FT pyk1-snc1 intergenic region, (369 aa), fasta scores: opt: FT 1747, E():0, (70.2% identity in 369 aa)" FT /product="putative GTP-binding protein" FT /fasta_file="fasta/c9.tab.seq.00318.out" FT misc_feature complement(join(1504612..1504725,1504776..1505575, FT 1505624..1505777)) FT /note="Match to PF01018 GTP1_OBG, GTP1/OBG family Score FT 571.82" FT misc_feature complement(1504726..1504738) FT /colour=6 FT /note="ctaacttctttag, splice branch and acceptor" FT intron complement(1504726..1504775) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1504770..1504775) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1505576..1505589) FT /colour=6 FT /note="ctaatctttcttag, splice branch and acceptor" FT intron complement(1505576..1505623) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1505618..1505623) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS complement(1506890..1507738) FT /colour=7 FT /gene="SPAC9.08c" FT /label=SPAC9.08c FT /note="SPAC9.08c, len:282, SIMILARITY:Caenorhabditis FT elegans., Q20344, f42f12.3 protein., (243 aa), fasta FT scores: opt: 259, E():2.8e-11, (35.5% identity in 197 aa)" FT /product="putative steroid reductase; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c9.tab.seq.00319.out" FT CDS 1508303..1510597 FT /colour=7 FT /gene="SPAC9.09" FT /label=SPAC9.09 FT /note="SPAC9.09, len:764, SIMILARITY:Saccharomyces FT cerevisiae, METE_YEAST, 5- FT methyltetrahydropteroyltriglutamate--homocysteine FT methyltransferase(ec 2.1.1.14), (766 aa), fasta scores: FT opt: 3002, E():0, (59.5% identity in 768 aa)" FT /product="putative Homocysteine methyltransferase (5- FT methyltetrahydropteroyltriglutamate--homocysteine FT methyltransferase); methionine synthase; similar to S. FT cerevisiae MET6" FT /fasta_file="fasta/c9.tab.seq.00320.out" FT CDS 1512510..1514285 FT /colour=7 FT /gene="SPAC9.10" FT /label=SPAC9.10 FT /note="SPAC9.10, len:591, SIMILARITY:Schizosaccharomyces FT pombe, P78767, fission yeast, (357 aa), fasta scores: opt: FT 964, E():0, (46.3% identity in 363 aa)" FT /product="APC amino acid transporter" FT /fasta_file="fasta/c9.tab.seq.00321.out" FT misc_feature 1512792..1514210 FT /colour=9 FT /note="Pfam match to entry PF00324 aa_permeases, Amino FT acid permease, score -185.10, E-value 8.7e-06" FT tRNA complement(1514655..1514737) FT /note="tRNA Met anticodon CAT, Cove score 54.77" FT intron complement(1514691..1514699) FT /note="intron tRNA Met anticodon CAT" FT CDS join(1515494..1515563,1515622..1516538) FT /colour=8 FT /gene="SPAC9.11" FT /label=SPAC9.11 FT /note="SPAC9.11, len:328" FT /product="predicted coiled-coil protein; sequence orphan" FT /fasta_file="fasta/c9.tab.seq.00322.out" FT misc_feature 1515564..1515569 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1515603..1515621 FT /colour=6 FT /note="ttaataaaataaaatacag, splice branch and acceptor" FT CDS complement(join(1516807..1516901,1516963..1517731)) FT /colour=2 FT /gene="atp12" FT /gene="SPAC9.12c" FT /label=atp12 FT /note="SPAC9.12c, len:287, SIMILARITY:Saccharomyces FT cerevisiae, ATPT_YEAST, atp12 protein ., (325 aa), fasta FT scores: opt: 236, E():8.4e-09, (30.9% identity in 307 aa)" FT /product="putative mitochondrial F1-F0 ATPase assembly FT complex; similar to S. cerevisiae ATP12" FT /fasta_file="fasta/c9.tab.seq.00323.out" FT misc_feature complement(1516902..1516913) FT /colour=6 FT /note="ctcacgaaatag, splice branch and acceptor" FT misc_feature complement(1516957..1516962) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1518855..1518973 FT /note="nominal overlap with PCR product SPAPJ735, S. pombe FT chromosome 1" FT BLASTN_HIT 1518855..1518973 FT /note="595 (+1) 34882 35000 SPAC9 S. pombe chromosome 1" FT misc_feature 1518855..1518973 FT /note="nominal overlap with cosmid SPAC9, EM:AL121764 S. FT pombe chromosome 1" FT BLASTN_HIT 1520560..1520716 FT /note="785 (+1) 1 157 SPAC5D6 S. pombe chromosome 1" FT misc_feature 1520560..1520716 FT /note="nominal overlap with cosmid SPAC5D6, EM:Z98056 S. FT pombe chromosome 1" FT misc_feature 1520560..1520716 FT /note="nominal overlap with PCR product SPAPJ735, S. pombe FT chromosome 1" FT CDS complement(1522556..1523500) FT /colour=8 FT /gene="SPAC5D6.12" FT /label=SPAC5D6.12 FT /note="SPAC5D6.12, len:315aa" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c5D6.tab.seq.00236.out" FT misc_feature complement(1523501..1526822) FT /note="compositionally biased region" FT CDS 1524346..1524753 FT /colour=8 FT /gene="SPAC5D6.10c" FT /label=SPAC5D6.10c FT /note="SPAC5D6.10c, len:135aa" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c5D6.tab.seq.00237.out" FT CDS 1526823..1527737 FT /colour=7 FT /gene="SPAC5D6.09c" FT /label=SPAC5D6.09c FT /note="SPAC5D6.09c, len:304, SIMILARITY:Saccharomyces FT cerevisiae, YCQ0_YEAST, hypothetical 30.7 kD protein, (283 FT aa), fasta scores: opt: 645, E():0, (39.8% identity in 289 FT aa)" FT /product="putative GPR/FUN34 family protein" FT /fasta_file="fasta/c5D6.tab.seq.00238.out" FT misc_feature 1527087..1527656 FT /note="Match to PF01184 Grp1_Fun34_YaaH, GPR1/FUN34/yaaH FT family Score 275.46" FT CDS join(1528861..1529034,1529110..1529241) FT /colour=12 FT /gene="mes1" FT /gene="SPAC5D6.08c" FT /label=mes1 FT /note="SPAC5D6.08c, len:101aa" FT /product="meiosis-ii protein" FT /fasta_file="fasta/c5D6.tab.seq.00239.out" FT misc_feature 1529035..1529040 FT /colour=6 FT /note="gttagt, splice donor sequence" FT misc_feature 1529092..1529109 FT /colour=6 FT /note="ctaacattttatttacag, splice branch and acceptor FT seque nce" FT CDS 1530601..1532088 FT /colour=10 FT /gene="SPAC5D6.07c" FT /label=SPAC5D6.07c FT /note="SPAC5D6.07c, len:495aa" FT /product="hypothetical protein; contains PXA domain" FT /fasta_file="fasta/c5D6.tab.seq.00240.out" FT CDS join(1532585..1533049,1533096..1533263) FT /colour=7 FT /gene="SPAC5D6.06c" FT /label=SPAC5D6.06c FT /note="SPAC5D6.06c, len:210aa; similarity: to YBR070C, FT YBS0 _YEAST, P38242, osmotolerence protein, (237aa), fasta FT score s, opt:357, E():2.7e-17, (37.3% identity in 193 aa FT overlap )" FT /note="SPAC5D6.06c, len:209, SIMILARITY:Saccharomyces FT cerevisiae, YBS0_YEAST, hypothetical 27.0 kD protein in FT val1-hsp26 intergenic region., (237 aa), fasta scores: FT opt: 357, E():5.1e-17, (37.3% identity in 193 aa)" FT /product="putative glycosyl transferase" FT /fasta_file="fasta/c5D6.tab.seq.00241.out" FT misc_feature 1533050..1533055 FT /colour=6 FT /note="gtataa, splice donor sequence" FT misc_feature 1533086..1533095 FT /colour=6 FT /note="ctaactgataatag, splice branch and acceptor sequence" FT CDS complement(join(1533583..1533850,1533904..1534026, FT 1534080..1534185,1534288..1534414)) FT /colour=2 FT /gene="sep11" FT /gene="SPAC5D6.05" FT /label=sep11 FT /note="SPAC5D6.05, len:207aa" FT /product="required for efficient cell separation (PMID: FT 10392445); no apparent orthologs" FT /fasta_file="fasta/c5D6.tab.seq.00242.out" FT misc_feature complement(1533851..1533865) FT /colour=6 FT /note="ttgatcccttcgcag, splice branch and acceptor" FT misc_feature complement(1533898..1533903) FT /colour=6 FT /note="gtttgt, splice donor sequence" FT misc_feature complement(1534027..1534038) FT /colour=6 FT /note="ctaattagtcag, splice branch and acceptor sequence" FT intron complement(1534027..1534079) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1534074..1534079) FT /colour=6 FT /note="gtttgt, splice donor sequence" FT misc_feature complement(1534186..1534202) FT /colour=6 FT /note="ctaactttgaattgaag, splice branch and acceptor FT sequen ce" FT intron complement(1534186..1534287) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1534282..1534287) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS complement(join(1535267..1536259,1536317..1536407, FT 1536444..1536574,1536704..1536847)) FT /colour=10 FT /gene="SPAC5D6.04" FT /label=SPAC5D6.04 FT /note="SPAC5D6.04, len:452aa; similarity: to YBR287W, FT YB8B_ YEAST, P38355, hypothetical 47.5 kD protein, (427 FT aa), fast a scores, opt:529, E():3.2e-28, (35.8% identity FT in 438 aa overlap)" FT /product="hypothetical protein; similar to S. cerevisiae FT YBR287W; contains 6 predicted transmembrane helices" FT /fasta_file="fasta/c5D6.tab.seq.00243.out" FT misc_feature complement(1536260..1536271) FT /colour=6 FT /note="ctaactctttag, splice branch and acceptor sequence" FT misc_feature complement(1536311..1536316) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(1536408..1536418) FT /colour=6 FT /note="ctaactttcag, splice branch and acceptor sequence" FT misc_feature complement(1536438..1536443) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1536575..1536588) FT /colour=6 FT /note="ctaactttacag, splice branch and acceptor sequence" FT misc_feature complement(1536698..1536703) FT /colour=6 FT /note="gtatga, splice donor sequence" FT CDS 1540052..1540954 FT /colour=8 FT /gene="SPAC5D6.02c" FT /label=SPAC5D6.02c FT /note="SPAC5D6.02c, len:300aa" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c5D6.tab.seq.00244.out" FT CDS complement(1541473..1541865) FT /colour=2 FT /gene="rps15a-2" FT /gene="rps22-2" FT /gene="SPAC5D6.01" FT /label=rps15a-2 FT /note="SPAC5D6.01, len:130aa" FT /product="40S ribosomal protein S15a(s22)" FT /fasta_file="fasta/c5D6.tab.seq.00245.out" FT misc_feature complement(1541476..1541853) FT /note="Match to PF00410 Ribosomal_S8, Ribosomal protein S8 FT Score 198.86" FT misc_feature complement(1541515..1541568) FT /colour=8 FT /note="PS00053 Ribosomal protein S8 signature" FT misc_feature complement(1541875..1542021) FT /colour=6 FT /note="putative upstream intron, makes promoter proximal" FT promoter complement(1542109..1542116) FT /colour=4 FT /note="Homol D box" FT promoter complement(1542122..1542131) FT /colour=4 FT /note="Homol E box" FT misc_feature complement(1542379..1542411) FT /note="nominal overlap with cosmid SPAC57A7, EM:Z95396 FT S.pombe chromosome 1" FT misc_feature complement(1542379..1542411) FT /colour=3 FT /note="nominal overlap with cosmid SPAC5D6, EM:Z98056 FT S.pombe chromosome 1" FT CDS complement(join(1542440..1543042,1543085..1543690, FT 1543762..1543992,1544047..1544304)) FT /colour=7 FT /gene="SPAC57A7.13" FT /label=SPAC57A7.13 FT /note="SPAC57A7.13, len:564, SIMILARITY: LOW to Homo FT sapiens, Q14136, kiaa0122 protein, (1010 aa), fasta FT scores: opt: 288, E():3.9e-11, (38.9% identity in 113 aa)" FT /product="RNA-binding protein; rrm rNA recognition motifs FT (2); G-patch domain; similar to human tumor suppressor FT luca15; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c57A7.tab.seq.00040.out" FT misc_feature complement(1543043..1543055) FT /colour=6 FT /note="ctgatatgtatag, splice branch and acceptor sequence" FT misc_feature complement(1543079..1543084) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1543441..1543674) FT /colour=9 FT /note="Pfam match to entry PF00076 rrm, RNA recognition FT mot if" FT misc_feature complement(1543691..1543706) FT /colour=6 FT /note="ctaactgttggagtag, splice branch and acceptor FT sequenc e" FT misc_feature complement(1543756..1543761) FT /colour=6 FT /note="gtaaac, splice donor sequence" FT misc_feature complement(1543867..1544088) FT /colour=9 FT /note="Pfam match to entry PF00076 rrm, RNA recognition FT mot if" FT misc_feature complement(1543993..1544011) FT /colour=6 FT /note="ctaacaaaaatgcgtgaag, splice branch and acceptor FT sequ ence" FT misc_feature complement(1544041..1544046) FT /colour=6 FT /note="gtgtga, splice donor sequence" FT CDS complement(join(1544765..1546339,1546465..1546590)) FT /colour=7 FT /fasta_file="fasta/c57A7.tab.seq.00028.out" FT /gene="SPAC57A7.12" FT /label=SPAC57A7.12 FT /note="SPAC57A7.12, len:566, SIMILARITY:Saccharomyces FT cerevisiae, YHM4_YEAST, heat shock protein 70 homolog FT yhr064c., (572 aa), fasta scores: opt: 1320, E():0, (40.3% FT identity in 571 aa)" FT /product="heat shock protein 70 family" FT misc_feature complement(1544911..1546515) FT /colour=9 FT /note="Pfam match to entry PF00012 HSP70, Hsp70 protein" FT misc_feature complement(1546340..1546355) FT /colour=6 FT /note="ctaacaaatcaaacag, splice branch and acceptor FT sequenc e" FT intron complement(1546340..1546464) FT /note="confirmed by mRNA" FT misc_feature complement(1546459..1546464) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT CDS complement(1547025..1550966) FT /colour=2 FT /fasta_file="fasta/c57A7.tab.seq.00029.out" FT /gene="mip1" FT /gene="SPAC57A7.11" FT /label=mip1 FT /note="SPAC57A7.11, len:1312, SIMILARITY:Saccharomyces FT cerevisiae, YHY6_YEAST, hypothetical 175.8 kD protein, FT (1541 aa), fasta scores: opt: 1027, E():0, (39.2% identity FT in 1551 aa)" FT /product="WD repeat protein; facilitates function of the FT meiotic regulator Mei2p" FT misc_feature complement(1547343..1547387) FT /colour=8 FT /note="PS00678 Beta-transducin family Trp-Asp repeats FT signa ture" FT CDS join(1551388..1551418,1551463..1553513,1553573..1554208) FT /colour=2 FT /fasta_file="fasta/c57A7.tab.seq.00030.out" FT /gene="sec21" FT /gene="SPAC57A7.10c" FT /label=sec21 FT /note="SPAC57A7.10c, len:905, SIMILARITY:Saccharomyces FT cerevisiae, COPG_YEAST, coatomer gamma subunit, (935 aa), FT fasta scores: opt: 1542, E():0, (37.9% identity in 928 aa)" FT /product="putative coatomer gamma subunit" FT misc_feature 1551419..1551424 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1551453..1551462 FT /colour=6 FT /note="ttaacaatag, splice branch and acceptor sequence" FT misc_feature 1553514..1553519 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1553560..1553572 FT /colour=6 FT /note="ctaatgcttttag, splice branch and acceptor sequence" FT CDS complement(1554707..1555825) FT /colour=10 FT /fasta_file="fasta/c57A7.tab.seq.00031.out" FT /gene="SPAC57A7.09" FT /label=SPAC57A7.09 FT /note="SPAC57A7.09, len:372" FT /product="zinc finger protein; zf-C3HC4 type (RING FT finger); protease associated (PA) domain" FT misc_feature complement(1554740..1554865) FT /note="Match to PF00097 zf-C3HC4, zinc finger, C3HC4 type FT (RING finger) Score 42.03" FT tRNA complement(1556764..1556857) FT /note="tRNA Leu anticodon CAG, Cove score 60.97" FT CDS complement(1557640..1559187) FT /colour=2 FT /fasta_file="fasta/c57A7.tab.seq.00032.out" FT /gene="phz1" FT /gene="SPAC57A7.08" FT /label=phz1 FT /note="SPAC57A7.08, len:515" FT /product="serine-threonine protein phosphatase pp-z; FT subcellular localization of GFP fusion- Cytoplasm and FT nuclear rim" FT misc_feature complement(1557733..1558614) FT /note="Match to PF00149 STphosphatase, Ser/Thr protein FT phosphatase Score 635.86" FT CDS 1559865..1560791 FT /colour=7 FT /fasta_file="fasta/c57A7.tab.seq.00033.out" FT /gene="SPAC57A7.07c" FT /label=SPAC57A7.07c FT /note="SPAC57A7.07c, len:308, SIMILARITY:Escherichia coli., FT MMUM_ECOLI, homocysteine s-methyltransferase, (310 aa), FT fasta scores: opt: 195, E():9.8e-06, (21.6% identity in FT 320 aa)" FT /product="putative homocysteine methyltransferase" FT CDS complement(join(1560989..1563514,1563561..1563824)) FT /colour=10 FT /fasta_file="fasta/c57A7.tab.seq.00034.out" FT /gene="SPAC57A7.06" FT /label=SPAC57A7.06 FT /note="SPAC57A7.06, len:929, SIMILARITY:Saccharomyces FT cerev isiae, YMJ3_YEAST, hypothetical 103.0 kD protein in FT rad10-p rs4 intergenic region., (899 aa), fasta scores: FT opt: 759, E ():1.2e-32, (32.4% identity in 977 aa)" FT /note="SPAC57A7.06, len:928, SIMILARITY:Saccharomyces FT cerevisiae, YMJ3_YEAST, hypothetical 103.0 kD protein in FT rad10-prs4 intergenic region., (899 aa), fasta scores: FT opt: 759, E():1.2e-32, (32.4% identity in 977 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YML093W null lethal; GFP fusion nuclear; predicted coiled- FT coil" FT misc_feature complement(1563515..1563529) FT /colour=6 FT /note="ctaacacatttttag, splice branch and acceptor FT sequence" FT misc_feature complement(1563555..1563560) FT /colour=6 FT /note="gtaaat, splice donor sequence" FT CDS complement(1564264..1568277) FT /colour=10 FT /fasta_file="fasta/c57A7.tab.seq.00035.out" FT /gene="SPAC57A7.05" FT /label=SPAC57A7.05 FT /note="SPAC57A7.05, len:1336, SIMILARITY: LOW to FT Saccharomyces cerevisiae, Q07660, orf ydl231c., (1125 aa), FT fasta scores: opt: 199, E():0.00036, (20.5% identity in FT 366 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YDL231C at the C-term; contains 11 predicted transmembrane FT helices; leucine-serine rich" FT misc_feature complement(1568280..1572540) FT /note="low complexity region" FT CDS 1572541..1574502 FT /colour=2 FT /fasta_file="fasta/c57A7.tab.seq.00036.out" FT /gene="pab1" FT /gene="SPAC57A7.04c" FT /gene="pabp" FT /label=pab1 FT /note="SPAC57A7.04c, len:653" FT /product="poly(A) binding protein; polyadenylation factor" FT misc_feature 1572784..1572999 FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 92.78" FT misc_feature 1573048..1573260 FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 90.88" FT misc_feature 1573327..1573539 FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 108.03" FT misc_feature 1573636..1573848 FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 90.59" FT misc_feature 1574248..1574463 FT /note="Match to PF00658 PABP, Poly-adenylate binding FT protein, unique domain. Score 158.99" FT misc_feature join(1578361..1579163,1579222..1579278,1579323..1579368) FT /note="Match to PF00632 HECT, HECT-domain (ubiquitin- FT transferase). Score 256.86" FT misc_feature complement(1578539..1581479) FT /note="nominal overlap with cosmid SPAC167, EM:AL035248 S. FT pombe chromosome 1" FT misc_feature 1579164..1579169 FT /colour=6 FT /note="gtaggt, splice donor sequence" FT misc_feature 1579204..1579221 FT /colour=6 FT /note="ctaacgtatttattatag, splice branch and acceptor FT seque nce" FT misc_feature 1579279..1579284 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1579308..1579322 FT /colour=6 FT /note="ctaaccaatgtttag, splice branch and acceptor FT sequence" FT misc_feature complement(1581479) FT misc_feature complement(1578539..1581479) FT /note="nominal overlap with cosmid SPAC57A7, EM:Z95396 S. FT pombe chromosome 1" FT misc_feature join(1578541..1579163,1579222..1579278,1579323..1579368) FT /note="Match to PF00632 HECT, HECT-domain (ubiquitin- FT transferase). Score 161.37" FT misc_feature 1579164..1579169 FT /colour=6 FT /note="gtaggt, splice donor sequence" FT misc_feature 1579204..1579221 FT /colour=6 FT /note="ctaacgtatttattatag, splice branch and acceptor" FT misc_feature 1579279..1579284 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1579308..1579322 FT /colour=6 FT /note="ctaaccaatgtttag, splice branch and acceptor" FT CDS complement(join(1583677..1583748,1583811..1583842, FT 1583890..1583968,1584057..1584467)) FT /colour=10 FT /gene="SPAC167.04" FT /label=SPAC167.04 FT /note="SPAC167.04, len:197, SIMILARITY:Saccharomyces FT cerevisiae), YK45_YEAST, hypothetical 22.0 kD protein in FT las1-ccp1 intergenic region., (197 aa), fasta scores: opt: FT 463, E():1.2e-24, (42.4% identity in 165 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YKR065C; Pfam-B_21729" FT /fasta_file="fasta/c167.tab.seq.00129.out" FT misc_feature complement(1583749..1583765) FT /colour=6 FT /note="ctaacttttatgcaaag, splice branch and acceptor" FT misc_feature complement(1583805..1583810) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1583843..1583857) FT /colour=6 FT /note="ctaactcttaattag, splice branch and acceptor" FT misc_feature complement(1583884..1583889) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature complement(1583969..1583980) FT /colour=6 FT /note="ttaattttttag, splice branch and acceptor" FT misc_feature complement(1584051..1584056) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT CDS 1584810..1586759 FT /colour=2 FT /gene="snu66" FT /gene="SPAC167.03c" FT /label=snu66 FT /note="SPAC167.03c, len:649, SIMILARITY:Homo sapiens), FT O43290, sart-1., (800 aa), fasta scores: opt: 349, FT E():2.3e-11, (24.9% identity in 699 aa)" FT /product="putative pre-mRNA splicing factor; putative FT U4/U6.U5 snRNP component; predicted coiled-coil; similar FT to S. cerevisiae SNU66" FT /fasta_file="fasta/c167.tab.seq.00130.out" FT CDS complement(join(1586823..1587086,1587132..1587265, FT 1587304..1587519,1587574..1587690,1587746..1587896, FT 1587944..1587997)) FT /colour=2 FT /gene="ptb1" FT /gene="SPAC167.02" FT /note="SPAC167.02, len:311" FT /product="type ii proteins geranylgeranyltransferase beta FT subunit" FT /fasta_file="fasta/c167.tab.seq.00131.out" FT misc_feature complement(1586895..1587029) FT /note="Match to PF00432 prenyltrans, Prenyltransferase and FT squalene oxidase repeats Score 49.80" FT misc_feature complement(1587087..1587099) FT /colour=6 FT /note="ctaatagttctag, splice branch and acceptor" FT misc_feature complement(1587126..1587131) FT /colour=6 FT /note="gtacga, splice donor sequence" FT misc_feature complement(1587126..1587218) FT /note="Match to PF00432 prenyltrans, Prenyltransferase and FT squalene oxidase repeats Score 27.52" FT misc_feature complement(join(1587231..1587265,1587304..1587397)) FT /note="Match to PF00432 prenyltrans, Prenyltransferase and FT squalene oxidase repeats Score 47.62" FT misc_feature complement(1587266..1587277) FT /colour=6 FT /note="ttgaccctaatag, splice branch and acceptor" FT misc_feature complement(1587298..1587303) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1587413..1587517) FT /note="Match to PF00432 prenyltrans, Prenyltransferase and FT squalene oxidase repeats Score 37.06" FT misc_feature complement(join(1587413..1587519,1587574..1587598)) FT /note="Pfam match to entry PF00432 prenyltrans, FT Prenyltransferase and squalene oxidase repeats" FT misc_feature complement(1587520..1587538) FT /colour=6 FT /note="ctaattataaataattag, splice branch and acceptor" FT misc_feature complement(1587568..1587573) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(join(1587611..1587690,1587746..1587797)) FT /note="Match to PF00432 prenyltrans, Prenyltransferase and FT squalene oxidase repeats Score 33.75" FT misc_feature complement(1587691..1587705) FT /colour=6 FT /note="ctaacaatgagttag, splice branch and acceptor" FT misc_feature complement(1587740..1587745) FT /colour=6 FT /note="gttagt, splice donor sequence" FT misc_feature complement(1587897..1587907) FT /colour=6 FT /note="cttacaaacag, splice branch and acceptor" FT misc_feature complement(1587938..1587943) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT CDS complement(join(1589142..1589315,1589366..1592410)) FT /colour=7 FT /gene="SPAC167.01" FT /label=SPAC167.01 FT /note="SPAC167.01, len:1072, SIMILARITY:Saccharomyces FT cerevisiae), IRE1_YEAST, serine/threonine-protein kinase FT ire1 , (1115 aa), fasta scores: opt: 645, E():3.3e-28, FT (29.3% identity in 1130 aa)" FT /product="putative serine/threonine protein kinase" FT /fasta_file="fasta/c167.tab.seq.00132.out" FT misc_feature complement(1589316..1589332) FT /colour=6 FT /note="ctaacttccttttttag, splice branch and acceptor" FT misc_feature complement(1589360..1589365) FT /colour=6 FT /note="gtatta, splice donor sequence" FT misc_feature complement(1589597..1590439) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 178.14" FT misc_feature complement(1589597..1590451) FT /note="Pfam match to entry PF00069 pkinase, Eukaryotic FT prot ein kinase domain" FT LTR complement(1593493..1593841) FT /note="tf2 type LTR associated with full length tf2" FT misc_feature complement(1593493..1597538) FT /note="tf2 retrotransposable element" FT misc_feature complement(1596049..1596588) FT /note="Pfam match to entry PF00078 Reverse transcriptase FT (RNA-dependent DNA polymerase)" FT misc_feature 1597442..1597538 FT /note="nominal overlap with cosmid SPAC1705, S. pombe FT chromosome 1" FT misc_feature 1597442..1597538 FT /note="nominal overlap with cosmid SPAC167, EM:AL035248 FT S.pombe chromosome 1" FT misc_feature 1597743..1599799 FT /note="Nominal overlap with old SPAC1F2 Z98976 S.pombe FT chromosome I cosmid c1F2 (removed from EMBL as redundant)" FT LTR complement(1598060..1598408) FT /note="Tf2-type LTR" FT CDS join(1598539..1598545,1598740..1598836,1598892..1598979) FT /colour=10 FT /gene="SPAC1705.02" FT /gene="SPAC1F2.02c" FT /label=SPAC1705.02 FT /note="SPAC1F2.02c, len:63, SIMILARITY: H. sapiens, O75919, FT 4F5S., (62 aa), fasta scores, FT opt:147, E(): 0.00051, (43.1% identity in 58 aa overlap)" FT /product="eukaryotic conserved protein; human 4F5S homolog" FT /fasta_file="fasta/c1705.tab.seq.02195.out" FT misc_feature 1598546..1598551 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT intron 1598546..1598739 FT /colour=2 FT /note="confirmed intron" FT misc_feature 1598727..1598739 FT /colour=6 FT /note="ctaatgttactag, splice branch and acceptor" FT misc_feature 1598837..1598842 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT intron 1598837..1598891 FT /colour=2 FT /note="confirmed intron" FT misc_feature 1598879..1598891 FT /colour=6 FT /note="ctaatattttaag, splice branch and acceptor" FT misc_feature 1599699..1599799 FT /note="nominal overlap with cosmid SPAC23H4, EM:Z98977 FT S.pombe chromosome 1" FT misc_feature 1599699..1599799 FT /note="nominal overlap with cosmid SPAC1705, S. pombe FT chromosome 1" FT misc_feature complement(1599699..1599841) FT /note="nominal overlap with cosmid SPAC1F2, EM:Z98976 S. FT pombe chromosome 1" FT misc_RNA complement(1604522..1604779) FT /note="possible/similarity" FT CDS join(1605086..1605160,1605349..1605498,1605562..1605652, FT 1605697..1605704) FT /colour=2 FT /gene="pip1" FT /gene="SPAC23H4.18c" FT /label=pip1 FT /note="SPAC23H4.18c, len:112" FT /product="putative subunit of the SCF-Pop ubiquitin ligase FT complex; pop-interacting protein 1" FT /fasta_file="fasta/c23H4.tab.seq.01542.out" FT misc_feature 1605161..1605166 FT /colour=6 FT /note="gttcgt, splice donor sequence" FT intron 1605161..1605348 FT /colour=2 FT /note="confirmed intron" FT misc_feature 1605333..1605348 FT /colour=6 FT /note="cttaccttcaatttag, splice branch and acceptor" FT misc_feature 1605499..1605504 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT intron 1605499..1605561 FT /colour=2 FT /note="confirmed intron" FT misc_feature 1605546..1605561 FT /colour=6 FT /note="ttaacaaatacaaaag, splice branch and acceptor" FT misc_feature 1605653..1605658 FT /colour=6 FT /note="gtaggg, splice donor sequence" FT misc_feature 1605682..1605696 FT /colour=6 FT /note="ctaactttatctcag, splice branch and acceptor" FT CDS 1606530..1607588 FT /colour=7 FT /gene="SPAC23H4.17c" FT /label=SPAC23H4.17c FT /note="SPAC23H4.17c, len:351, SIMILARITY:Saccharomyces FT cerevisiae, UME5_YEAST, meiotic mRNA stability protein FT kinase ume5, (541 aa), fasta scores: opt: 1146, E():0, FT (53.3% identity in 300 aa)" FT /product="putative serine/threonine protein kinase; FT putative RNA polymerase II holoenzyme complex and FT Kornberg's mediator (SRB) subcomplex" FT /fasta_file="fasta/c23H4.tab.seq.01543.out" FT misc_feature 1606542..1607486 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 273.07" FT misc_feature 1606935..1606973 FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT CDS join(1607990..1608121,1608168..1608332,1608469..1608660, FT 1608719..1609216) FT /colour=8 FT /gene="SPAC23H4.16c" FT /label=SPAC23H4.16c FT /note="SPAC23H4.16c, len:327" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c23H4.tab.seq.01544.out" FT misc_feature 1608122..1608127 FT /colour=6 FT /note="gtacta, splice donor sequence" FT misc_feature 1608154..1608167 FT /colour=6 FT /note="ctaacttgccatag, splice branch and acceptor" FT misc_feature 1608333..1608338 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1608455..1608468 FT /colour=6 FT /note="ctaactatgcatag, splice branch and acceptor" FT misc_feature 1608661..1608666 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 1608702..1608718 FT /colour=6 FT /note="ctgacatttcgctttag, splice branch and acceptor" FT CDS complement(1609432..1611783) FT /colour=10 FT /gene="SPAC23H4.15" FT /label=SPAC23H4.15 FT /note="SPAC23H4.15, len:782, SIMILARITY:Saccharomyces FT cerevisiae, Q07381, chromosome iv reading frame orf FT ydl060w., (788 aa), fasta scores: opt: 1961, E():0, (41.2% FT identity in 792 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YDL060W - null lethal; Pfam-B_1475 and Pfam-B_6211" FT /fasta_file="fasta/c23H4.tab.seq.01545.out" FT misc_feature complement(1610314..1610340) FT /colour=8 FT /note="PS00215 Mitochondrial energy transfer proteins FT signa ture" FT CDS complement(join(1612201..1612273,1612333..1614721, FT 1614768..1614872,1614924..1615001,1615047..1615119)) FT /colour=2 FT /gene="vps39" FT /gene="SPAC23H4.14" FT /label=vps39 FT /note="SPAC23H4.14, len:904, SIMILARITY:Saccharomyces FT cerevisiae, VP39_YEAST, vacuolar assembly protein vps39, FT (1049 aa), fasta scores: opt: 380, E():4.5e-16, (26.5% FT identity in 486 aa)" FT /product="putative vacuolar sorting protein" FT /fasta_file="fasta/c23H4.tab.seq.01546.out" FT misc_feature complement(1612274..1612292) FT /colour=6 FT /note="ctaaccttcatttaacaag, splice branch and acceptor" FT misc_feature complement(1612327..1612332) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1614722..1614734) FT /colour=6 FT /note="ttaacttttttag, splice branch and acceptor" FT misc_feature complement(1614762..1614767) FT /colour=6 FT /note="gtaaac, splice donor sequence" FT misc_feature complement(1614873..1614892) FT /colour=6 FT /note="ttaataaatcttataaatag, splice branch and acceptor" FT misc_feature complement(1614918..1614923) FT /colour=6 FT /note="gtatgg, splice donor sequence" FT misc_feature complement(1615002..1615015) FT /colour=6 FT /note="ctaatggataatag, splice branch and acceptor" FT misc_feature complement(1615041..1615046) FT /colour=6 FT /note="gtatga, splice donor sequence" FT CDS join(1616369..1616539,1616620..1617003) FT /colour=9 FT /gene="SPAC23H4.13c" FT /label=SPAC23H4.13c FT /note="SPAC23H4.13c, len:184aa; nonconsensus branch" FT /product="very hypothetical protein" FT /fasta_file="fasta/c23H4.tab.seq.01547.out" FT misc_feature 1616540..1616545 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1616605..1616619 FT /colour=6 FT /note="ctcaccaaattctag, splice branch and acceptor" FT CDS complement(join(1617165..1617249,1617299..1618227)) FT /colour=2 FT /gene="alp13" FT /gene="SPAC23H4.12" FT /label=alp13 FT /note="SPAC23H4.12, len:336" FT /product="chromodomain protein; required for cell polarity" FT /fasta_file="fasta/c23H4.tab.seq.01548.out" FT misc_feature complement(1617250..1617265) FT /colour=6 FT /note="ctaaccatttatttag, splice branch and acceptor" FT misc_feature complement(1617293..1617298) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS join(1618631..1619067,1619139..1619268) FT /colour=8 FT /gene="SPAC23H4.11c" FT /label=SPAC23H4.11c FT /note="SPAC23H4.11c, len:188aa" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c23H4.tab.seq.01549.out" FT misc_feature 1619068..1619073 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 1619121..1619138 FT /colour=6 FT /note="ctaataatttctttctag, splice branch and acceptor" FT CDS 1619776..1621332 FT /EC_number="2.7.1.50" FT /colour=2 FT /gene="thi4" FT /gene="SPAC23H4.10c" FT /label=thi4 FT /note="SPAC23H4.10c, len:517" FT /product="thiamine biosynthetic bifunctional enzyme FT [includes:thiamine-phosphate pyrophosphorylase]" FT /fasta_file="fasta/c23H4.tab.seq.01550.out" FT CDS complement(1621614..1622759) FT /colour=2 FT /gene="cdb4" FT /gene="SPAC23H4.09" FT /label=cdb4 FT /note="SPAC23H4.09, len:380" FT /product="curved DNA-binding protein??; metallopeptidase FT M24 family; similar to human and mouse P38-2G4 cell cycle FT protein; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c23H4.tab.seq.01551.out" FT misc_feature complement(1621983..1622717) FT /note="Match to PF00557 Peptidase_M24, metallopeptidase FT family M24 Score 265.56" FT CDS complement(join(1623066..1623456,1623546..1623858, FT 1623948..1624016,1624070..1624130)) FT /colour=8 FT /gene="SPAC23H4.08" FT /label=SPAC23H4.08 FT /product="hypothetical protein; sequence orphan; 4 FT predicted exons; confirmed intron" FT /fasta_file="fasta/c23H4.tab.seq.01552.out" FT misc_feature complement(1623457..1623469) FT /colour=6 FT /note="ctaacattcatag, splice branch and acceptor" FT intron complement(1623457..1623545) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1623540..1623545) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1623859..1623872) FT /colour=6 FT /note="ttgacagtttctag, splice branch and acceptor" FT misc_feature complement(1623942..1623947) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature complement(1624017..1624036) FT /colour=6 FT /note="ctaactccttaataatttag, splice branch and acceptor" FT misc_feature complement(1624064..1624069) FT /colour=6 FT /note="gtacga, splice donor sequence" FT CDS join(1624871..1625038,1625087..1625602) FT /colour=2 FT /gene="srp102" FT /gene="SPAC23H4.07c" FT /label=srp102 FT /note="SPAC23H4.07c, len:226, SIMILARITY: S. cerevisiae FT YKL154W, SRPB_YEAST, P36057, putative signal recognition FT particle, (244aa), fasta scor es, opt:269, E(): 2.9e-09, FT (28.8% identity in 240 aa overlap)" FT /product="putative signal recognition particle receptor FT beta subunit" FT /fasta_file="fasta/c23H4.tab.seq.01553.out" FT misc_feature 1625000..1625023 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 1625039..1625044 FT /colour=6 FT /note="gtataa, splice donor sequence" FT intron 1625039..1625086 FT /colour=2 FT /note="confirmed intron" FT misc_feature 1625072..1625086 FT /colour=6 FT /note="ttaactgttatatag, splice branch and acceptor" FT CDS complement(1626168..1627247) FT /EC_number="6.3.1.2" FT /colour=2 FT /gene="gln1" FT /gene="SPAC23H4.06" FT /label=gln1 FT /note="SPAC23H4.06, len:358" FT /product="glutamine synthetase" FT /fasta_file="fasta/c23H4.tab.seq.01554.out" FT misc_feature complement(1626201..1627169) FT /note="Match to PF00120 gln-synt, Glutamine synthetase FT Score 554.06" FT misc_feature complement(1626474..1626524) FT /colour=8 FT /note="PS00181 Glutamine synthetase putative ATP-binding FT re gion signature" FT misc_feature complement(1627008..1627061) FT /colour=8 FT /note="PS00180 Glutamine synthetase signature 1" FT CDS 1629007..1629300 FT /colour=9 FT /gene="SPAC23H4.05c" FT /label=SPAC23H4.05c FT /note="SPAC23H4.05c, len:97aa" FT /product="very hypothetical protein" FT /fasta_file="fasta/c23H4.tab.seq.01555.out" FT CDS complement(join(1631184..1632269,1632357..1632418, FT 1632463..1632562)) FT /EC_number="2.1.1.61" FT /colour=7 FT /gene="SPAC23H4.04" FT /label=SPAC23H4.04 FT /note="SPAC23H4.04, len:414, SIMILARITY:Saccharomyces FT cerevisiae, TRMU_YEAST, putative tRNA, (417 aa), fasta FT scores: opt: 807, E():0, (37.1% identity in 394 aa)" FT /product="putative tRNA methyltransferase" FT /fasta_file="fasta/c23H4.tab.seq.01556.out" FT misc_feature complement(1632270..1632285) FT /colour=6 FT /note="ctaaactttggtttag, splice branch and acceptor" FT misc_feature complement(1632351..1632356) FT /colour=6 FT /note="gtaatt, splice donor sequence" FT misc_feature complement(1632419..1632435) FT /colour=6 FT /note="ctaataatgtttttaag, splice branch and acceptor" FT misc_feature complement(1632457..1632462) FT /colour=6 FT /note="gttcgt, splice donor sequence" FT tRNA complement(1632981..1633052) FT /note="tRNA Thr anticodon AGT, Cove score 75.01" FT CDS join(1633751..1634072,1634206..1634534) FT /colour=2 FT /gene="erv25" FT /gene="SPAC23H4.03c" FT /label=erv25 FT /note="SPAC23H4.03c, len:215, SIMILARITY:Saccharomyces FT cerevisiae, ERV5_YEAST, erv25 protein ., (211 aa), fasta FT scores: opt: 540, E():8.1e-29, (36.9% identity in 214 aa)" FT /product="putative COPII-coated vesicle" FT /fasta_file="fasta/c23H4.tab.seq.01557.out" FT misc_feature join(1633769..1634072,1634206..1634528) FT /note="Match to PF01105 EMP24_GP25L, emp24/gp25L/p24 FT family Score 278.89" FT misc_feature 1634073..1634078 FT /colour=6 FT /note="gtatgg, splice donor sequence" FT misc_feature 1634189..1634205 FT /colour=6 FT /note="ctgacatttaaatgtag, splice branch and acceptor" FT CDS complement(join(1634996..1636479,1636651..1636765)) FT /colour=7 FT /gene="SPAC23H4.02" FT /label=SPAC23H4.02 FT /note="SPAC23H4.02, len:531, SIMILARITY:Cochliobolus FT carbonum, AAD43341, serine threonine protein kinase snf1p., FT (880 aa), fasta scores: opt: 932, E():0, (36.3% identity FT in 452 aa)" FT /product="putative serine/threonine protein kinase" FT /fasta_file="fasta/c23H4.tab.seq.01558.out" FT misc_feature complement(1635158..1635175) FT /colour=8 FT /note="PS00190 Cytochrome c family heme-binding site FT signat ure" FT misc_feature complement(join(1635773..1636479,1636651..1636699)) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 275.38" FT misc_feature complement(1636136..1636174) FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT misc_feature complement(1636480..1636491) FT /colour=6 FT /note="ctaacagtgtag, splice branch and acceptor" FT misc_feature complement(1636645..1636650) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1639968..1640085 FT /note="nominal overlap with plasmid p27G11, EM:AL157917 S. FT pombe chromosome 1" FT misc_feature 1639968..1640085 FT /note="nominal overlap with cosmid SPAC23H4 EM:Z98977 S. FT pombe chromosome 1" FT CDS 1641240..1642310 FT /colour=10 FT /gene="SPAP27G11.02" FT /label=SPAP27G11.02 FT /note="SPAP27G11.02, len:356, predicted to contain coiled- FT coil region" FT /product="hypothetical protein; similar to S. cerevisiae FT YKL133C (low)" FT /fasta_file="fasta/p27G11.tab.seq.00186.out" FT CDS join(1642861..1643530,1643599..1643888) FT /colour=10 FT /gene="SPAP27G11.03" FT /label=SPAP27G11.03 FT /note="SPAP27G11.03, len:319, SIMILARITY:Saccharomyces FT cerevisiae, Q05791, YLR215C, chromosome xii cosmid 8167., FT (360 aa), fasta scores: opt: 646, E():0, (37.1% identity FT in 340 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT CDC123" FT /fasta_file="fasta/p27G11.tab.seq.00187.out" FT misc_feature 1643531..1643536 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1643584..1643598 FT /colour=6 FT /note="ctaacttgaaaatag, splice branch and acceptor" FT CDS complement(join(1644177..1645012,1645056..1645167)) FT /colour=7 FT /gene="SPAP27G11.04c" FT /label=SPAP27G11.04c FT /note="SPAP27G11.04c, len:315, SIMILARITY:Saccharomyces FT oviformis, CAB60630, tRNA-specific adenosine-34 deaminase FT subunit tad3p/adat3., (322 aa), fasta scores: opt: 346, FT E():9.8e-17, (26.5% identity in 291 aa)" FT /product="putative subunit of tRNA-specific adenosine-34 FT deaminase" FT /fasta_file="fasta/p27G11.tab.seq.00188.out" FT misc_feature complement(1644321..1644578) FT /note="Match to PF00383 dCMP_cyt_deam, Cytidine and FT deoxycytidylate deaminase zinc binding region Score 28.26" FT misc_feature complement(1645013..1645025) FT /colour=6 FT /note="ctgacaaaagaag, splice branch and acceptor" FT misc_feature complement(1645050..1645055) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS complement(join(1645606..1647803,1647867..1648025, FT 1648067..1648208,1648259..1648420)) FT /colour=2 FT /gene="vps41" FT /gene="SPAP27G11.05c" FT /label=vps41 FT /note="SPAP27G11.05c, len:886, SIMILARITY:Homo sapiens, FT VP41_HUMAN, vacuolar assembly protein vps41 homolog, (854 FT aa), fasta scores: opt: 1290, E():0, (29.4% identity in FT 795 aa)" FT /product="putative vacuolar sorting protein" FT /fasta_file="fasta/p27G11.tab.seq.00189.out" FT misc_feature complement(1646122..1646532) FT /note="Match to PF00637 Clathrin_repeat, 7-fold repeat in FT Clathrin and VPS Score 32.41" FT misc_feature complement(1647804..1647819) FT /colour=6 FT /note="ctaacgataaatttag, splice branch and acceptor" FT misc_feature complement(1647861..1647866) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature complement(1648026..1648039) FT /colour=6 FT /note="ctgatctttattag, splice branch and acceptor" FT misc_feature complement(1648061..1648066) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1648209..1648225) FT /colour=6 FT /note="ttaacatttgtgtatag, splice branch and acceptor" FT misc_feature complement(1648253..1648258) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT CDS complement(join(1649209..1649403,1649461..1649591, FT 1649645..1649807)) FT /colour=7 FT /gene="SPAP27G11.06c" FT /label=SPAP27G11.06c FT /note="SPAP27G11.06c, len:162, SIMILARITY:Camptotheca FT acuminata., P93078, ap-1 golgi-related complex component FT protein, (161 aa), fasta scores: opt: 637, E():0, (58.1% FT identity in 160 aa)" FT /product="small subunit of clathrin-associated protein FT (AP) complex" FT /fasta_file="fasta/p27G11.tab.seq.00190.out" FT misc_feature complement(join(1649287..1649403,1649461..1649591, FT 1649645..1649801)) FT /note="Match to PF01217 Clat_adaptor_s, Clathrin adaptor FT complex small chain Score 203.45" FT misc_feature complement(1649404..1649415) FT /colour=6 FT /note="ttaaccgagtag, splice branch and acceptor" FT intron complement(1649404..1649460) FT /note="confirmed by mRNA" FT misc_feature complement(1649455..1649460) FT /colour=6 FT /note="gtacgg, splice donor sequence" FT misc_feature complement(1649592..1649610) FT /colour=6 FT /note="ttaactgtatttgtcttag, splice branch and acceptor" FT intron complement(1649592..1649642) FT /note="confirmed by mRNA" FT misc_feature complement(1649639..1649644) FT /colour=6 FT /note="gtaaaa, splice donor sequence" FT CDS complement(join(1650174..1650284,1650333..1650938)) FT /colour=7 FT /gene="SPAP27G11.07c" FT /label=SPAP27G11.07c FT /note="SPAP27G11.07c, len:238, SIMILARITY:Arabidopsis FT thaliana, Q9XH03, t1n24.12 protein., (290 aa), fasta FT scores: opt: 402, E():9.5e-19, (42.9% identity in 156 aa)" FT /product="similar to endopeptidases" FT /fasta_file="fasta/p27G11.tab.seq.00191.out" FT misc_feature complement(1650285..1650298) FT /colour=6 FT /note="ctaactgtttgaag, splice branch and acceptor" FT misc_feature complement(1650327..1650332) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1650471..1650509) FT /colour=8 FT /note="PS00109 Tyrosine protein kinases specific active- FT site signature, NOTE: Could be a false positive" FT CDS complement(join(1651315..1651871,1651922..1652543)) FT /colour=8 FT /gene="SPAP27G11.08c" FT /label=SPAP27G11.08c FT /note="SPAP27G11.08c, len:392" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/p27G11.tab.seq.00192.out" FT misc_feature complement(1651872..1651888) FT /colour=6 FT /note="ctcaccaaaatttttag, splice branch and acceptor" FT misc_feature complement(1651916..1651921) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS complement(1653114..1654094) FT /colour=7 FT /gene="SPAP27G11.09c" FT /label=SPAP27G11.09c FT /note="SPAP27G11.09c, len:326, SIMILARITY:Pichia FT guilliermondii, GCH2_PICGU, GTP cyclohydrolase ii, (344 FT aa), fasta scores: opt: 1116, E():0, (52.4% identity in FT 328 aa)" FT /product="putative GTP cyclohydrolase; putative riboflavin FT biosynthesis" FT /fasta_file="fasta/p27G11.tab.seq.00193.out" FT misc_feature complement(join(1653225..1653631,1653791..1653905)) FT /note="Match to PF00925 GTP_cyclohydro2, GTP FT cyclohydrolase II Score 250.38" FT CDS complement(join(1654752..1659429,1659501..1659517)) FT /colour=2 FT /gene="nup184" FT /gene="SPAP27G11.10c" FT /label=nup184 FT /note="SPAP27G11.10c, len:1564, NOTE: Sequence differs at FT C-term to Q9Y8G4, EM:AF055035" FT /product="nucleoporin" FT /fasta_file="fasta/p27G11.tab.seq.00194.out" FT misc_feature complement(1659430..1659447) FT /colour=6 FT /note="ttaacactttttgtgcag, splice branch and acceptor" FT misc_feature complement(1659495..1659500) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS complement(join(1660576..1660774,1660857..1660879)) FT /colour=9 FT /gene="SPAP27G11.11c" FT /label=SPAP27G11.11c FT /note="SPAP27G11.11c, len:73" FT /product="very hypothetical protein" FT /fasta_file="fasta/p27G11.tab.seq.00195.out" FT misc_feature complement(1660775..1660790) FT /colour=6 FT /note="ctaatttttcctttag, splice branch and acceptor" FT misc_feature complement(1660851..1660856) FT /colour=6 FT /note="gtatat, splice donor sequence" FT CDS 1660959..1661273 FT /colour=9 FT /gene="SPAP27G11.16" FT /label=SPAP27G11.16 FT /note="SPAP27G11.16, len:104" FT /product="very hypothetical protein" FT /fasta_file="fasta/p27G11.tab.seq.00196.out" FT CDS join(1661744..1661763,1661843..1661885,1662038..1662070, FT 1662121..1664418) FT /colour=10 FT /gene="SPAP27G11.12" FT /label=SPAP27G11.12 FT /note="SPAP27G11.12, len:797, FT SIMILARITY:Schizosaccharomyces pombe, YE9G_SCHPO, FT hypothetical 104.4 kD protein c17a5.16 in chromosome FT i.hypothetical 104.8 kD protein c17a5.16 in chromosome i., FT (921 aa), fasta scores: opt: 665, E():0, (23.9% identity FT in 899 aa)" FT /product="conserved protein; no apparent S. cerevisiae FT ortholog" FT /fasta_file="fasta/p27G11.tab.seq.00197.out" FT misc_feature 1661764..1661769 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1661828..1661842 FT /colour=6 FT /note="ttaaccaaattacag, splice branch and acceptor" FT misc_feature 1661886..1661891 FT /colour=6 FT /note="gtaggt, splice donor sequence" FT misc_feature 1662025..1662037 FT /colour=6 FT /note="ctaaccaattcag, splice branch and acceptor" FT misc_feature 1662071..1662076 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1662107..1662120 FT /colour=6 FT /note="ctaataatctttag, splice branch and acceptor" FT CDS complement(join(1664934..1664950,1665003..1665180)) FT /colour=7 FT /gene="SPAP27G11.13c" FT /label=SPAP27G11.13c FT /note="SPAP27G11.13c, len:64, SIMILARITY:Arabidopsis FT thaliana, AAD25649, at2g20490 protein., (64 aa), fasta FT scores: opt: 246, E():2.1e-12, (63.8% identity in 58 aa)" FT /product="putative requirement for the function of snoRNPs FT by similar to human nop10; direct rRNA pseudouridinylation" FT /fasta_file="fasta/p27G11.tab.seq.00198.out" FT misc_feature complement(1664951..1664961) FT /colour=6 FT /note="ctaacgattag, splice branch and acceptor" FT intron complement(1664951..1665002) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1664997..1665002) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS complement(1665738..1667807) FT /colour=8 FT /gene="SPAP27G11.14c" FT /label=SPAP27G11.14c FT /note="SPAP27G11.14c, len:689, FT SIMILARITY:Schizosaccharomyces pombe, YE01_SCHPO, FT hypothetical 138.5 kD protein c17h9.01 in chromosome i., FT (1202 aa), fasta scores: opt: 164, E():0.0044, (22.3% FT identity in 439 aa)" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/p27G11.tab.seq.00199.out" FT misc_feature 1668418..1668423 FT /colour=6 FT /note="gtaggt, splice donor sequence" FT misc_feature 1668445..1668458 FT /colour=6 FT /note="ctaatttgttttag, splice branch and acceptor" FT misc_feature 1669155..1669252 FT /note="nominal overlap with cosmid SPAC343 EM:AL109739 S. FT pombe chromosome 1" FT CDS join(1668319..1668417,1668459..1669175) FT /colour=10 FT /gene="SPAP27G11.15" FT /label=SPAP27G11.15 FT /note="SPAP27G11.15, len:271, SIMILARITY:Saccharomyces FT cerevisiae, YB78_YEAST, hypothetical 35.9 kD protein in FT fat2-pbp2 intergenic region., (304 aa), fasta scores: opt: FT 365, E():4.3e-17, (31.7% identity in 293 aa)" FT /product="conserved protein" FT /fasta_file="fasta/p27G11.tab.seq.00200.out" FT CDS complement(join(1669215..1670487,1670554..1670561)) FT /colour=7 FT /gene="SPAC343.01c" FT /label=SPAC343.01c FT /note="SPAC343.01c, len:427, SIMILARITY:Saccharomyces FT cerevisiae, ERG8_YEAST, phosphomevalonate kinase, (451 aa), FT fasta scores: opt: 407, E():9.9e-20, (32.6% identity in FT 451 aa)" FT /product="putative phosphomevalonate kinase" FT /fasta_file="fasta/c343.tab.seq.00696.out" FT misc_feature 1669155..1671501 FT /note="nominal overlap with plasmid SPAP27G11, EM:AL157917 FT S. pombe chromosome 1" FT misc_feature complement(1670488..1670507) FT /colour=6 FT /note="ctaactagcgtctttggcag, splice branch and acceptor" FT misc_feature complement(1670548..1670553) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS 1671431..1671979 FT /colour=7 FT /gene="SPAC343.02" FT /label=SPAC343.02 FT /note="SPAC343.02, len:183, SIMILARITY:Saccharomyces FT cerevisiae, YCT6_YEAST, ribosomal protein, mitochondrial., FT (169 aa), fasta scores: opt: 174, E():5.3e-05, (28.7% FT identity in 171 aa)" FT /product="mitochondrial ribosomal protein S19" FT /fasta_file="fasta/c343.tab.seq.00697.out" FT misc_feature 1671638..1671904 FT /note="Match to PF01245 Ribosomal_L19, Ribosomal protein FT L19 Score 24.79" FT CDS join(1672784..1672802,1672846..1672968,1673186..1673328) FT /colour=7 FT /gene="SPAC343.03" FT /label=SPAC343.03 FT /note="SPAC343.03, len:95, SIMILARITY:Caenorhabditis FT elegans, Q20052, F35G12.9 PROTEIN, (135 aa), fasta scores, FT opt: 318, E():2e-14, (40% identity in 87 aa overlap)" FT /product="putative Anaphase-Promoting Complex (APC); FT required for cyclin degradation; required for metaphase- FT anaphase transition; highly conserved ring finger; similar FT to S. cerevisiae APC11 which has ubiquitin ligase activity" FT /fasta_file="fasta/c343.tab.seq.00698.out" FT misc_feature 1672803..1672808 FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature 1672835..1672845 FT /colour=6 FT /note="ctaaccactag, splice branch and acceptor" FT misc_feature 1672969..1672974 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 1673173..1673185 FT /colour=6 FT /note="ctaactacgctag, splice branch and acceptor" FT CDS complement(join(1673609..1674907,1675032..1675182, FT 1675237..1675310)) FT /colour=10 FT /gene="SPAC343.04c" FT /label=SPAC343.04c FT /note="SPAC343.04c, len:508, SIMILARITY:Caenorhabditis FT elegans., YZLL_CAEEL, hypothetical 43.1 kD trp-asp repeats FT containing protein k04g11.4 in chromosome x., (395 aa), FT fasta scores: opt: 424, E():1.1e-19, (28.6% identity in FT 301 aa)" FT /product="WD repeat protein" FT /fasta_file="fasta/c343.tab.seq.00699.out" FT misc_feature complement(1673636..1673755) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat" FT misc_feature complement(1674284..1674382) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat" FT misc_feature complement(1674410..1674514) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat" FT misc_feature complement(1674908..1674923) FT /colour=6 FT /note="ctaacatgtactctag, splice branch and acceptor" FT misc_feature complement(1675026..1675031) FT /colour=6 FT /note="gtaaac, splice donor sequence" FT misc_feature complement(1675183..1675200) FT /colour=6 FT /note="ctaacgttattttggtag, splice branch and acceptor" FT misc_feature complement(1675231..1675236) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT tRNA complement(1675968..1676038) FT /note="tRNA Gly anticodon GCC, Cove score 72.94" FT CDS join(1676935..1676937,1676993..1677092,1677135..1678891) FT /EC_number="3.6.3.14" FT /colour=2 FT /gene="vma1" FT /gene="SPAC343.05" FT /label=vma1 FT /note="SPAC343.05, len:620" FT /product="V-type ATPase; vacuolar ATP synthase catalytic FT subunit A" FT /fasta_file="fasta/c343.tab.seq.00700.out" FT misc_feature 1676938..1676943 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 1676977..1676992 FT /colour=6 FT /note="ttaacaaatttgatag, splice branch and acceptor" FT misc_feature 1677093..1677098 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 1677121..1677134 FT /colour=6 FT /note="ctaaacatttacag, splice branch and acceptor" FT misc_feature 1677131..1678423 FT /note="Match to PF00006 ATP-synt_ab, ATP synthase alpha FT and beta subunits" FT misc_feature 1678502..1678858 FT /note="Match to PF00306 ATP-synt_ab_C, ATP synthase ab C FT terminal" FT CDS complement(1679288..1680433) FT /colour=7 FT /gene="SPAC343.06c" FT /label=SPAC343.06c FT /note="SPAC343.06c, len:382, SIMILARITY:Saccharomyces FT cerevisiae, YJ70_YEAST, hypothetical 37.5 kD protein in FT yuh1-ura8 intergenic region., (327 aa), fasta scores: opt: FT 290, E():3.5e-12, (40.0% identity in 280 aa)" FT /product="possibly involved in lipid metabolism by FT similarity" FT /fasta_file="fasta/c343.tab.seq.00701.out" FT CDS join(1680688..1680817,1680861..1681017,1681065..1681752, FT 1681803..1682657) FT /colour=7 FT /gene="SPAC343.07" FT /label=SPAC343.07 FT /note="SPAC343.07, len:610, SIMILARITY:Anemia phyllitidis, FT Q39953, poly(a)-mRNA-binding protein, (638 aa), fasta FT scores: opt: 325, E():2.2e-12, (38.3% identity in 154 aa)" FT /product="putative RNA-binding protein" FT /fasta_file="fasta/c343.tab.seq.00702.out" FT misc_feature join(1680751..1680817,1680861..1681024) FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain)" FT misc_feature 1680818..1680823 FT /colour=6 FT /note="gtaatc, splice donor sequence" FT misc_feature 1680848..1680860 FT /colour=6 FT /note="ctaactgtttaag, splice branch and acceptor" FT misc_feature 1681018..1681023 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 1681044..1681064 FT /colour=6 FT /note="ctaatagagcaacaattatag, splice branch and acceptor" FT misc_feature 1681501..1681713 FT /colour=9 FT /note="Pfam match to entry PF00076 rrm, RNA recognition FT motif. (a.k.a. RRM, RBD, or RNP domain)," FT misc_feature 1681753..1681758 FT /colour=6 FT /note="gtatta, splice donor sequence" FT misc_feature 1681786..1681802 FT /colour=6 FT /note="ctgaccttttaatttag, splice branch and acceptor" FT misc_feature 1682088..1682309 FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain)" FT CDS complement(join(1682964..1682982,1683032..1683282, FT 1683400..1683459)) FT /colour=7 FT /gene="SPAC343.08c" FT /label=SPAC343.08c FT /note="SPAC343.08c, len:110, SIMILARITY:Saccharomyces FT cerevisiae, RT17_YEAST, mitochondrial 40s ribosomal FT protein mrp17., (131 aa), fasta scores: opt: 194, E():1.1e- FT 07, (36.7% identity in 109 aa)" FT /product="mitochondrial ribosomal protein S6" FT /fasta_file="fasta/c343.tab.seq.00703.out" FT misc_feature complement(1682983..1683000) FT /colour=6 FT /note="ctaattccttttgtgtag, splice branch and acceptor" FT misc_feature complement(1683026..1683031) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1683040..1683282) FT /note="Match to PF01250 Ribosomal_S6, Ribosomal protein S6" FT misc_feature complement(1683283..1683295) FT /colour=6 FT /note="ctaataaatttag, splice branch and acceptor" FT misc_feature complement(1683394..1683399) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS 1683960..1685192 FT /colour=7 FT /gene="SPAC343.09" FT /label=SPAC343.09 FT /note="SPAC343.09, len:411, SIMILARITY:Saccharomyces FT cerevisiae, SHP1_YEAST, shp1 protein., (423 aa), fasta FT scores: opt: 483, E():1.3e-20, (32.5% identity in 400 aa)" FT /product="possibly involved in glycogen metabolism; FT similar to S. cerevisiae SHP1; contains UBX domain" FT /fasta_file="fasta/c343.tab.seq.00704.out" FT misc_feature 1684956..1685183 FT /note="Match to PF00789 UBX, UBX domain Score 47.59" FT CDS 1685915..1687840 FT /EC_number="1.5.1.20" FT /colour=2 FT /gene="mthfr2" FT /gene="SPAC343.10" FT /label=mthfr2 FT /note="SPAC343.10, len:642" FT /product="methylenetetrahydrofolate reductase 2; similar FT to S. cerevisiae MET12" FT /fasta_file="fasta/c343.tab.seq.00705.out" FT CDS complement(1688151..1692917) FT /colour=7 FT /gene="SPAC343.11c" FT /label=SPAC343.11c FT /note="SPAC343.11c, len:1589, SIMILARITY:Homo sapiens, FT Q92509, myeloblast kiaa0234., (1482 aa), fasta scores: FT opt: 383, E():7.4e-15, (20.1% identity in 1324 aa)" FT /product="putative transcriptional regulator; zinc finger FT protein; zf-C5HC2 type; zf-PHD finger; jmjC domain; jmjN FT domain; similar to retinoblastoma binding proteins" FT /fasta_file="fasta/c343.tab.seq.00706.out" FT misc_feature complement(1688412..1688558) FT /note="Match to PF00628 PHD, PHD-finger Score 40.33" FT misc_feature complement(1689258..1689401) FT /note="Match to PF00628 PHD, PHD-finger Score 47.82" FT LTR 1693162..1693505 FT /note="Tf2 type LTR" FT misc_feature complement(1697391..1697428) FT /note="true extent of overlap with cosmid clone c824 S. FT pombe chromosome I" FT CDS 1697747..1698955 FT /colour=2 FT /gene="rds1" FT /gene="SPAC343.12" FT /label=rds1 FT /note="SPAC343.12, len:403" FT /product="stress response protein; adenine-repressible FT gene (PMID: 7565608); regulated by glucose, ammonium, FT phosphate, carbon dioxide and temperature (PMID: 7565608); FT no apparent orthologs" FT /fasta_file="fasta/c343.tab.seq.00042.out" FT CDS complement(1699299..1699640) FT /colour=8 FT /gene="SPAC343.20" FT /label=SPAC343.20 FT /note="SPAC343.20, len:113" FT /product="hypothetical protein; sequence orphan; has FT transcript profile on microarray" FT /fasta_file="fasta/c343.tab.seq.00708.out" FT CDS join(1700031..1700186,1700253..1700489,1700560..1701747) FT /colour=7 FT /gene="SPAC343.13" FT /label=SPAC343.13 FT /note="SPAC343.13, len:527, SIMILARITY:Aquifex aeolicus., FT O66766, glutamyl-tRNA, (478 aa), fasta scores: opt: 622, FT E():0, (36.2% identity in 508 aa)" FT /product="putative glutamyl-tRNA amidotransferase; PET112 FT family" FT /fasta_file="fasta/c343.tab.seq.00709.out" FT misc_feature 1700187..1700192 FT /colour=6 FT /note="gtgagt, splice donor sequence" FT misc_feature 1700231..1700252 FT /colour=6 FT /note="ttaactttttatttttttatag, splice branch and acceptor" FT misc_feature join(1700295..1700489,1700560..1701702) FT /note="Match to PF01162 PET112, PET112 family" FT misc_feature 1700490..1700495 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 1700541..1700559 FT /colour=6 FT /note="ttaacaaacttatatttag, splice branch and acceptor" FT CDS complement(join(1702052..1702628,1702675..1703065, FT 1703118..1703331)) FT /colour=7 FT /gene="SPAC343.14c" FT /label=SPAC343.14c FT /note="SPAC343.14c, len:394, possibility of inteRNAl FT splice between 33743..33820 which improves homology in FT alignement, SIMILARITY:Fugu rubripes, E2BB_FUGRU, FT translation initiation factor eif-2b beta subunit, (355 FT aa), fasta scores: opt: 762, E():0, (38.6% identity in 383 FT aa)" FT /product="putative translation initiation factor eif-2b FT beta subunit" FT /fasta_file="fasta/c343.tab.seq.00710.out" FT misc_feature complement(join(1702103..1702628,1702675..1703042)) FT /note="Match to PF01008 IF-2B, Initiation factor 2 subunit" FT misc_feature complement(1702629..1702641) FT /colour=6 FT /note="ctaacctttttag, splice branch and acceptor" FT misc_feature complement(1702669..1702674) FT /colour=6 FT /note="gtatgg, splice donor sequence" FT intron complement(1702897..1702974) FT /note="intron improves homology but is covered by an EST, FT so putative" FT misc_feature complement(1703066..1703078) FT /colour=6 FT /note="ctaaaccgtgaag, splice branch and acceptor" FT intron complement(1703066..1703117) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1703112..1703117) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS 1703623..1704927 FT /colour=7 FT /gene="SPAC343.15" FT /label=SPAC343.15 FT /note="SPAC343.15, len:435, SIMILARITY:Saccharomyces FT cerevisiae, MOD5_YEAST, tRNA isopentenyltransferase, (428 FT aa), fasta scores: opt: 606, E():7.9e-32, (37.0% identity FT in 432 aa)" FT /product="tRNA isopentenyltransferase" FT /fasta_file="fasta/c343.tab.seq.00711.out" FT misc_feature 1703650..1703673 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop), FT [AG].{4}GK[ST]" FT CDS 1705406..1707571 FT /EC_number="4.2.1.36" FT /colour=7 FT /gene="SPAC343.16" FT /label=SPAC343.16 FT /note="SPAC343.16, len:722, SIMILARITY:Saccharomyces FT cerevisiae, LYS4_YEAST, homoaconitase , (693 aa), fasta FT scores: opt: 1588, E():0, (63.6% identity in 687 aa)" FT /product="putative homoaconitate hydratase; lysine FT biosynthesis pathway; similar to S. cerevisiae LYS4" FT /fasta_file="fasta/c343.tab.seq.00712.out" FT misc_feature 1705778..1706455 FT /note="Match to PF00330 aconitase, Aconitase family FT (aconitate hydratase)" FT misc_feature 1706498..1706869 FT /note="Match to PF00330 aconitase, Aconitase family FT (aconitate hydratase)" FT misc_feature 1706966..1707484 FT /note="Match to PF00694 Aconitase_C, Aconitase C-terminal FT domain" FT CDS complement(join(1707858..1709318,1709375..1709644)) FT /colour=7 FT /gene="SPAC343.17c" FT /label=SPAC343.17c FT /note="SPAC343.17c, len:577, SIMILARITY:Arabidopsis FT thaliana, AAD21755, f11a3.12 protein., (648 aa), fasta FT scores: opt: 816, E():0, (32.6% identity in 549 aa)" FT /product="WD repeat protein; no apparent S. cerevisiae FT ortholog" FT /fasta_file="fasta/c343.tab.seq.00713.out" FT misc_feature complement(1708611..1708697) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 22.00" FT misc_feature complement(1708911..1709021) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 26.21" FT misc_feature complement(1709294..1709410) FT /colour=9 FT /note="Pfam match to entry PF00400 WD40, WD domain, G-beta FT repeat" FT misc_feature complement(1709319..1709333) FT /colour=6 FT /note="ctaatttttggtaag, splice branch and acceptor" FT misc_feature complement(1709369..1709374) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS join(1710090..1710111,1710165..1710760) FT /colour=7 FT /gene="SPAC343.18" FT /label=SPAC343.18 FT /note="SPAC343.18, len:206, SIMILARITY:Schizosaccharomyces FT pombe, YEEA_SCHPO, hypothetical 28.9 kD protein c19a8.10 FT in chromosome i., (254 aa), fasta scores: opt: 168, FT E():0.0013, (29.9% identity in 107 aa)" FT /product="zinc finger protein; zf-C3HC4 type (RING FT finger); no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c343.tab.seq.00714.out" FT misc_feature 1710112..1710117 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1710144..1710164 FT /colour=6 FT /note="ttaacgtctacacgtttctag, splice branch and acceptor" FT misc_feature 1710641..1710670 FT /colour=8 FT /note="PS00518 zinc finger, C3HC4 type (RING finger)" FT misc_feature 1712003..1712101 FT /note="nominal overlap with cosmid SPAC824, EM:AL121741 S. FT pombe chromosome 1" FT misc_feature 1712003..1712101 FT /note="nominal overlap with cosmid SPAC343, EM:AL109739 S. FT pombe chromosome 1" FT CDS 1714866..1718294 FT /colour=7 FT /gene="SPAC824.02" FT /label=SPAC824.02 FT /note="SPAC824.02, len:1167, SIMILARITY:Saccharomyces FT cerevisiae, YFC5_YEAST, BST1 negative regulator of COPII FT vesicle formation, (1029 aa), fasta scores: opt: 1100, FT E():0, (29.6% identity in 1111 aa)" FT /product="putative negative regulator of vesicle FT formation; similar to S. cerevisiae BST2; putative FT negative regulator of COPII vesicle formation; possibly FT involved in vesicle transport; possibly localizes to the FT endoplasmic reticulum" FT /fasta_file="fasta/c824.tab.seq.00376.out" FT CDS complement(1718578..1719321) FT /colour=10 FT /gene="SPAC824.03c" FT /label=SPAC824.03c FT /note="SPAC824.03c, len:247, SIMILARITY: LOW to Q08774, FT YOR305W, (242 aa), fasta scores, opt:112, E():0.83, (24.3% FT identity in 202 aa overlap)" FT /product="hypothetical protein; similar to S. cerevisiae FT YOR305W" FT /fasta_file="fasta/c824.tab.seq.00377.out" FT CDS 1720038..1721063 FT /colour=7 FT /gene="SPAC824.04" FT /label=SPAC824.04 FT /note="SPAC824.04, len:341, SIMILARITY:Schizosaccharomyces FT pombe, O60137, hypothetical 39.8 kD protein., (357 aa), FT fasta scores: opt: 437, E():1.4e-22, (30.4% identity in FT 358 aa)" FT /product="WD repeat protein" FT /fasta_file="fasta/c824.tab.seq.00378.out" FT misc_feature 1720347..1720445 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat" FT misc_feature 1720848..1720892 FT /colour=8 FT /note="PS00678 Trp-Asp (WD) repeats signature" FT CDS join(1721683..1721713,1721754..1721788,1721837..1721918, FT 1721973..1722082,1722148..1724397) FT /colour=2 FT /gene="vps16" FT /gene="SPAC824.05" FT /label=vps16 FT /note="SPAC824.05, len:835, SIMILARITY:Saccharomyces FT cerevisiae, VP16_YEAST, vacuolar protein sorting- FT associated protein vps16., (798 aa), fasta scores: opt: FT 754, E():0, (25.7% identity in 839 aa)" FT /product="putative vacuolar sorting protein" FT /fasta_file="fasta/c824.tab.seq.00379.out" FT misc_feature 1721714..1721719 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 1721740..1721753 FT /colour=6 FT /note="ctaatttacgaaag, splice branch and acceptor" FT misc_feature 1721789..1721794 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 1721824..1721836 FT /colour=6 FT /note="ctaatgtaactag, splice branch and acceptor" FT misc_feature 1721919..1721924 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1721956..1721972 FT /colour=6 FT /note="ctaattatttgaaacag, splice branch and acceptor" FT misc_feature 1722083..1722088 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1722131..1722147 FT /colour=6 FT /note="ctaatttttctgtgtag, splice branch and acceptor" FT CDS join(1724778..1724780,1724828..1724875,1724929..1725300) FT /colour=7 FT /gene="SPAC824.06" FT /label=SPAC824.06 FT /note="SPAC824.06, len:140, SIMILARITY:Saccharomyces FT cerevisiae, Q07914, ylr008c., (168 aa), fasta scores: opt: FT 318, E():1.7e-15, (58.5% identity in 82 aa)" FT /product="DNAJ domain protein; similar to S. cerevisiae FT YLR008C; predicted N-terminal signal sequence" FT /fasta_file="fasta/c824.tab.seq.00380.out" FT misc_feature 1724781..1724786 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 1724809..1724827 FT /colour=6 FT /note="ctaacttatttttgattag, splice branch and acceptor" FT misc_feature 1724876..1724881 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1724916..1724928 FT /colour=6 FT /note="ctaatgactttag, splice branch and acceptor" FT CDS join(1726247..1726365,1726508..1727159) FT /colour=7 FT /gene="SPAC824.07" FT /label=SPAC824.07 FT /note="SPAC824.07, len:256, SIMILARITY:Schizosaccharomyces FT pombe, O94250, putative hydroxyacylglutathione hydrolase., FT (256 aa), fasta scores: opt: 1005, E():0, (55.9% identity FT in 254 aa)" FT /product="putative hydroxyacylglutathione hydrolase" FT /fasta_file="fasta/c824.tab.seq.00381.out" FT misc_feature join(1726286..1726365,1726508..1726922) FT /note="Match to PF00753 lactamase_B, Metallo-beta- FT lactamase family" FT misc_feature 1726366..1726371 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1726494..1726507 FT /colour=6 FT /note="ttgacaaactctag, splice branch and acceptor" FT CDS 1727714..1729384 FT /colour=2 FT /gene="gdp1" FT /gene="SPAC824.08" FT /label=gdp1 FT /product="nucleotide diphoshphatase; guanosine FT diphosphatase; similar to S. cerevisiae GDA1; S. FT cerevisiae predicted ortholog localizes to golgi membrane" FT /fasta_file="fasta/c824.tab.seq.00382.out" FT misc_feature 1728107..1729354 FT /note="Match to PF01150 GDA1_CD39, GDA1/CD39 (nucleoside FT phosphatase) family" FT CDS complement(join(1729993..1730635,1730774..1730818, FT 1730890..1730968,1731038..1731081,1731126..1731277)) FT /colour=7 FT /gene="SPAC824.09c" FT /label=SPAC824.09c FT /note="SPAC824.09c, len:320, SIMILARITY:Saccharomyces FT cerevisiae, YIE4_YEAST, hypothetical 32.6 kD protein., FT (298 aa), fasta scores: opt: 485, E():3.9e-20, (39.7% FT identity in 267 aa)" FT /product="putative GTPase activating protein" FT /fasta_file="fasta/c824.tab.seq.00383.out" FT misc_feature complement(join(1730584..1730641,1730774..1730818, FT 1730890..1730968,1731038..1731081,1731126..1731235)) FT /note="Match to PF01412 ArfGap, putative GTP-ase FT activating required for Arf Score 109.99" FT misc_feature complement(1730636..1730650) FT /colour=6 FT /note="ctgacctagatttag, splice branch and acceptor" FT misc_feature complement(1730768..1730773) FT /colour=6 FT /note="gtaggt, splice donor sequence" FT misc_feature complement(1730819..1730834) FT /colour=6 FT /note="ctaacaactttaatag, splice branch and acceptor" FT misc_feature complement(1730884..1730889) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1730969..1730985) FT /colour=6 FT /note="ttaacagacaaaactag, splice branch and acceptor" FT misc_feature complement(1731032..1731037) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(1731082..1731095) FT /colour=6 FT /note="ttaacacttgttag, splice branch and acceptor" FT misc_feature complement(1731120..1731125) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1731884..1733919 FT /note="nominal overlap with cosmid SPAC664 S. pombe FT chromosome 1" FT misc_feature complement(1732700..1732885) FT /note="Match to PF01393 Chromo_shadow, Chromo shadow FT domain" FT misc_feature complement(1733315..1733446) FT /note="Match to PF00385 chromo, 'chromo' (CHRromatin FT Organization MOdifier) domain" FT misc_feature 1731884..1733919 FT /note="nominal overlap with cosmid SPAC824, EM:AL121741 S. FT pombe chromosome 1" FT misc_feature complement(1732700..1732885) FT /note="Match to PF01393 Chromo_shadow, Chromo shadow FT domain Score 135.76" FT misc_feature complement(1733315..1733380) FT /colour=8 FT /note="PS00598 Chromo domain signature" FT misc_feature complement(1733315..1733446) FT /note="Match to PF00385 chromo, 'chromo' (CHRromatin FT Organization MOdifier) domain Score 81.11" FT tRNA 1734258..1734340 FT /note="tRNA Lys anticodon CTT, Cove score 75.47" FT intron 1734297..1734304 FT /note="intron tRNA Lys anticodon CTT" FT CDS complement(join(1734657..1735967,1736035..1736244, FT 1736367..1736555,1736604..1736756)) FT /colour=7 FT /fasta_file="fasta/c664.tab.seq.00017.out" FT /gene="SPAC664.02c" FT /label=SPAC664.02c FT /note="SPAC664.02c, len:620, SIMILARITY:Saccharomyces FT cerevisiae, ARP8_YEAST, actin-like protein arp8., (881 aa), FT fasta scores: opt: 831, E():0, (28.1% identity in 693 FT aa)" FT /product="actin-like protein; subcellular localization of FT GFP fusion- Nucleus; similar to S. cerevisiae ARP8 which FT is also GFP localised nuclear" FT misc_feature complement(1734684..1734941) FT /note="Match to PF00022 actin, Actin Score 23.18" FT misc_feature complement(1735968..1735984) FT /colour=6 FT /note="ctaattatattttttag, splice branch and acceptor" FT misc_feature complement(1736029..1736034) FT /colour=6 FT /note="gtgcgt, splice donor sequence" FT misc_feature complement(1736245..1736257) FT /colour=6 FT /note="ctaattcttctag, splice branch and acceptor" FT misc_feature complement(1736361..1736366) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1736556..1736571) FT /colour=6 FT /note="ctaaaatgccttgtag, splice branch and acceptor" FT misc_feature complement(1736598..1736603) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT CDS join(1738498..1738500,1738535..1739905) FT /colour=7 FT /fasta_file="fasta/c664.tab.seq.00018.out" FT /gene="SPAC664.03" FT /label=SPAC664.03 FT /note="SPAC664.03, len:457, SIMILARITY:Saccharomyces FT cerevisiae., G1911498, paf1p=RNA polymerase ii-associated FT factor/putative transcriptionalregulator., (444 aa), fasta FT scores: opt: 296, E():1.6e-09, (24.3% identity in 474 aa)" FT /product="putative DNA-directed RNA polymerase II FT regulator" FT misc_feature 1738501..1738506 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT CDS complement(join(1740178..1740225,1740369..1740743)) FT /colour=2 FT /fasta_file="fasta/c664.tab.seq.00019.out" FT /gene="rps16-2" FT /gene="SPAC664.04c" FT /label=rps16-2 FT /note="SPAC664.04c, len:140" FT /product="40S ribosomal protein S16" FT misc_feature complement(1740226..1740239) FT /colour=6 FT /note="ctaactgtttctag, splice branch and acceptor" FT intron complement(1740226..1740368) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1740363..1740368) FT /colour=6 FT /note="gtttgt, splice donor sequence" FT misc_feature complement(1740366..1740722) FT /note="Match to PF00380 Ribosomal_S9, Ribosomal protein FT S9/S16 Score 212.84" FT misc_feature complement(1740486..1740542) FT /colour=8 FT /note="PS00360 Ribosomal protein S9 signature" FT CDS 1740890..1741516 FT /colour=2 FT /fasta_file="fasta/c664.tab.seq.00020.out" FT /gene="rpl13" FT /gene="SPAC664.05" FT /label=rpl13 FT /note="SPAC664.05, len:208" FT /product="60S ribosomal protein L13" FT misc_feature 1740914..1741426 FT /note="Match to PF01294 Ribosomal_L13e, Ribosomal protein FT L13e Score 341.22" FT misc_feature 1741079..1741126 FT /colour=8 FT /note="PS01104 Ribosomal protein L13e signature" FT CDS join(1742493..1742615,1742833..1743459) FT /colour=2 FT /fasta_file="fasta/c664.tab.seq.00021.out" FT /gene="rpl7-3" FT /gene="SPAC664.06" FT /label=rpl7a-2 FT /note="SPAC664.06, len:249" FT /product="60S ribosomal protein L7" FT misc_feature 1742616..1742621 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT snRNA 1742672..1742747 FT /note="SP26014 Schizosaccharomyces pombe small nuclear RNA FT snR39." FT misc_feature 1742818..1742832 FT /colour=6 FT /note="ctaattttactccag, splice branch and acceptor" FT misc_feature 1742971..1743129 FT /note="Match to PF00327 Ribosomal_L30, Ribosomal protein FT L30p/L7e Score 109.79" FT misc_feature 1743031..1743129 FT /colour=8 FT /note="PS00634 Ribosomal protein L30 signature" FT CDS complement(join(1743766..1743993,1744050..1744663, FT 1744721..1745054,1745108..1745212)) FT /colour=2 FT /gene="rad9" FT /gene="SPAC664.07c" FT /label=rad9 FT /note="SPAC664.07c, len:426" FT /product="DNA repair protein; replication checkpoint FT protein; similar to S. cerevisiae DDC1" FT /fasta_file="fasta/c664.tab.seq.00032.out" FT misc_feature complement(1743994..1744005) FT /colour=6 FT /note="ttaactttatag, splice branch and acceptor" FT intron complement(1743994..1744049) FT /note="confirmed by mRNA" FT misc_feature complement(1744044..1744049) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1744664..1744682) FT /colour=6 FT /note="ctaacgtttattcatcaag, splice branch and acceptor" FT intron complement(1744664..1744720) FT /note="confirmed by mRNA" FT misc_feature complement(1744715..1744720) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(1745055..1745067) FT /colour=6 FT /note="ctaattggtaaag, splice branch and acceptor" FT intron complement(1745055..1745107) FT /note="confirmed by mRNA" FT misc_feature complement(1745102..1745107) FT /colour=6 FT /note="gtgtgt, splice donor sequence" FT CDS complement(join(1745889..1747089,1747151..1747250, FT 1747297..1747344,1747387..1747396)) FT /colour=7 FT /fasta_file="fasta/c664.tab.seq.00023.out" FT /gene="SPAC664.08c" FT /label=SPAC664.08c FT /note="SPAC664.08c, len:452, SIMILARITY:Saccharomyces FT cerevisiae, Q06631, similar to Saccharomyces cerevisiae FT Bmh1p., (534 aa), fasta scores: opt: 280, E():2.3e-08, FT (28.9% identity in 537 aa)" FT /product="similar to S. cerevisiae BFR2 -protein transport FT protein" FT misc_feature complement(1747090..1747110) FT /colour=6 FT /note="ctaatgtttcatattttatag, splice branch and acceptor" FT misc_feature complement(1747145..1747150) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1747251..1747263) FT /colour=6 FT /note="ctcacataaatag, splice branch and acceptor" FT misc_feature complement(1747291..1747296) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1747345..1747359) FT /colour=6 FT /note="ctaataaatctttag, splice branch and acceptor" FT misc_feature complement(1747381..1747386) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS 1749172..1751064 FT /colour=7 FT /fasta_file="fasta/c664.tab.seq.00024.out" FT /gene="SPAC664.09" FT /label=SPAC664.09 FT /note="SPAC664.09, len:630, SIMILARITY:Schizosaccharomyces FT pombe, O14194, putative gamma-glutamyltranspeptidase , FT (611 aa), fasta scores: opt: 1766, E():0, (50.2% identity FT in 540 aa)" FT /product="putative gamma-glutamyltranspeptidase" FT misc_feature 1749517..1751040 FT /note="Match to PF01019 G_glu_transpept, Gamma- FT glutamyltranspeptidase Score 645.96" FT CDS join(1751671..1751700,1751746..1754169) FT /colour=7 FT /fasta_file="fasta/c664.tab.seq.00025.out" FT /gene="SPAC664.10" FT /label=SPAC664.10 FT /note="SPAC664.10, len:817, NOTE: first exon possibly FT incorrect; may use MKLNFSNTLQYPHVFGEKEK as alteRNAtive FT first exon, SIMILARITY:Emericella nidulans, KLPA_EMENI, FT kinesin-like protein klpa., (770 aa), fasta scores: opt: FT 1623, E():0, (42.6% identity in 753 aa)" FT /product="kinesin-like protein" FT misc_feature 1751701..1751706 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 1751727..1751745 FT /colour=6 FT /note="ttaatttttttccttatag, splice branch and acceptor" FT misc_feature 1753150..1754127 FT /note="Match to PF00225 kinesin, Kinesin motor domain FT Score 329.62" FT CDS 1755685..1757709 FT /colour=2 FT /fasta_file="fasta/c664.tab.seq.00026.out" FT /gene="ssp1" FT /gene="SPAC664.11" FT /label=ssp1 FT /note="SPAC664.11, len:674" FT /product="mitochondrial chaperonin; heat shock 70 kD FT protein; involved in mitochondrial protein import" FT misc_feature 1755838..1757646 FT /note="Match to PF00012 HSP70, Hsp70 protein Score 1391.96" FT misc_feature 1755847..1755870 FT /colour=8 FT /note="PS00297 Heat shock hsp70 proteins family signature FT 1" FT misc_feature 1756399..1756440 FT /colour=8 FT /note="PS00329 Heat shock hsp70 proteins family signature FT 2" FT misc_feature 1756822..1756866 FT /colour=8 FT /note="PS01036 Heat shock hsp70 proteins family signature FT 3" FT CDS complement(join(1758245..1758406,1758493..1758570)) FT /colour=10 FT /fasta_file="fasta/c664.tab.seq.00027.out" FT /gene="SPAC664.12c" FT /label=SPAC664.12c FT /note="SPAC664.12c, len:79" FT /product="hypothetical protein; similar to S. cerevisiae FT YDR379C-A" FT misc_feature complement(1758407..1758421) FT /colour=6 FT /note="ctaactaatacgtag, splice branch and acceptor" FT misc_feature complement(1758487..1758492) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS 1759181..1759534 FT /colour=9 FT /fasta_file="fasta/c664.tab.seq.00028.out" FT /gene="SPAC664.13" FT /label=SPAC664.13 FT /note="SPAC664.13, len:117" FT /product="very hypothetical protein" FT CDS 1761303..1762841 FT /colour=7 FT /fasta_file="fasta/c664.tab.seq.00029.out" FT /gene="SPAC664.14" FT /label=SPAC664.14 FT /note="SPAC664.14, len:512, SIMILARITY:Saccharomyces FT cerevisiae, MEP2_YEAST, ammonium transporter mep2., (499 FT aa), fasta scores: opt: 1528, E():0, (46.7% identity in FT 490 aa)" FT /product="Amt ammonium transporter" FT misc_feature 1761444..1762673 FT /note="Match to PF00909 Ammonium_transp, Ammonium FT Transporter Family Score 568.78" FT tRNA complement(1763440..1763514) FT /note="tRNA Lys anticodon TTT, Cove score 75.86" FT misc_feature 1764220..1764936 FT /note="nominal overlap with cosmid SPACUNK12, EM:AL157993 FT S. pombe chromosome 1" FT misc_feature 1764220..1764936 FT /note="nominal overlap with cosmid SPAC664 EM:AL136235 FT S.pombe chromosome I cosmid c664" FT misc_feature 1765632..1765748 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 49.83" FT misc_feature 1765761..1765868 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 47.67" FT misc_feature 1765950..1766054 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 39.90" FT misc_feature 1766244..1766354 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 44.83" FT CDS complement(join(1767508..1767874,1767937..1768267, FT 1768340..1768430,1768498..1768552,1768600..1768763)) FT /colour=2 FT /gene="cmk1" FT /gene="SPACUNK12.02c" FT /label=cmk1 FT /note="SPACUNK12.02c, len:335" FT /product="serine/threonine protein kinase; calmodulin FT kinase i homolog." FT /fasta_file="fasta/cUNK12.tab.seq.00125.out" FT misc_feature complement(join(1767643..1767874,1767937..1768267, FT 1768340..1768424)) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 228.62" FT misc_feature complement(1767875..1767890) FT /colour=6 FT /note="ctaatactgtttatag, splice branch and acceptor" FT intron complement(1767875..1767936) FT /note="Intron confirmed by mRNA" FT misc_feature complement(1767931..1767936) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1768268..1768283) FT /colour=6 FT /note="ctaacccttgaaacag, splice branch and acceptor" FT intron complement(1768268..1768339) FT /note="Intron confirmed by mRNA" FT misc_feature complement(1768334..1768339) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1768431..1768453) FT /colour=6 FT /note="ctaacatgtttttggtggtatag, splice branch and acceptor" FT intron complement(1768431..1768497) FT /note="Intron confirmed by mRNA" FT misc_feature complement(1768492..1768497) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1768553..1768570) FT /colour=6 FT /note="ctgaccaaattttcatag, splice branch and acceptor" FT intron complement(1768553..1768599) FT /note="Intron confirmed by mRNA" FT misc_feature complement(1768594..1768599) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1770200..1770238 FT /note="nominal overlap with cosmid SPAC105, EM:AL157994 FT S.pombe chromosome 1" FT misc_feature 1770200..1770238 FT /note="Nominal overlap with SPACUNK12, EM:AL157993 S.pombe FT chromosome 1" FT CDS complement(join(1770292..1772800,1772975..1773054, FT 1773097..1773179,1773212..1773236)) FT /colour=7 FT /gene="SPAC105.01c" FT /label=SPAC105.01c FT /note="SPAC105.01c, len:899, SIMILARITY to N-term FT of:Saccharomyces cerevisiae, YJJ4_YEAST, hypothetical 97.1 FT kD protein in bck1-tok1 intergenic region., (873 aa), FT fasta scores: opt: 1326, E():0, (45.5% identity in 420 aa)" FT /product="CPA2 potassium ion/proton antiporter" FT /fasta_file="fasta/c105.tab.seq.00220.out" FT misc_feature complement(1772801..1772815) FT /colour=6 FT /note="ttaacagaacaacag, splice branch and acceptor" FT misc_feature complement(1772969..1772974) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1773055..1773067) FT /colour=6 FT /note="ataacaactttag, splice branch and acceptor" FT misc_feature complement(1773091..1773096) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1773180..1773194) FT /colour=6 FT /note="ctaatccgctgttag, splice branch and acceptor" FT misc_feature complement(1773206..1773211) FT /colour=6 FT /note="gtttgt, splice donor sequence" FT CDS complement(join(1774424..1774626,1774911..1775195, FT 1775249..1775273)) FT /colour=10 FT /gene="SPAC105.02c" FT /label=SPAC105.02c FT /note="SPAC105.02c, len:170, SIMILARITY:Saccharomyces FT cerevisiae, YGZ2_YEAST, hypothetical 20.1 kD protein in FT rtf1-cse1 intergenic region., (181 aa), fasta scores: opt: FT 303, E():1.5e-13, (34.2% identity in 155 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YGL242C; ankyrin repeat protein" FT /fasta_file="fasta/c105.tab.seq.00221.out" FT misc_feature complement(1774627..1774647) FT /colour=6 FT /note="ctaactattgtttcattatag, splice branch and acceptor" FT misc_feature complement(1774905..1774910) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1775196..1775210) FT /colour=6 FT /note="ctaacgattttttag, splice branch and acceptor" FT misc_feature complement(1775243..1775248) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT tRNA 1776140..1776223 FT /note="tRNA Tyr anticodon GTA, Cove score 40.71" FT misc_feature 1778597..1779198 FT /note="nominal overlap with cosmid SPAC17A5 EM:Z98849 S. FT pombe chromosome 1" FT CDS complement(1776594..1778720) FT /colour=7 FT /gene="SPAC105.03c" FT /label=SPAC105.03c FT /note="SPAC105.03c, len:709, FT SIMILARITY:Schizosaccharomyces pombe, CAB61777, putative FT transcriptional activator protein., (654 aa), fasta FT scores: opt: 1378, E():0, (41.6% identity in 486 aa)" FT /product="putative transcriptional activator; similar to FT S. cerevisiae DAL81 an activator for allantoin, 4- FT aminobutyric acid (GABA), and urea catabolic genes; zinc FT finger protein; fungal Zn[2]-Cys[6] binuclear cluster FT domain" FT /fasta_file="fasta/c105.tab.seq.00222.out" FT misc_feature complement(1778597..1778720) FT /note="SPAC105.03c; see c105 for full length CDS" FT /partial FT misc_feature 1778597..1779198 FT /note="3010 (+1) 8398 8999 c105 S. pombe chromosome 1" FT CDS join(1779769..1781124,1781179..1782669) FT /colour=7 FT /function="essential for the biogenesis of peroxisomes, by FT similarity" FT /gene="SPAC17A5.01" FT /label=SPAC17A5.01 FT /note="SPAC17A5.01, len:948aa; similarity: to YNL329C, FT PEX6 _YEAST, P33760, peroxisome biosynthesis pas8, FT (1030aa), fas ta scores, opt:1194, E():0, (31.0% identity FT in 986 aa overl ap)" FT /product="putative peroxin-6, AAA family atpase" FT /fasta_file="fasta/c17A5.tab.seq.01438.out" FT misc_feature 1781053..1781076 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 1781125..1781130 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1781164..1781178 FT /colour=6 FT /note="ctaactgttttctag, splice branch and acceptor FT sequence" FT misc_feature 1781890..1782462 FT /note="Match to PF00004 AAA, ATPases associated with FT various cellular activities (AAA) Score 301.32" FT misc_feature 1781905..1781928 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS complement(1782883..1783335) FT /colour=8 FT /gene="SPAC17A5.18c" FT /label=SPAC17A5.18c FT /note="SPAC17A5.18c, len:154" FT /product="hypothetical protein; sequence orphan; has FT transcript profile on microarray; predicted coiled-coil FT region" FT /fasta_file="fasta/c17A5.tab.seq.01439.out" FT CDS complement(join(1783785..1783986,1784026..1784794, FT 1784840..1784961,1785007..1785314)) FT /colour=2 FT /gene="dbr1" FT /gene="SPAC17A5.02c" FT /label=dbr1 FT /note="SPAC17A5.02c, len:465aa; anomoly: we predict FT differe nt C-terminal" FT /product="RNA lariat debranching enzyme; putative pre-mRNA FT splicing factor; RNA turnover; similar to S. cerevisiae FT DBR1" FT /fasta_file="fasta/c17A5.tab.seq.01440.out" FT misc_feature complement(1783987..1784000) FT /colour=6 FT /note="ctgacgtttgatag, splice branch and acceptor sequence" FT misc_feature complement(1784020..1784025) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature complement(1784795..1784808) FT /colour=6 FT /note="gtaacatataatag, splice branch and acceptor sequence" FT misc_feature complement(1784834..1784839) FT /colour=6 FT /note="gtataa, splice donor sequence" FT misc_feature complement(1784962..1784982) FT /colour=6 FT /note="ctattaacaatgcgccaacag, splice branch and acceptor FT se quence" FT misc_feature complement(1785001..1785006) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT promoter 1785694..1785703 FT /colour=4 FT /note="Homol E box" FT promoter 1785712..1785719 FT /colour=4 FT /note="Homol D box" FT CDS 1785785..1786951 FT /colour=2 FT /gene="rpl3-1" FT /gene="SPAC17A5.03" FT /label=rpl3-1 FT /note="SPAC17A5.03, len:387aa" FT /product="60S ribosomal protein L3" FT /fasta_file="fasta/c17A5.tab.seq.01441.out" FT misc_feature 1785932..1786801 FT /note="Match to PF00297 Ribosomal_L3, Ribosomal protein L3 FT Score 671.25" FT misc_feature 1786409..1786480 FT /colour=8 FT /note="PS00474 Ribosomal protein L3 signature" FT CDS complement(join(1787269..1787861,1787933..1788878)) FT /colour=7 FT /gene="SPAC17A5.04c" FT /label=SPAC17A5.04c FT /note="SPAC17A5.04c, len:512aa, similarity: to a region of FT Q61824, metrin alpha, (903aa), fasta scores, opt:490, FT E(): 4.4e-21, (33.3% identity in 273 aa overlap), contains FT PS001 42 Neutral zinc metallopeptidases zinc binding FT region signature" FT /product="putative zinc metallopeptidase; disintegrin/ADAM FT protease; subcellular localization of GFP fusion- Spore FT rim; predicted N-terminal signal sequence; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c17A5.tab.seq.01442.out" FT misc_feature complement(1787614..1787838) FT /note="Match to PF00200 disintegrin, Disintegrin Score FT 99.21" FT misc_feature complement(1787862..1787881) FT /colour=6 FT /note="ctaaccattatttaag, splice branch and acceptor FT sequenc e" FT misc_feature complement(1787927..1787932) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1788162..1788206) FT /colour=9 FT /fasta_file="c17A5.seq.0005.out" FT /note="Pfam match to entry PF00099 zn-protease, zinc FT binding metalloprotease domain, score 17.70, E-value 0.27" FT misc_feature complement(1788174..1788203) FT /colour=8 FT /note="PS00142 Neutral zinc metallopeptidases, zinc FT binding region signature" FT CDS complement(1789304..1790047) FT /colour=8 FT /gene="SPAC17A5.05c" FT /label=SPAC17A5.05c FT /note="SPAC17A5.05c, len:247aa" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c17A5.tab.seq.01443.out" FT CDS 1791463..1793877 FT /colour=7 FT /gene="ercc3sp" FT /gene="SPAC17A5.06" FT /label=ercc3sp FT /note="SPAC17A5.06, len:804aa, similarity: to YIL143C, FT RA25 _YEAST, Q00578, DNA repair helicase rad25, (843aa), FT fasta s cores, opt:3556, E():0, (68.3% identity in 823 aa FT overlap)" FT /product="putative DNA repair protein; DEAD box helicase; FT putative ERCC-3 complementing; putative TFIIH subunit" FT /fasta_file="fasta/c17A5.tab.seq.01444.out" FT misc_feature 1793200..1793430 FT /note="Match to PF00271 helicase_C, Helicases conserved C- FT terminal domain Score 45.04" FT CDS complement(join(1794012..1794468,1794553..1794789, FT 1794844..1794948,1795018..1795864,1796013..1796320, FT 1796367..1796371)) FT /colour=2 FT /gene="ulp2" FT /gene="SPAC17A5.07c" FT /label=ulp2 FT /note="SPAC17A5.07c, len:652aa, similarity: some to FT YIL031W , SMT4_YEAST, P40537, smt4 protein, (1034aa), FT fasta scores, opt:293, E():1.5e-10, (24.7% identity in 453 FT aa overlap)" FT /product="putative Pmt3 processing and deconjugating FT enzyme" FT /fasta_file="fasta/c17A5.tab.seq.01445.out" FT misc_feature complement(1794469..1794483) FT /colour=6 FT /note="ctaagttaattatag, splice branch and acceptor FT sequence" FT misc_feature complement(1794547..1794552) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1794790..1794805) FT /colour=6 FT /note="ctaatgggtaatatag, splice branch and acceptor FT sequenc e" FT misc_feature complement(1794838..1794843) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1794949..1794966) FT /colour=6 FT /note="ttaacctcaaaaatttag, splice branch and acceptor FT seque nce" FT misc_feature complement(1795012..1795017) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1795865..1795877) FT /colour=6 FT /note="ctactttgtttag, splice branch and acceptor sequence" FT misc_feature complement(1796007..1796012) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1796321..1796335) FT /colour=6 FT /note="ctaactatttttag, splice branch and acceptor sequence" FT misc_feature complement(1796361..1796366) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS 1797463..1798095 FT /colour=7 FT /gene="SPAC17A5.08" FT /label=SPAC17A5.08 FT /note="SPAC17A5.08, len:210aa; similarity: to YDL018C, FT Q124 03, (225aa), fasta scores, opt:168, E():2.3e-21, FT (31.0% ide ntity in 216 aa overlap)" FT /product="putative COPII-coated vesicle proteins; emp24- FT like" FT /fasta_file="fasta/c17A5.tab.seq.01446.out" FT misc_feature 1797481..1798086 FT /note="Match to PF01105 EMP24_GP25L, emp24/gp25L/p24 FT family Score 280.88" FT CDS complement(1798764..1799696) FT /colour=7 FT /gene="SPAC17A5.09c" FT /label=SPAC17A5.09c FT /note="SPAC17A5.09c, len:310aa" FT /product=" low similar to human protein phosphatase FT inhibitor 2 and S. cerevisiae GLC8- Modulator of protein FT serine/threonine phosphatase- involved in control of FT vacuole fusion- by multiple alignment" FT /fasta_file="fasta/c17A5.tab.seq.01447.out" FT CDS 1799867..1800541 FT /colour=10 FT /gene="SPAC17A5.10" FT /label=SPAC17A5.10 FT /note="SPAC17A5.10, len:224aa SIMILARITY: YG5M_YEAST, FT hypot hetical protein, (198 aa),fasta scores, opt:226, FT E(): 7.4e- 09, (38.1% identity in 176 aa overlap)" FT /product="hypothetical protein; similar to S. cerevisiae FT YGR268C" FT /fasta_file="fasta/c17A5.tab.seq.01448.out" FT misc_feature 1800293..1800310 FT /colour=8 FT /note="PS00190 Cytochrome c family heme-binding site FT signat ure" FT tRNA 1801972..1802045 FT /colour=3 FT /note="tRNA Ile anticodon AAT, Cove score 63.37" FT CDS join(1802601..1802881,1802940..1803048,1803099..1803176, FT 1803241..1803369,1803439..1803879) FT /colour=2 FT /gene="rec12" FT /gene="SPAC17A5.11" FT /label=rec12 FT /note="SPAC17A5.11, len:345aa" FT /product="meiotic recombination protein; similar to S. FT cerevisiae SPO11" FT /fasta_file="fasta/c17A5.tab.seq.01449.out" FT misc_feature 1802882..1802887 FT /colour=6 FT /note="gtaatt, splice donor sequence" FT misc_feature 1802924..1802939 FT /colour=6 FT /note="ctaattacatttgcag, splice branch and acceptor FT sequenc e" FT misc_feature 1803049..1803054 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1803084..1803098 FT /colour=6 FT /note="ttaatttgatcttag, splice branch and acceptor FT sequence" FT misc_feature 1803177..1803182 FT /colour=6 FT /note="gtaggt, splice donor sequence" FT misc_feature 1803215..1803240 FT /colour=6 FT /note="ctaactaagaattttactaaatacag, splice branch and FT accept or sequence" FT misc_feature 1803370..1803375 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1803418..1803438 FT /colour=6 FT /note="ctaactaattgcttgtaacag, splice branch and acceptor FT se quence" FT CDS 1803934..1806027 FT /colour=10 FT /gene="SPAC17A5.12" FT /label=SPAC17A5.12 FT /note="SPAC17A5.12, may need N-terminal truncating, FT len:697 aa; similarity: eg. to YDR320C, Q06677, unknown FT (668aa), fa sta scores, opt:602, E():6.9e-27, (24.3% FT identity in 679 aa overlap)" FT /product="hypothetical protein; similar to S. cerevisiae FT swa2; contains UBA domain" FT /fasta_file="fasta/c17A5.tab.seq.01450.out" FT CDS join(1806176..1806284,1806338..1806633,1806745..1807047) FT /EC_number="3.5.4.16" FT /colour=2 FT /gene="SPAC17A5.13" FT /label=SPAC17A5.13 FT /note="SPAC17A5.13, len:235aa, similarity: to YGR267C, FT GCH1 _YEAST, P51601, GTP cyclohydrolase i, (243aa), fasta FT scores , opt:960, E():0, (62.9% identity in 229 aa FT overlap)" FT /product="GTP cyclohydrolase I" FT /fasta_file="fasta/c17A5.tab.seq.01451.out" FT misc_feature 1806285..1806290 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1806324..1806337 FT /colour=6 FT /note="ctaataccaattag, splice branch and acceptor sequence" FT misc_feature join(1806385..1806633,1806745..1807041) FT /note="Match to PF01227 GTP_cyclohydroI, GTP FT cyclohydrolase I Score 398.72" FT misc_feature 1806562..1806612 FT /colour=8 FT /note="PS00859 GTP cyclohydrolase I signature 1" FT misc_feature 1806634..1806639 FT /colour=6 FT /note="gtaggt, splice donor sequence" FT misc_feature 1806730..1806744 FT /colour=6 FT /note="ctaacattattgtag, splice branch and acceptor FT sequence" FT misc_feature 1806823..1806849 FT /colour=8 FT /note="PS00860 GTP cyclohydrolase I signature 2" FT CDS join(1808225..1808239,1808278..1808345,1808396..1812299) FT /colour=2 FT /gene="exo2" FT /gene="SPAC17A5.14" FT /label=exo2 FT /note="SPAC17A5.14, len:1328aa, similar eg. to YGL173C, FT KEM 1_YEAST, P22147, strand exchange protein 1, (1528aa), FT fasta scores, opt:1499, E():0, (42.8% identity in 1275 aa FT overla p)" FT /product="exonuclease ii" FT /fasta_file="fasta/c17A5.tab.seq.01452.out" FT misc_feature 1808240..1808245 FT /colour=6 FT /note="gttgtt, splice donor sequence" FT misc_feature 1808267..1808277 FT /colour=6 FT /note="ttaacaattag, splice branch and acceptor sequence" FT misc_feature 1808346..1808351 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1808383..1808395 FT /colour=6 FT /note="ctaattgaaatag, splice branch and acceptor sequence" FT misc_feature 1810149..1810172 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS complement(1812611..1814761) FT /EC_number="6.1.1.17" FT /colour=2 FT /gene="SPAC17A5.15c" FT /label=SPAC17A5.15c FT /note="SPAC17A5.15c, putative glutamyl-tRNA synthetase, FT len :716aa, similar eg. to YGL245W, SYEC_YEAST, P46655, FT glutamy l-tRNA synthetase, cytoplasmic (724aa), fasta FT scores, opt:2 450, E():0, (52.2% identity in 724 aa FT overlap)" FT /product="glutamyl-tRNA synthetase, cytoplasmic" FT /fasta_file="fasta/c17A5.tab.seq.01453.out" FT misc_feature complement(1812752..1814146) FT /note="Match to PF00749 tRNA-synt_1c, tRNA synthetases FT class I (E and Q) Score 561.02" FT misc_feature complement(1814090..1814125) FT /colour=8 FT /note="PS00178 Aminoacyl-transfer RNA synthetases class-I FT s ignature" FT CDS join(1816114..1816133,1816176..1816218,1816281..1816313, FT 1816382..1817028,1817127..1817334,1817391..1817768, FT 1817868..1818122,1818175..1819368) FT /colour=10 FT /gene="SPAC17A5.16" FT /label=SPAC17A5.16 FT /note="SPAC17A5.16; len:925aa, similar eg. to C. elegans FT Q2 1136, unknown, (729aa), fasta scores, opt:400, E():9.4e- FT 19, (23.5% identity in 857 aa overlap)" FT /product="conserved protein; no apparent S. cerevisiae FT ortholog" FT /fasta_file="fasta/c17A5.tab.seq.01454.out" FT misc_feature 1816134..1816139 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1816164..1816175 FT /colour=6 FT /note="ctaactgtttag, splice branch and acceptor sequence" FT misc_feature 1816219..1816224 FT /colour=6 FT /note="gtacgg, splice donor sequence" FT misc_feature 1816268..1816280 FT /colour=6 FT /note="ctaattctagtag, splice branch and acceptor sequence" FT misc_feature 1816314..1816319 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 1816354..1816381 FT /colour=6 FT /note="ctaatgtattcgtttttatgtttattag, splice branch and FT acce ptor sequence" FT misc_feature 1817029..1817034 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1817111..1817126 FT /colour=6 FT /note="ctaatcacttttgcag, splice branch and acceptor FT sequenc e" FT misc_feature 1817335..1817340 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1817375..1817390 FT /colour=6 FT /note="ctaacttagtttttag, splice branch and acceptor FT sequenc e" FT misc_feature 1817769..1817774 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1817850..1817867 FT /colour=6 FT /note="ctaactaatttaaaacag, splice branch and acceptor FT seque nce" FT misc_feature 1818123..1818128 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 1818161..1818174 FT /colour=6 FT /note="scttaccgccttccag, plice branch and acceptor FT sequence" FT CDS complement(1821158..1821919) FT /colour=7 FT /gene="SPAC1610.02c" FT /label=SPAC1610.02c FT /note="SPAC1610.02c, len:253, SIMILARITY:Thermotoga FT maritima.thermotoga maritima., RL1_THEMA, 50s ribosomal FT protein l1.50s ribosomal protein l1., (233 aa), fasta FT scores: opt: 354, E():2.5e-16, (34.6% identity in 208 aa)" FT /product="mitochondrial ribosomal protein L1" FT /fasta_file="fasta/c1610.tab.seq.02213.out" FT misc_feature 1820397..1821450 FT /note="nominal overlap with cosmid SPAC17A5 S. pombe FT chromosome 1" FT misc_feature complement(1821197..1821769) FT /note="Match to PF00687 Ribosomal_L1, L1P family of FT ribosomal proteins Score 58.23" FT CDS complement(join(1822269..1823627,1823699..1824173, FT 1824265..1824442,1824528..1824648)) FT /colour=2 FT /gene="meu5" FT /gene="crp79" FT /gene="SPAC1610.03c" FT /label=meu5 FT /note="SPAC1610.03c, len:727, FT SIMILARITY:Schizosaccharomyces pombe, CAB52270, putative FT RNA-binding protein., (609 aa), fasta scores: opt: 378, FT E():1.4e-15, (30.4% identity in 425 aa)" FT /note="prediction updated 24.1.2001, to change exon 3 FT start from 3828 to 3777 to comform with crp 79 submission, FT now has good branch site" FT /product="RNA-binding protein; putative polyadenylate FT binding; meiotic expression upregulated; mRNA export FT carrier" FT /fasta_file="fasta/c1610.tab.seq.02214.out" FT misc_feature complement(1823031..1823252) FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 65.76" FT misc_feature complement(1823628..1823644) FT /colour=6 FT /note="ctaacctcattattaag, splice branch and acceptor" FT intron complement(1823628..1823698) FT /note="confirmed by mRNA" FT misc_feature complement(1823693..1823698) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature complement(1824174..1824189) FT /note="splice branch and acceptor" FT /colour=6 FT intron complement(1824174..1824264) FT /note="confirmed by mRNA" FT misc_feature complement(1824259..1824264) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(join(1824264..1824442,1824528..1824594)) FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 27.31" FT misc_feature complement(1824443..1824458) FT /colour=6 FT /note="ttaatcaattctttag, splice branch and acceptor" FT intron complement(1824443..1824527) FT /note="confirmed by mRNA" FT misc_feature complement(1824522..1824527) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 1827312..1828195 FT /note="nominal overlap with cosmid SPAC1002 S. pombe FT chromosome 1" FT CDS 1825976..1827556 FT /colour=8 FT /gene="SPAC1610.04" FT /label=SPAC1610.04 FT /note="SPAC1610.04, len:526, SIMILARITY:Caenorhabditis FT elegans., O62421, y32f6b.1 protein., (758 aa), fasta FT scores: opt: 124, E():1.5, (27.1% identity in 133 aa)" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c1610.tab.seq.02215.out" FT misc_feature 1827312..1827556 FT /note="CDS SPAC1610.04 see cosmid c1610 for full length FT sequence" FT misc_feature 1827312..1828195 FT /note="nominal overlap with c1610 S. pombe chromosome 1" FT CDS 1828804..1829493 FT /colour=8 FT /fasta_file="fasta/c1002.tab.seq.00208.out" FT /gene="SPAC1002.02" FT /label=SPAC1002.02 FT /note="SPAC1002.02, len:229" FT /product="hypothetical protein; sequence orphan" FT CDS complement(1829888..1832659) FT /colour=7 FT /fasta_file="fasta/c1002.tab.seq.00209.out" FT /gene="SPAC1002.03c" FT /label=SPAC1002.03c FT /note="SPAC1002.03c, len:923, SIMILARITY:Dictyostelium FT discoideum, Q94502, moda., (943 aa), fasta scores: opt: FT 2326, E():0, (39.5% identity in 953 aa)" FT /product="putative alpha glucosidase" FT misc_feature complement(1829978..1832140) FT /note="Match to PF01055 Glyco_hydro_31, Glycosyl FT hydrolases family 31 Score 826.42" FT CDS complement(1833449..1834048) FT /colour=7 FT /fasta_file="fasta/c1002.tab.seq.00210.out" FT /gene="SPAC1002.04c" FT /label=SPAC1002.04c FT /note="SPAC1002.04c, len:199, SIMILARITY:Homo sapiens, FT T2D9_HUMAN, transcription initiation factor tfiid 28 kD FT subunit, (211 aa), fasta scores: opt: 325, E():2.7e-13, FT (35.2% identity in 162 aa)" FT /product="putative transcription initiation factor TFIID FT subunit; similar to S. cerevisiae TAF40" FT CDS complement(1834326..1836473) FT /colour=7 FT /fasta_file="fasta/c1002.tab.seq.00211.out" FT /gene="SPAC1002.05c" FT /label=SPAC1002.05c FT /note="SPAC1002.05c, len:715, SIMILARITY:Caenorhabditis FT elegans., Q23541, zk593.4 protein., (1430 aa), fasta FT scores: opt: 1136, E():0, (31.2% identity in 727 aa)" FT /product="zinc finger protein; zf-C5HC2 type; jmjC domain; FT similar to S. cerevisiae YJR119C similar to retinoblastoma FT binding proteins" FT CDS complement(join(1836946..1837078,1837159..1837318, FT 1837394..1837457)) FT /colour=8 FT /fasta_file="fasta/c1002.tab.seq.00212.out" FT /gene="SPAC1002.06c" FT /label=SPAC1002.06c FT /note="SPAC1002.06c, len:118" FT /product="hypothetical protein; sequence orphan" FT misc_feature complement(1837079..1837095) FT /colour=6 FT /note="ctaaccaccattattag, splice branch and acceptor" FT misc_feature complement(1837153..1837158) FT /colour=6 FT /note="gtattt, splice donor sequence" FT misc_feature complement(1837319..1837328) FT /colour=6 FT /note="ctaaagatag, splice branch and acceptor" FT misc_feature complement(1837388..1837393) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS complement(join(1837918..1838052,1838104..1838214, FT 1838306..1838336,1838383..1838417,1838476..1838594, FT 1838842..1838917)) FT /colour=7 FT /fasta_file="fasta/c1002.tab.seq.00228.out" FT /gene="ats1" FT /gene="SPAC1002.07c" FT /label=ats1 FT /note="SPAC1002.07c, len:168" FT /product="putative N-acetyltransferase; GNAT family; FT closest S. cerevisiae homologs HPA2 and HPA3 are histone FT acetyltransferases; but S. pombe sequence is more similar FT to bacterial acetyltransferases?; human homolog SAT is a FT Spermidine/spermine N1-acetyltransferase which catalyzes FT rate-limiting step in polyamine catabolism; could be FT anything really..." FT misc_feature complement(1838053..1838064) FT /colour=6 FT /note="ctaataccctag, splice branch and acceptor" FT intron complement(1838053..1838103) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1838098..1838103) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1838215..1838234) FT /colour=6 FT /note="ttaaccattcaatttcttag, splice branch and acceptor" FT intron complement(1838215..1838305) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1838300..1838305) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(1838337..1838350) FT /colour=6 FT /note="ctgacgttgaatag, splice branch and acceptor" FT intron complement(1838337..1838382) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1838377..1838382) FT /colour=6 FT /note="gtagtg, splice donor sequence" FT misc_feature complement(1838418..1838438) FT /colour=6 FT /note="ctaatctataattgccatcag, splice branch and acceptor" FT intron complement(1838418..1838475) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1838470..1838475) FT /colour=6 FT /note="gttcgt, splice donor sequence" FT misc_feature complement(1838492..1838902) FT /colour=9 FT /note="Pfam match to entry PF00583 Acetyltransf, FT Acetyltransferase (GNAT) family," FT misc_feature complement(1838595..1838614) FT /colour=6 FT /note="ttaacattttgtttatgaag, splice branch and acceptor" FT intron complement(1838595..1838841) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(1838836..1838841) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT CDS complement(1839699..1840799) FT /colour=7 FT /fasta_file="fasta/c1002.tab.seq.00214.out" FT /gene="SPAC1002.08c" FT /label=SPAC1002.08c FT /note="SPAC1002.08c, len:366, SIMILARITY:Saccharomyces FT cerevisiae, MTF1_YEAST, mitochondrial replication protein FT mtf1, (340 aa), fasta scores: opt: 346, E():1.9e-16, FT (27.8% identity in 327 aa)" FT /product="putative mitochondrial replication protein" FT CDS complement(1841809..1843344) FT /EC_number="1.8.1.4" FT /colour=2 FT /fasta_file="fasta/c1002.tab.seq.00215.out" FT /gene="dld1" FT /gene="dldh" FT /gene="SPAC1002.09c" FT /label=dld1 FT /note="SPAC1002.09c, len:511" FT /product="dihydrolipoamide dehydrogenase, mitochondrial ; FT similar to S. cerevisiae LPD1" FT misc_feature complement(1841812..1843197) FT /note="Match to PF00070 pyr_redox, Pyridine nucleotide- FT disulphide oxidoreductase class-I Score 855.79" FT CDS complement(1843531..1845303) FT /colour=10 FT /fasta_file="fasta/c1002.tab.seq.00216.out" FT /gene="SPAC1002.10c" FT /label=SPAC1002.10c FT /note="SPAC1002.10c, len:590, SIMILARITY:Homo sapiens, FT O95905, hsgt1p., (644 aa), fasta scores: opt: 572, FT E():7.1e-28, (29.1% identity in 629 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YBL046W; no apparent S. cerevisiae ortholog" FT CDS 1846329..1848074 FT /colour=7 FT /fasta_file="fasta/c1002.tab.seq.00217.out" FT /gene="SPAC1002.11" FT /label=SPAC1002.11 FT /note="SPAC1002.11, len:581, SIMILARITY:Homo sapiens, FT O43292, hgaa1., (621 aa), fasta scores: opt: 591, E():5.4e- FT 30, (32.2% identity in 388 aa)" FT /product="putative glycosylphosphatidylinositol anchor FT attachment protein" FT CDS complement(1848371..1849867) FT /colour=7 FT /fasta_file="fasta/c1002.tab.seq.00218.out" FT /gene="SPAC1002.12c" FT /label=SPAC1002.12c FT /note="SPAC1002.12c, len:498, SIMILARITY:Escherichia coli., FT GABD_ECOLI, succinate-semialdehyde dehydrogenase [nadp+], FT (482 aa), fasta scores: opt: 1792, E():0, (55.4% identity FT in 482 aa)" FT /product="putative succinate-semialdehyde dehydrogenase" FT misc_feature complement(1848377..1849777) FT /note="Match to PF00171 aldedh, Aldehyde dehydrogenase FT Score 639.77" FT misc_feature complement(1848947..1848982) FT /colour=8 FT /note="PS00070 Aldehyde dehydrogenases cysteine active FT site, [FYLVA].{3}G[QE].C[LIVMGSTANC][AGCN].[GSTADNEKR], FT info count = 18.9" FT misc_feature complement(1849043..1849066) FT /colour=8 FT /note="PS00687 Aldehyde dehydrogenases glutamic acid FT active site, [LIVMFGA]E[LIMSTAC][GS]G[KNLM][SADN][TAPFV], FT info count = 19.3" FT CDS complement(1851612..1852865) FT /colour=2 FT /fasta_file="fasta/c1002.tab.seq.00219.out" FT /gene="psu1" FT /gene="SPAC1002.13c" FT /label=psu1 FT /note="SPAC1002.13c, len:417" FT /product="cell wall synthesis protein" FT CDS 1853648..1853953 FT /colour=9 FT /fasta_file="fasta/c1002.tab.seq.00220.out" FT /gene="SPAC1002.20" FT /label=SPAC1002.20 FT /note="SPAC1002.20" FT /product="very hypothetical protein" FT CDS 1854461..1855768 FT /colour=10 FT /fasta_file="fasta/c1002.tab.seq.00221.out" FT /gene="SPAC1002.14" FT /label=SPAC1002.14 FT /note="SPAC1002.14, len:435, SIMILARITY:Homo sapiens, FT O94793, hrihfb2038 protein, (189 aa), fasta scores: opt: FT 530, E():5.7e-26, (39.8% identity in 181 aa)" FT /product="zinc finger protein; zf-C3HC4 type (RING FT finger); similar to S. cerevisiae YML068W" FT misc_feature 1854980..1855075 FT /colour=9 FT /note="Pfam match to entry PF00097 zf-C3HC4, zinc finger, FT C3HC4 type (RING finger)," FT misc_feature 1855196..1855384 FT /colour=9 FT /note="Pfam match to entry PF01485 IBR, IBR domain," FT CDS complement(join(1855836..1856099,1856141..1856223, FT 1856279..1856485,1856641..1856737)) FT /colour=7 FT /fasta_file="fasta/c1002.tab.seq.00222.out" FT /gene="SPAC1002.15c" FT /label=SPAC1002.15c FT /note="SPAC1002.15c, len:216, SIMILARITY:Caenorhabditis FT elegans., O18534, RNA polymerase transcriptional FT regulation mediator., (246 aa), fasta scores: opt: 274, FT E():1.4e-11, (29.6% identity in 169 aa)" FT /product="putative component of RNA polymerase II FT holoenzyme and mediator subcomplex; RNA polymerase FT transcriptional regulation mediator" FT misc_feature complement(1856100..1856110) FT /colour=6 FT /note="ctaacgtctag, splice branch and acceptor" FT misc_feature complement(1856135..1856140) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature complement(1856224..1856237) FT /colour=6 FT /note="ttaacttttactag, splice branch and acceptor" FT misc_feature complement(1856273..1856278) FT /colour=6 FT /note="gtatat, splice donor sequence" FT misc_feature complement(1856486..1856503) FT /colour=6 FT /note="ctaatatagaaaacttag, splice branch and acceptor" FT misc_feature complement(1856635..1856640) FT /colour=6 FT /note="gtgagt, splice donor sequence" FT CDS complement(1857547..1859046) FT /colour=7 FT /fasta_file="fasta/c1002.tab.seq.00223.out" FT /gene="SPAC1002.16c" FT /label=SPAC1002.16c FT /note="SPAC1002.16c, len:499, FT SIMILARITY:Schizosaccharomyces pombe, YAOI_SCHPO, putative FT transporter c11d3.18c., (498 aa), fasta scores: opt: 1340, FT E():0, (45.7% identity in 475 aa)" FT /product="MFS transporter of unknown specificity" FT misc_feature complement(1857619..1858884) FT /colour=9 FT /note="Pfam match to entry PF00083 sugar_tr, Sugar (and FT other) transporter," FT CDS complement(1860688..1861257) FT /colour=7 FT /fasta_file="fasta/c1002.tab.seq.00224.out" FT /gene="SPAC1002.17c" FT /label=SPAC1002.17c FT /note="SPAC1002.17c, len:189, SIMILARITY:Bacillus FT subtilis.bacillus subtilis., UPP_BACSU, uracil FT phosphoribosyltransferase, (209 aa), fasta scores: opt: FT 389, E():1.8e-19, (32.4% identity in 207 aa)" FT /product="putative uracil phosphoribosyltransferase" FT misc_feature complement(1860823..1861203) FT /note="Match to PF00156 Pribosyltran, Phosphoribosyl FT transferase domain Score 37.54" FT CDS 1862133..1863332 FT /colour=10 FT /gene="SPAC1002.18" FT /label=SPAC1002.18 FT /note="SPAC1002.18, len:399" FT /product="hypothetical protein; conserved in other yeasts FT (Gaillardin et al); similar to N. crassa 3H10.120; no FT apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c1002.tab.seq.00229.out" FT CDS complement(1864551..1864997) FT /colour=9 FT /fasta_file="fasta/c1002.tab.seq.00226.out" FT /gene="SPAC1002.21" FT /label=SPAC1002.21 FT /note="SPAC1002.21, len:101" FT /product="very hypothetical protein" FT CDS 1865145..1866464 FT /colour=7 FT /gene="SPAC1002.19" FT /label=SPAC1002.19 FT /note="SPAC1002.19, len:439, SIMILARITY:Aquifex aeolicus., FT O66679, GTP cyclohydrolase ii., (406 aa), fasta scores: FT opt: 224, E():2.9e-07, (23.9% identity in 426 aa)" FT /product="putative GTP cyclohydrolase (bacterial type); FT riboflavin biosynthesis; no apparent S. cerevisiae FT ortholog" FT /fasta_file="fasta/c1002.tab.seq.00230.out" FT misc_feature 1865808..1866341 FT /colour=9 FT /note="Pfam match to entry PF00925 GTP_cyclohydro2, GTP FT cyclohydrolase II," FT misc_feature 1867365..1867583 FT /note="nominal overlap with SPAC1002 S. pombe chromosome 1" FT misc_feature complement(1867593..1867620) FT /note="polyA 28 bases" FT CDS join(1868263..1868528,1868646..1869969) FT /colour=7 FT /gene="SPAC1399.05c" FT /label=SPAC1399.05c FT /note="SPAC1399.05c, len:530, SIMILARITY:Saccharomyces FT cerevisiae, Q06719, mutant mal2-8cp malp, (470 aa), fasta FT scores: opt: 154, E():0.014, (23.6% identity in 140 aa)" FT /product="putative transcriptional regulator; zinc finger FT protein; fungal binuclear cluster domain" FT /fasta_file="fasta/c1399.tab.seq.02299.out" FT misc_feature 1868529..1868534 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 1868616..1868645 FT /colour=6 FT /note="ctaacaaatttactaaactgcttattatag, splice branch and FT acceptor" FT CDS 1870297..1870959 FT /colour=7 FT /gene="SPAC1399.04c" FT /label=SPAC1399.04c FT /note="SPAC1399.04c, len:221, SIMILARITY:Toxoplasma FT gondii.toxoplasma gondii., UPP_TOXGO, uracil FT phosphoribosyltransferase, (244 aa), fasta scores: opt: FT 710, E():0, (52.9% identity in 210 aa)" FT /product="putative uracil phosphoribosyltransferase" FT /fasta_file="fasta/c1399.tab.seq.02300.out" FT CDS complement(1871612..1873357) FT /colour=2 FT /gene="fur4" FT /gene="SPAC1399.03" FT /label=fur4 FT /note="SPAC1399.03, len:582" FT /product="uracil permease" FT /fasta_file="fasta/c1399.tab.seq.02301.out" FT CDS complement(1875797..1877566) FT /colour=7 FT /gene="SPAC1399.02" FT /label=SPAC1399.02 FT /note="SPAC1399.02, len:590, FT SIMILARITY:Schizosaccharomyces pombe, YAN6_SCHPO, FT hypothetical 63.5 kDa protein c3h1.06c in chromosome i., FT (589 aa), fasta scores: opt: 3469, E():0, (89.0% identity FT in 589 aa)" FT /product="MFS transporter of unknown specificity" FT /fasta_file="fasta/c1399.tab.seq.02302.out" FT misc_feature complement(1877567..1882303) FT /note="low complexity gene free region with strand FT inversion (ie (G-C)/(G+C) inversion)" FT misc_feature 1879914..1879997 FT /note="low complexity sequence around point of inflection" FT CDS 1882303..1884108 FT /colour=7 FT /gene="SPAC1399.01c" FT /label=SPAC1399.01c FT /note="SPAC1399.01c, len:602, SIMILARITY:Emericella FT nidulans, UAPC_EMENI, purine permease., (580 aa), fasta FT scores: opt: 2173, E():0, (56.4% identity in 560 aa)" FT /product="putative purine permease" FT /fasta_file="fasta/c1399.tab.seq.02303.out" FT misc_feature 1882507..1883799 FT /note="Match to PF00860 xan_ur_permease, Xanthine/uracil FT permeases family Score 497.47" FT misc_feature 1884417..1884620 FT /note="nominal overlap with c1399 S. pombe chromosome 1" FT CDS 1885482..1886474 FT /colour=7 FT /gene="SPAP11E10.01" FT /label=SPAP11E10.01 FT /note="SPAP11E10.01, len:331, SIMILARITY:Arabidopsis FT thaliana, BAB10429, similar to ornithine cyclodeaminase., FT (325 aa), fasta scores: opt: 608, E():0, (35.8% identity FT in 327 aa)" FT /product="putative ornithine cyclodeaminase; Mu-crystallin- FT like; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/p11E10.tab.seq.02335.out" FT misc_feature 1888146..1888267 FT /note="nominal overlap with pB1A10" FT misc_feature 1888146..1888267 FT /note="nominal overlap with p11E10 S. pombe chromosome 1" FT CDS 1891610..1892620 FT /colour=7 FT /gene="SPAPB1A10.02" FT /label=SPAPB1A10.02 FT /note="SPAPB1A10.02, len:337, SIMILARITY:Gallus gallus, FT ENOA_CHICK, alpha enolase, (433 aa), fasta scores: opt: FT 141, E():0.18, (27.9% identity in 201 aa)" FT /product="putative alpha enolase; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/pB1A10.tab.seq.00031.out" FT CDS join(1893039..1893057,1893110..1893381,1893753..1894064) FT /colour=7 FT /gene="SPAPB1A10.03" FT /label=SPAPB1A10.03 FT /note="SPAPB1A10.03, len:201, SIMILARITY:Homo sapiens, FT Q9NPJ8, p15-2a protein, (142 aa), fasta scores: opt: 214, FT E():8e-07, (28.0% identity in 118 aa)" FT /product="putative nuclear export factor" FT /fasta_file="fasta/pB1A10.tab.seq.02346.out" FT misc_feature 1893058..1893063 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1893097..1893109 FT /colour=6 FT /note="ctaacaattaaag, splice branch and acceptor" FT misc_feature 1893382..1893387 FT /colour=6 FT /note="gtcagt, splice donor sequence" FT CDS complement(join(1894349..1894556,1894608..1895284)) FT /colour=2 FT /gene="cwp1" FT /gene="SPAPB1A10.04c" FT /label=cwp1 FT /note="SPAPB1A10.04c, len:295" FT /product="geranylgeranyl transferase type i" FT /fasta_file="fasta/pB1A10.tab.seq.02347.out" FT misc_feature complement(1894557..1894571) FT /colour=6 FT /note="ttaacttttttacag, splice branch and acceptor" FT misc_feature complement(1894602..1894607) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1894607..1894681) FT /note="Match to PF01239 PPTA, protein prenyltransferase FT alpha subunit repeat Score 34.83" FT misc_feature complement(1894718..1894798) FT /note="Match to PF01239 PPTA, protein prenyltransferase FT alpha subunit repeat Score 46.95" FT misc_feature complement(1894808..1894900) FT /note="Match to PF01239 PPTA, protein prenyltransferase FT alpha subunit repeat Score 56.54" FT misc_feature complement(1894910..1895002) FT /note="Match to PF01239 PPTA, protein prenyltransferase FT alpha subunit repeat Score 47.18" FT misc_feature complement(1895015..1895107) FT /note="Match to PF01239 PPTA, protein prenyltransferase FT alpha subunit repeat Score 39.91" FT CDS 1896838..1897695 FT /colour=8 FT /gene="SPAPB1A10.05" FT /label=SPAPB1A10.05 FT /note="SPAPB1A10.05, len:286, SIMILARITY:Caenorhabditis FT elegans., O76471, cytoplasmic signalling transducer, (554 FT aa), fasta scores: opt: 133, E():0.75, (23.9% identity in FT 251 aa)" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/pB1A10.tab.seq.02348.out" FT CDS complement(join(1897928..1901191,1901239..1901526)) FT /colour=7 FT /gene="SPAPB1A10.06c" FT /label=SPAPB1A10.06c FT /note="SPAPB1A10.06c, len:1184" FT /product="putative ATP-dependent RNA helicase" FT /fasta_file="fasta/pB1A10.tab.seq.02349.out" FT misc_feature complement(1899116..1899385) FT /note="Match to PF00271 helicase_C, Helicases conserved C- FT terminal domain Score 26.23" FT misc_feature complement(1901192..1901207) FT /colour=6 FT /note="ctaacaaccttattag, splice branch and acceptor" FT misc_feature complement(1901233..1901238) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS complement(join(1902099..1902148,1902198..1903473)) FT /colour=10 FT /gene="SPAPB1A10.07c" FT /label=SPAPB1A10.07c FT /note="SPAPB1A10.07c, len:438" FT /product="hypothetical protein; similar to S. cerevisiae FT YDR105C; contains 10 predicted transmembrane helices; FT predicted N-terminal signal sequence" FT /fasta_file="fasta/pB1A10.tab.seq.02350.out" FT misc_feature complement(1902149..1902166) FT /colour=6 FT /note="ctaacaacaatatttcag, splice branch and acceptor" FT misc_feature complement(1902192..1902197) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS join(1905947..1906562,1906635..1907257) FT /colour=8 FT /gene="SPAPB1A10.08" FT /label=SPAPB1A10.08 FT /note="SPAPB1A10.08, len:413, SIMILARITY:Staphylococcus FT aureus., Q9KWZ5, hypothetical 28.4 kDa protein., (241 aa), FT fasta scores: opt: 138, E():0.12, (28.4% identity in 169 FT aa)" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/pB1A10.tab.seq.02351.out" FT misc_feature 1906563..1906568 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1906620..1906634 FT /colour=6 FT /note="ctaacaatatcatag, splice branch and acceptor" FT CDS join(1908038..1908461,1908509..1910280) FT /colour=7 FT /gene="SPAPB1A10.09" FT /label=SPAPB1A10.09 FT /note="SPAPB1A10.09, len:732, SIMILARITY:Drosophila FT melanogaster, Q9VZ62, cg11207 protein., (671 aa), fasta FT scores: opt: 406, E():2.8e-14, (23.0% identity in 662 aa)" FT /product="putative microtubule-associated protein; FT possibly required for anaphase spindle elongation; similar FT to S. cerevisiae ASE1; similar to human prc1, protein FT regulating cytokinesis" FT /fasta_file="fasta/pB1A10.tab.seq.02352.out" FT misc_feature 1908462..1908467 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1908498..1908508 FT /colour=6 FT /note="ctgatgtatag, splice branch and acceptor" FT CDS complement(join(1910555..1911001,1911056..1911154, FT 1911506..1911586)) FT /colour=7 FT /gene="ypt71" FT /gene="SPAPB1A10.10c" FT /label=ypt71 FT /note="SPAPB1A10.10c, len:209, FT SIMILARITY:Schizosaccharomyces pombe, O94655, ras-related FT protein rab-7., (205 aa), fasta scores: opt: 831, E():0, FT (59.3% identity in 209 aa)" FT /product="GTP-binding protein; possibly involved in FT endocytosis and vacuole function; rab family; ras family" FT /fasta_file="fasta/pB1A10.tab.seq.02353.out" FT misc_feature complement(join(1910558..1911001,1911056..1911154, FT 1911506..1911559)) FT /note="Match to PF00071 ras, Ras family Score 221.47" FT misc_feature complement(1911002..1911015) FT /colour=6 FT /note="ctaattataaacag, splice branch and acceptor" FT misc_feature complement(1911050..1911055) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1911155..1911172) FT /colour=6 FT /note="ttaacatcgtcattttag, splice branch and acceptor" FT misc_feature complement(1911500..1911505) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS complement(1912147..1913727) FT /colour=7 FT /gene="SPAPB1A10.11c" FT /label=SPAPB1A10.11c FT /note="SPAPB1A10.11c, len:527, SIMILARITY:Saccharomyces FT cerevisiae, SYEM_YEAST, glutamyl-tRNA synthetase, FT mitochondrial, (536 aa), fasta scores: opt: 1046, E():0, FT (38.4% identity in 537 aa)" FT /product="putative glutamyl-tRNA synthetase, mitochondrial" FT /fasta_file="fasta/pB1A10.tab.seq.02354.out" FT misc_feature complement(1912192..1913259) FT /note="Match to PF00749 tRNA-synt_1c, tRNA synthetases FT class I (E and Q) Score 235.44" FT misc_feature complement(1913314..1913628) FT /note="Match to PF00749 tRNA-synt_1c, tRNA synthetases FT class I (E and Q) Score 179.05" FT CDS complement(join(1914293..1915552,1915754..1915879)) FT /colour=7 FT /gene="SPAPB1A10.12c" FT /label=SPAPB1A10.12c FT /note="SPAPB1A10.12c, len:462, SIMILARITY:Saccharomyces FT cerevisiae, ALO_YEAST, d-arabinono-1,4-lactone oxidase, FT (526 aa), fasta scores: opt: 727, E():0, (33.3% identity FT in 447 aa)" FT /product="putative d-arabinono-1,4-lactone oxidase" FT /fasta_file="fasta/pB1A10.tab.seq.02355.out" FT misc_feature complement(1915553..1915571) FT /colour=6 FT /note="ctaacattattatttttag, splice branch and acceptor" FT misc_feature complement(1915748..1915753) FT /colour=6 FT /note="gtaatg, splice donor sequence" FT CDS 1917361..1918950 FT /colour=10 FT /gene="SPAPB1A10.13" FT /label=SPAPB1A10.13 FT /note="SPAPB1A10.13, len:530, SIMILARITY:Sus scrofa, FT Q29071, gastric mucin, (528 aa), fasta scores: opt: 312, FT E():3e-09, (23.5% identity in 476 aa)" FT /product="hypothetical protein; similar to proteoglycans" FT /fasta_file="fasta/pB1A10.tab.seq.02356.out" FT CDS 1920596..1921327 FT /colour=8 FT /gene="SPAPB1A10.14" FT /label=SPAPB1A10.14 FT /note="SPAPB1A10.14, len:244, SIMILARITY:Saccharomyces FT cerevisiae, Q04925, hypothetical 47.4 kDa protein., (415 FT aa), fasta scores: opt: 124, E():0.24, (22.5% identity in FT 142 aa)" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/pB1A10.tab.seq.02357.out" FT CDS join(1922230..1922316,1922602..1922736,1922774..1923180, FT 1923261..1923294) FT /colour=7 FT /gene="SPAPB1A10.15" FT /label=SPAPB1A10.15 FT /note="SPAPB1A10.15, len:221, SIMILARITY:Arabidopsis FT thaliana, Q9M127, hypothetical 28.9 kDa protein., (252 aa), FT fasta scores: opt: 227, E():5.8e-09, (28.2% identity in FT 206 aa)" FT /product="possibly involved in sterol uptake and FT distribution into the plasma membrane; similar to S. FT cerevisiae ARV1; contains 4 predicted transmembrane FT helices" FT /fasta_file="fasta/pB1A10.tab.seq.02358.out" FT misc_feature 1922317..1922322 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1922584..1922601 FT /colour=6 FT /note="ctaacgactatgttacag, splice branch and acceptor" FT misc_feature 1922737..1922742 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 1923181..1923186 FT /colour=6 FT /note="gtattt, splice donor sequence" FT misc_feature 1924488..1924629 FT /note="nominal overlap with SPAC140 S. pombe chromosome 1" FT CDS 1925209..1925967 FT /EC_number="1.3.5.1" FT /colour=2 FT /gene="sdh2" FT /gene="SPAC140.01" FT /label=sdh2 FT /note="SPAC140.01, len:253" FT /product="succinate dehydrogenase (ubiquinone) reductase; FT TCA cycle; mitochondrial; iron-sulfur protein subunit" FT /fasta_file="fasta/c140.tab.seq.02093.out" FT misc_feature 1925686..1925913 FT /note="Match to PF00037 fer4, 4Fe-4S ferredoxins and FT related iron-sulfur cluster binding domains. Score 48.63" FT CDS 1927199..1928701 FT /colour=2 FT /gene="gar2" FT /gene="SPAC140.02" FT /label=gar2 FT /note="SPAC140.02, len:501" FT /product="gar2 protein" FT /fasta_file="fasta/c140.tab.seq.02094.out" FT misc_feature 1927991..1928194 FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 90.37" FT misc_feature 1928300..1928509 FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 104.50" FT CDS join(1929728..1929841,1929883..1929965,1930005..1930022, FT 1930062..1930313,1930375..1931107) FT /colour=8 FT /gene="SPAC140.03" FT /label=SPAC140.03 FT /note="SPAC140.03, len:400" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c140.tab.seq.02095.out" FT misc_feature 1929842..1929847 FT /colour=6 FT /note="gtattt, splice donor sequence" FT misc_feature 1929869..1929882 FT /colour=6 FT /note="ctaataaatattag, splice branch and acceptor" FT misc_feature 1929966..1929971 FT /colour=6 FT /note="gtgaga, splice donor sequence" FT misc_feature 1929992..1930004 FT /colour=6 FT /note="ctaacacttctag, splice branch and acceptor" FT misc_feature 1930023..1930028 FT /colour=6 FT /note="gttagt, splice donor sequence" FT misc_feature 1930050..1930061 FT /colour=6 FT /note="ctgacaaattag, splice branch and acceptor" FT misc_feature 1930314..1930319 FT /colour=6 FT /note="gtgagt, splice donor sequence" FT misc_feature 1930361..1930374 FT /colour=6 FT /note="ctaatcaatttaag, splice branch and acceptor" FT CDS 1931995..1932882 FT /colour=10 FT /gene="SPAC140.04" FT /label=SPAC140.04 FT /note="SPAC140.04, len:296, SIMILARITY:Homo sapiens, FT CALD_HUMAN, caldesmon, (793 aa), fasta scores: opt: 178, FT E():0.0059, (22.0% identity in 259 aa)" FT /product="hypothetical protein; similar to N. crassa FT B24B19.20; predicted coiled-coil region" FT /fasta_file="fasta/c140.tab.seq.02096.out" FT misc_feature 1932884..1937943 FT /note="low complexity gene-free region" FT misc_feature 1939417..1939812 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 128.12" FT misc_feature 1939536..1939813 FT /note="nominal overlap with SPAC140 S. pombe chromosome 1" FT misc_feature 1939546..1940265 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 247.77" FT CDS 1941718..1945335 FT /colour=2 FT /gene="pds5" FT /gene="SPAC110.02" FT /label=pds5 FT /note="SPAC110.02, len:1206" FT /product="involved in sister chromatid cohesion; required FT for accurate chromosome segregation (PMID: 11861765); FT required for survival after DNA damage (PMID: 11861765); FT required for survival after metaphase arrest (PMID: FT 11861765); similar to S. cerevisiae PDS5" FT /fasta_file="fasta/c110.tab.seq.02296.out" FT CDS join(1945784..1945831,1945995..1946063,1946494..1946955) FT /colour=2 FT /gene="cdc42" FT /gene="SPAC110.03" FT /label=cdc42 FT /note="SPAC110.03, len:193" FT /product="Rho family; RAS small GTPase; guanine nucleotide FT exchange factor; involved in polarity; involved in mating; FT involved in cell morphology; involved in endocytosis; FT essential" FT /fasta_file="fasta/c110.tab.seq.02297.out" FT misc_feature join(1945796..1945831,1945995..1946063,1946494..1946952) FT /note="Match to PF00071 ras, Ras family Score 237.97" FT intron 1945832..1945994 FT /note="confirmed by mRNA" FT intron 1946064..1946493 FT /note="confirmed by mRNA" FT misc_feature complement(1947884..1949515) FT /note="Match to PF00012 HSP70, Hsp70 protein Score 288.72" FT misc_feature 1949143..1949517 FT /note="nominal overlap with SPAP14E8 S. pombe chromosome 1" FT intron complement(1949878..1950282) FT /colour=2 FT /note="confirmed intron" FT CDS join(1952632..1952761,1952869..1954439) FT /colour=10 FT /gene="SPAP14E8.02" FT /label=SPAP14E8.02 FT /note="SPAP14E8.02, len:566, LOW SIMILARITY:Saccharomyces FT cerevisiae, Q06266, chromosome xii cosmid 9470., (489 aa), FT fasta scores: opt: 251, E():1.7e-07, (26.9% identity in FT 301 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT TOS4; serine-rich protein" FT /fasta_file="fasta/p14E8.tab.seq.02139.out" FT misc_feature 1952762..1952767 FT /colour=6 FT /note="gtaagg, splice donor sequence" FT misc_feature 1952854..1952868 FT /colour=6 FT /note="ctaatattaatttag, splice branch and acceptor" FT CDS join(1954778..1954801,1954853..1954949,1955022..1955608) FT /colour=2 FT /gene="bos1" FT /gene="SPAP14E8.03" FT /label=bos1 FT /note="SPAP14E8.03, len:235, SIMILARITY:Saccharomyces FT cerevisiae, BOS1_YEAST, vesicular transport protein bos1., FT (244 aa), fasta scores: opt: 219, E():6.1e-07, (27.9% FT identity in 251 aa)" FT /product="ER to golgi SNARE" FT /fasta_file="fasta/p14E8.tab.seq.02140.out" FT misc_feature 1954802..1954807 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1954834..1954852 FT /colour=6 FT /note="ttaatttgtatttcgctag, splice branch and acceptor" FT misc_feature 1954950..1954955 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 1955003..1955021 FT /colour=6 FT /note="ctaatgcaaatcaatttag, splice branch and acceptor" FT CDS 1956415..1957428 FT /colour=7 FT /gene="SPAP14E8.04" FT /label=SPAP14E8.04 FT /note="SPAP14E8.04, len:337, SIMILARITY:Saccharomyces FT cerevisiae, YK67_YEAST, hypothetical 35.8 kD protein in FT prp16-srp40 intergenic region., (314 aa), fasta scores: FT opt: 591, E():0, (39.6% identity in 308 aa)" FT /product="putative zinc metallopeptidase" FT /fasta_file="fasta/p14E8.tab.seq.02141.out" FT misc_feature 1956844..1957329 FT /colour=9 FT /note="Pfam match to entry PF01435 Peptidase_M48, FT Peptidase family M48, score -24.50, E-value 0.00025" FT CDS complement(1957694..1957999) FT /colour=10 FT /gene="SPAP14E8.05c" FT /label=SPAP14E8.05c FT /note="SPAP14E8.05c, len:101, SIMILARITY:Saccharomyces FT cerevisiae, YJ55_YEAST, hypothetical 11.3 kD protein in FT mir1-ste18 intergenic region., (105 aa), fasta scores: FT opt: 212, E():8.4e-09, (38.5% identity in 96 aa)" FT /product="conserved protein; contains 3 predicted FT transmembrane helices" FT /fasta_file="fasta/p14E8.tab.seq.02142.out" FT misc_feature 1960351..1960457 FT /note="nominal overlap with cosmid SPAC3H1 EM:Z68144 S. FT pombe chromosome 1" FT misc_feature 1960351..1960457 FT /note="nominal overlap with plasmid SPAP14E8, EM:AL159180 FT S. pombe chromosome 1" FT misc_feature complement(1960761..1960777) FT /colour=6 FT /note="ctaactaaattgtttag, splice branch and acceptor" FT misc_feature complement(1960799..1960804) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS complement(1961264..1964374) FT /colour=7 FT /gene="SPAC3H1.02c" FT /label=SPAC3H1.02c FT /note="SPAC3H1.02c, len:1036, SIMILARITY:Saccharomyces FT cerevisiae, YOJ8_YEAST, hypothetical 118.4 kD protein, FT (1037 aa), fasta scores: opt: 1381, E():0, (29.3% identity FT in 1068 aa)" FT /product="putative zinc metallopeptidase" FT /fasta_file="fasta/c3H1.tab.seq.01402.out" FT misc_feature complement(1963889..1964278) FT /note="Match to PF00675 Peptidase_M16, Insulinase FT (Peptidase family M16) Score 21.57" FT CDS 1965033..1965473 FT /colour=10 FT /gene="SPAC3H1.03" FT /label=SPAC3H1.03 FT /note="SPAC3H1.03, len:146" FT /product="conserved protein; contains Pfam_B 16368 which FT is present in a number of transcriptional regulators; no FT apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c3H1.tab.seq.00029.out" FT CDS complement(join(1965752..1965910,1966012..1967658)) FT /colour=10 FT /gene="SPAC3H1.04c" FT /label=SPAC3H1.04c FT /note="SPAC3H1.04c, len:601, SIMILARITY:Candida albicans, FT O94022, hypothetical 69.0 kD protein., (595 aa), fasta FT scores: opt: 1014, E():0, (40.0% identity in 508 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YOR147W; Pfam-B_9984" FT /fasta_file="fasta/c3H1.tab.seq.01404.out" FT misc_feature complement(1965911..1965926) FT /colour=6 FT /note="ctaatttttgatgtag, splice branch and acceptor" FT misc_feature complement(1966006..1966011) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS join(1968576..1968680,1968751..1970070) FT /colour=7 FT /gene="SPAC3H1.05" FT /label=SPAC3H1.05 FT /note="SPAC3H1.05, len:474, SIMILARITY:Saccharomyces FT cerevisiae, ST24_YEAST, caax prenyl protease 1, (453 aa), FT fasta scores: opt: 896, E():0, (40.5% identity in 454 aa)" FT /product="putative caax prenyl protease 1" FT /fasta_file="fasta/c3H1.tab.seq.01405.out" FT misc_feature 1968681..1968686 FT /colour=6 FT /note="gtatat, splice donor sequence" FT misc_feature 1968736..1968750 FT /colour=6 FT /note="ttaacgtttttatag, splice branch and acceptor" FT misc_feature 1968997..1969041 FT /note="PS00678 Beta-transducin family Trp-Asp repeats FT signature" FT misc_feature 1969456..1970040 FT /note="Match to PF01435 Peptidase_M48, Peptidase family FT M48 Score 388.94" FT misc_feature 1969630..1969659 FT /note="PS00142 Neutral zinc metallopeptidases, zinc FT binding region signature" FT CDS complement(1970693..1972462) FT /colour=7 FT /gene="SPAC3H1.06c" FT /label=SPAC3H1.06c FT /note="SPAC3H1.06c, len:589, FT SIMILARITY:Schizosaccharomyces pombe, O42922, hypothetical FT 65.3 kD protein c16a3.17c in chromosome ii., (599 aa), FT fasta scores: opt: 1624, E():0, (42.8% identity in 587 aa)" FT /product="MFS drug efflux transporter of unknown FT specificity" FT /fasta_file="fasta/c3H1.tab.seq.01406.out" FT CDS 1973907..1974878 FT /EC_number="3.5.3.1" FT /colour=2 FT /gene="aru1" FT /gene="SPAC3H1.07" FT /label=aru1 FT /note="SPAC3H1.07, len:323" FT /product="arginase" FT /fasta_file="fasta/c3H1.tab.seq.01407.out" FT misc_feature 1973982..1974791 FT /note="Match to PF00491 arginase, Arginase family Score FT 525.04" FT CDS complement(join(1975102..1975528,1975569..1975777)) FT /colour=10 FT /gene="SPAC3H1.08c" FT /label=SPAC3H1.08c FT /note="SPAC3H1.08c, len:211, SIMILARITY:Saccharomyces FT cerevisiae, YFE6_YEAST, hypothetical 24.0 kD protein in FT emp47-sec53 intergenic region., (207 aa), fasta scores: FT opt: 273, E():5e-10, (26.1% identity in 165 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YFL046W; predicted coiled-coil region" FT /fasta_file="fasta/c3H1.tab.seq.01408.out" FT misc_feature complement(1975529..1975540) FT /colour=6 FT /note="ctaacgttatag, splice branch and acceptor" FT misc_feature complement(1975563..1975568) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS complement(join(1976495..1976687,1976736..1977430, FT 1977471..1977657,1977722..1978617)) FT /colour=7 FT /gene="SPAC3H1.09c" FT /label=SPAC3H1.09c FT /note="SPAC3H1.09c, len:656, SIMILARITY:Saccharomyces FT cerevisiae, YKO6_YEAST, hypothetical 75.5 kD protein in FT sdh1-cim5/yta3 intergenic region., (692 aa), fasta scores: FT opt: 1462, E():0, (44.7% identity in 637 aa)" FT /product="putative AAAP amino acid transporter" FT /fasta_file="fasta/c3H1.tab.seq.01409.out" FT misc_feature complement(1976688..1976699) FT /colour=6 FT /note="ctaacaatttag, splice branch and acceptor" FT misc_feature complement(1976730..1976735) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(1977431..1977444) FT /colour=6 FT /note="ctaaatgcattaag, splice branch and acceptor" FT misc_feature complement(1977465..1977470) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(1977658..1977672) FT /colour=6 FT /note="ttaaccgatgtctag, splice branch and acceptor" FT misc_feature complement(1977716..1977721) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS 1979432..1980676 FT /colour=7 FT /gene="SPAC3H1.10" FT /label=SPAC3H1.10 FT /note="SPAC3H1.10, len:414, SIMILARITY:Arabidopsis FT thaliana, Q9ZPM2, cadmium resistance factor 1., (485 aa), FT fasta scores: opt: 766, E():0, (35.3% identity in 394 aa)" FT /product="phytochelatin synthetase; involved in cadmium FT resistance" FT /fasta_file="fasta/c3H1.tab.seq.01410.out" FT misc_feature 1980677..1988986 FT /note="putative gene free region" FT misc_feature complement(1985418..1985556) FT /note="slightly palindromic region at the middle of gene FT free region; causing self match" FT mRNA 1985643..1985746 FT /colour=3 FT /note="mRNA from spc09196 104 1" FT CDS 1988987..1990735 FT /colour=7 FT /gene="SPAC3H1.11" FT /label=SPAC3H1.11 FT /note="SPAC3H1.11, len:582, SIMILARITY:Nectria FT haematococca., Q00878, cutinase g-box binding protein., FT (540 aa), fasta scores: opt: 312, E():2.9e-09, (26.7% FT identity in 465 aa)" FT /product="putative transcriptional activator; zinc finger FT protein; zf-C2H2 type; simialr to S. cerevisiae MSN1 and FT MSN2" FT /fasta_file="fasta/c3H1.tab.seq.01411.out" FT misc_feature 1990253..1990324 FT /note="Match to PF00096 zf-C2H2, zinc finger, C2H2 type FT Score 38.39" FT misc_feature 1990343..1990405 FT /note="Match to PF00096 zf-C2H2, zinc finger, C2H2 type FT Score 29.54" FT CDS complement(1991386..1994781) FT /colour=10 FT /gene="SPAC3H1.12c" FT /label=SPAC3H1.12c FT /note="SPAC3H1.12c, len:1131, SIMILARITY:Arabidopsis FT thaliana, AAD24841, putative phd-type zinc finger protein., FT (178 aa), fasta scores: opt: 243, E():3.9e-08, (31.5% FT identity in 108 aa)" FT /product="zinc finger protein; zf-PHD type; BAH domain FT protein" FT /fasta_file="fasta/c3H1.tab.seq.01412.out" FT misc_feature complement(1993852..1994007) FT /note="Match to PF00628 PHD, PHD-finger Score 71.71" FT misc_feature complement(1994113..1994475) FT /note="Match to PF01426 BAH, BAH domain Score 123.45" FT CDS join(1994849..1994970,1995010..1995479,1995521..1995726, FT 1995778..1996014) FT /colour=7 FT /gene="SPAC3H1.13" FT /label=SPAC3H1.13 FT /note="SPAC3H1.13, len:344, SIMILARITY:Arabidopsis FT thaliana, O04265, serine/threonine protein kinase., (347 FT aa), fasta scores: opt: 416, E():4.4e-20, (30.1% identity FT in 352 aa)" FT /product="putative serine/threonine protein kinase" FT /fasta_file="fasta/c3H1.tab.seq.01413.out" FT misc_feature join(1994942..1994970,1995010..1995479,1995521..1995726, FT 1995778..1995987) FT /note="Match to PF00069, eukaryotic protein kinase" FT misc_feature 1994971..1994976 FT /colour=6 FT /note="gtagag, splice donor sequence" FT misc_feature 1994999..1995009 FT /colour=6 FT /note="ctaatttctag, splice branch and acceptor" FT misc_feature join(1995011..1995479,1995521..1995726) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 57.31" FT misc_feature 1995480..1995485 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 1995508..1995520 FT /colour=6 FT /note="ctaattgcatcag, splice branch and acceptor" FT misc_feature 1995727..1995732 FT /colour=6 FT /note="gttcgt, splice donor sequence" FT misc_feature 1995766..1995777 FT /colour=6 FT /note="ttaacatgctag, splice branch and acceptor" FT misc_feature 1995778..1995984 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 34.55" FT misc_feature 1996810..1997270 FT /note="nominal overlap with cosmid SPAC9G1, EM:Z98763 S. FT pombe chromosome 1" FT misc_feature 1996810..1997270 FT /note="nominal overlap with cosmid SPAC3H1, EM:Z68144 FT S.pombe chromosome 1" FT CDS 1998794..2002999 FT /colour=2 FT /gene="wis4" FT /gene="wak1" FT /gene="wik1" FT /gene="SPAC9G1.02" FT /label=wis4 FT /note="SPAC9G1.02, len:1401" FT /product="serine/threonine protein kinase; mitogen- FT activated protein kinase wis4; MAP kinase kinase kinase" FT /fasta_file="fasta/c9G1.tab.seq.00044.out" FT misc_feature 2001902..2002711 FT /colour=9 FT /note="Pfam match to entry PF00069 pkinase, Eukaryotic FT prot ein kinase domain" FT misc_feature 2002262..2002300 FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT CDS complement(join(2003342..2003432,2003492..2003730)) FT /colour=2 FT /gene="rpl30" FT /gene="rpl30-1" FT /gene="SPAC9G1.03c" FT /label=rpl30 FT /note="SPAC9G1.03c, len:109" FT /product="60S ribosomal protein L30/L30A" FT /fasta_file="fasta/c9G1.tab.seq.00045.out" FT misc_feature complement(2003366..2003428) FT /colour=8 FT /note="PS00993 Ribosomal protein L30e signature 2" FT misc_feature complement(2003433..2003448) FT /colour=6 FT /note="ctaactgagttattag, splice branch and acceptor" FT intron complement(2003433..2003491) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(2003486..2003491) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(2003581..2003655) FT /colour=8 FT /note="PS00709 Ribosomal protein L30e signature 1" FT promoter complement(2003800..2003807) FT /colour=4 FT /note="Homol D box" FT promoter complement(2003814..2003823) FT /colour=4 FT /note="Homol E box" FT CDS join(2004961..2004989,2005055..2005805,2005882..2006226) FT /colour=2 FT /gene="cox18" FT /gene="oxa1sp1" FT /gene="SPAC9G1.04" FT /label=cox18 FT /note="SPAC9G1.04, len:374" FT /product="respiratory complex biogenesis protein; FT cytochrome c oxidase assembly protein" FT /fasta_file="fasta/c9G1.tab.seq.00046.out" FT misc_feature 2004990..2004995 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT intron 2004990..2005054 FT /note="confirmed intron" FT misc_feature 2005042..2005054 FT /colour=6 FT /note="ttgaccaatttag, splice branch and acceptor" FT misc_feature 2005806..2005811 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT intron 2005806..2005881 FT /note="confirmed intron" FT misc_feature 2005863..2005881 FT /colour=6 FT /note="ctaaccaaagatcaaatag, splice branch and acceptor" FT CDS join(2006578..2006682,2006744..2006867,2006938..2007039, FT 2007080..2007125,2007232..2007277,2007327..2008268, FT 2008315..2008737) FT /colour=7 FT /gene="SPAC9G1.05" FT /label=SPAC9G1.05 FT /note="SPAC9G1.05, len:595, SIMILARITY:Physarum FT polycephalum, WD66_PHYPO, 66 kD stress protein, (601 aa), FT fasta scores: opt: 1444, E():0, (35.9% identity in 601 aa)" FT /product="WD repeat protein; putative stress response" FT /fasta_file="fasta/c9G1.tab.seq.00047.out" FT misc_feature 2006683..2006688 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2006729..2006743 FT /colour=6 FT /note="ctaaatagtttttag, splice branch and acceptor" FT misc_feature 2006868..2006873 FT /colour=6 FT /note="gtacga, splice donor sequence" FT misc_feature 2006921..2006937 FT /colour=6 FT /note="ctaatgatcaactatag, splice branch and acceptor" FT misc_feature 2007040..2007045 FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature 2007065..2007079 FT /colour=6 FT /note="ctaattgatgaaaag, splice branch and acceptor" FT misc_feature 2007126..2007131 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2007213..2007231 FT /colour=6 FT /note="ctaatcttacttttaacag, splice branch and acceptor" FT misc_feature 2007278..2007283 FT /colour=6 FT /note="gtaagg, splice donor sequence" FT misc_feature 2007314..2007326 FT /colour=6 FT /note="ttaacggttacag, splice branch and acceptor" FT misc_feature 2007450..2007554 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 31.12" FT misc_feature 2007564..2007680 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 39.85" FT misc_feature 2007831..2007932 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 23.20" FT misc_feature 2008269..2008274 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 2008284..2008314 FT /colour=6 FT /note="ttaatttccataattattgacttttttag, splice branch and FT acc eptor" FT misc_feature 2008510..2008599 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 25.52" FT CDS complement(join(2009040..2011633,2011717..2011783)) FT /colour=7 FT /gene="SPAC9G1.06c" FT /label=SPAC9G1.06c FT /note="SPAC9G1.06c, len:886, SIMILARITY:Saccharomyces FT cerevisiae, Q07533, chromosome iv reading frame orf FT ydl117w., (885 aa), fasta scores: opt: 580, E():1.8e-25, FT (25.5% identity in 919 aa)" FT /product="SH3 domain protein; possibly involved in FT cytokinesis; similar to S. cerevisiae CYK3" FT /fasta_file="fasta/c9G1.tab.seq.00048.out" FT misc_feature complement(join(2011515..2011633,2011717..2011756)) FT /note="Match to PF00018 SH3, Src homology domain 3 Score FT 46.51" FT misc_feature complement(2011634..2011648) FT /colour=6 FT /note="ttaatgtgttttcag, splice branch and acceptor" FT misc_feature complement(2011711..2011716) FT /colour=6 FT /note="gttcgt, splice donor sequence" FT CDS 2012858..2014114 FT /colour=8 FT /gene="SPAC9G1.07" FT /label=SPAC9G1.07 FT /note="SPAC9G1.07, len:418" FT /product="hypothetical protein; sequence orphan; serine- FT rich protein" FT /fasta_file="fasta/c9G1.tab.seq.00049.out" FT CDS complement(2014244..2014969) FT /colour=7 FT /gene="SPAC9G1.08c" FT /label=SPAC9G1.08c FT /note="SPAC9G1.08c, len:241, LOW SIMILARITY:Homo sapiens, FT O95372, acyl-protein thioesterase., (231 aa), fasta FT scores: opt: 216, E():1.2e-07, (29.3% identity in 147 aa)" FT /product="putative lysophospholipase; acyl protein FT thioesterase; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c9G1.tab.seq.00050.out" FT CDS join(2015433..2015549,2015606..2016904) FT /colour=2 FT /gene="sid1" FT /gene="SPAC9G1.09" FT /label=sid1 FT /note="SPAC9G1.09, len:471, SIMILARITY:Dictyostelium FT discoideum, O61122, severin kinase., (478 aa), fasta FT scores: opt: 1044, E():0, (40.3% identity in 476 aa)" FT /product="serine/threonine protein kinase; involved in the FT regulation of septation" FT /fasta_file="fasta/c9G1.tab.seq.00051.out" FT misc_feature 2015475..2015546 FT /colour=8 FT /note="PS00107 protein kinases ATP-binding region FT signature" FT misc_feature 2015550..2015555 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 2015593..2015605 FT /colour=6 FT /note="cttacagttgcag, splice branch and acceptor" FT misc_feature 2015660..2016268 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 249.83" FT CDS complement(join(2017039..2017147,2017185..2020651)) FT /colour=7 FT /gene="SPAC9G1.10c" FT /label=SPAC9G1.10c FT /note="SPAC9G1.10c, len:1191, NOTE: C-term may not be FT spliced, SIMILARITY:Arabidopsis thaliana, AAD21781, FT f28c11.1., (417 aa), fasta scores: opt: 515, E():2e-19, FT (32.3% identity in 350 aa)" FT /product="putative Inositol polyphosphate phosphatase" FT /fasta_file="fasta/c9G1.tab.seq.00052.out" FT misc_feature complement(2017148..2017159) FT /colour=6 FT /note="ctaaccaaccag, splice branch and acceptor" FT misc_feature complement(2017179..2017184) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(2017265..2018293) FT /colour=9 FT /note="Pfam match to entry PF00783 IPPc, Inositol FT polyphosp hate phosphatase, catalytic domain homologs" FT CDS complement(2021463..2022605) FT /colour=2 FT /gene="spn4" FT /gene="SPAC9G1.11c" FT /label=spn4 FT /note="SPAC9G1.11c, len:380" FT /product="septin; similar to S. cerevisiae CDC12" FT /fasta_file="fasta/c9G1.tab.seq.00053.out" FT misc_feature complement(2021691..2022533) FT /colour=9 FT /note="Pfam match to entry PF00735 GTP_CDC, cell division FT protein" FT misc_feature complement(2022480..2022503) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS 2023606..2024700 FT /colour=2 FT /gene="SPAC9G1.12" FT /gene="cpd1" FT /label=cpd1 FT /note="SPAC9G1.12, len:364, SIMILARITY:Caenorhabditis FT elegans., O62365, w02a11.1 protein., (312 aa), fasta FT scores: opt: 647, E():0, (37.1% identity in 272 aa)" FT /product="putative m1A-tRNA methyltransferase; homologous FT to a S.cerevisiae protein Gcd14 possibly involved in tRNA FT modification; non-essential in S. pombe" FT /fasta_file="fasta/c9G1.tab.seq.00054.out" FT CDS complement(join(2024884..2025824,2026001..2026089, FT 2026154..2026359)) FT /colour=7 FT /gene="SPAC9G1.13c" FT /label=SPAC9G1.13c FT /note="SPAC9G1.13c, len:411, SIMILARITY:Saccharomyces FT cerevisiae, YG12_YEAST, hypothetical 55.2 kD protein in FT erp6-tfg2 intergenic region., (476 aa), fasta scores: opt: FT 319, E():1.4e-12, (31.4% identity in 484 aa)" FT /product=" similar to Drosophila melanogaster FT transcription initiation factor TFIID" FT /fasta_file="fasta/c9G1.tab.seq.00055.out" FT misc_feature complement(2025825..2025838) FT /colour=6 FT /note="ctaatttgttgtag, splice branch and acceptor" FT misc_feature complement(2025995..2026000) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(2026090..2026100) FT /colour=6 FT /note="ctaatttgtag, splice branch and acceptor" FT misc_feature complement(2026148..2026153) FT /colour=6 FT /note="gtgagt, splice donor sequence" FT misc_feature 2027383..2027794 FT /note="nominal overlap with cosmid SPAC767, EM:AL133442 S. FT pombe chromosome 1" FT misc_feature complement(2027393..2027794) FT /colour=9 FT /note="Pfam match to entry PF01031 dynamin_2, Dynamin FT central region, score -76.70, E-value 5.7e-06" FT misc_feature 2027383..2027794 FT /note="nominal overlap with cosmid SPAC9G1, EM:Z98763 S. FT pombe chromosome 1" FT misc_feature complement(2027393..2028271) FT /note="Match to PF01031 dynamin_2, Dynamin central region FT Score 414.87" FT misc_feature complement(2028272..2028862) FT /note="Match to PF00350 dynamin, Dynamin family Score FT 347.16" FT misc_feature complement(2028782..2028811) FT /colour=8 FT /note="PS00410 Dynamin family signature" FT misc_feature complement(2028875..2028889) FT /colour=6 FT /note="ctaataaattgttag, splice branch and acceptor" FT misc_feature complement(2028920..2028925) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(2028923..2029009) FT /note="Match to PF00350 dynamin, Dynamin family Score FT 26.56" FT misc_feature 2029387..2029907 FT /note="nominal overlap with cosmid SPAC17H9, EM:Z98597 S. FT pombe chromosome 1" FT LTR 2029314..2029640 FT /note="Tf1-type LTR" FT misc_feature 2029387..2029907 FT /note="nominal overlap with cosmid SPAC767, S. pombe FT chromosome 1" FT CDS 2030661..2034269 FT /colour=2 FT /function="non-essential" FT /gene="cid16" FT /gene="SPAC17H9.01" FT /label=cid16 FT /note="SPAC17H9.01, len:1202, SIMILARITY:in the c-terminal FT region to Schizosaccharomyces pombe, AAD16889, caffeine- FT induced death protein 1., (405 aa), fasta scores: opt: 358, FT E():1.1e-15, (28.3% identity in 325 aa)" FT /product="putative nucleotidyl transferase; cid1-related" FT /fasta_file="fasta/c17H9.tab.seq.01495.out" FT CDS 2034514..2037606 FT /colour=7 FT /gene="SPAC17H9.02" FT /label=SPAC17H9.02 FT /note="SPAC17H9.02, len:1030, SIMILARITY:Homo sapiens, FT Y052_HUMAN, hypothetical proteinkiaa0052, (1045 aa), fasta FT scores: opt: 3117, E():0, (49.9% identity in 942 aa)" FT /product="DEAD/DEAH box helicase; possibly required for FT mRNA export from nucleus, similar to S. cerevisiae MTR4" FT /fasta_file="fasta/c17H9.tab.seq.01496.out" FT misc_feature 2034880..2035362 FT /note="Match to PF00270 DEAD, DEAD/DEAH box helicase Score FT 122.76" FT misc_feature 2034952..2034975 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 2035780..2036049 FT /colour=9 FT /note="Pfam match to entry PF00271 helicase_C, Helicases FT conserved C-terminal domain," FT CDS complement(2037825..2038517) FT /colour=8 FT /gene="SPAC17H9.03c" FT /label=SPAC17H9.03c FT /note="SPAC17H9.03c, len:230, SIMILARITY: low to a region FT of Mus musculus, O55230, rad51-like 3, (329 aa), fasta FT scores: opt: 151, E():0.0019, (29.7% identity in 118 aa)" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c17H9.tab.seq.01497.out" FT CDS complement(2039581..2041395) FT /colour=7 FT /gene="SPAC17H9.04c" FT /label=SPAC17H9.04c FT /note="SPAC17H9.04c, len:604, SIMILARITY:Saccharomyces FT cerevisiae, ARP_YEAST, arp protein., (719 aa), fasta FT scores: opt: 383, E():1.2e-16, (30.1% identity in 625 aa)" FT /product="RNA-binding / Ran zinc finger protein" FT /fasta_file="fasta/c17H9.tab.seq.01498.out" FT misc_feature complement(2039632..2039712) FT /note="Match to PF00641 zf-RanBP, Zn-finger in Ran binding FT protein and others. Score 26.74" FT misc_feature complement(2039974..2040063) FT /note="Match to PF00641 zf-RanBP, Zn-finger in Ran binding FT protein and others. Score 41.09" FT misc_feature complement(2040283..2040369) FT /note="Match to PF00641 zf-RanBP, Zn-finger in Ran binding FT protein and others. Score 43.98" FT misc_feature complement(2040445..2040660) FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 46.54" FT LTR 2041682..2042022 FT /colour=4 FT /note="Tf2 type" FT CDS 2042608..2043609 FT /colour=7 FT /gene="SPAC17H9.05" FT /label=SPAC17H9.05 FT /note="SPAC17H9.05, len:333, SIMILARITY:Saccharomyces FT cerevisiae, YKR2_YEAST, hypothetical 49.7 kD protein in FT gin2-ste3 intergenic region., (427 aa), fasta scores: opt: FT 626, E():5.8e-27, (40.0% identity in 315 aa) also some FT similar to Human, Q99848, nucleolar protein P40, (306aa), FT fasta scores: opt: 432, E():1.2e-16, (33.8% identity in FT 311 aa)" FT /product="nucleolar protein P40-like; possibly involved in FT pre-rRNA processing and ribosomal subunit assembly; FT similar to S. cerevisiae EBP2" FT /fasta_file="fasta/c17H9.tab.seq.01499.out" FT CDS complement(join(2043882..2043962,2044003..2044227, FT 2044275..2044771,2044812..2045814)) FT /colour=8 FT /gene="SPAC17H9.06c" FT /label=SPAC17H9.06c FT /note="SPAC17H9.06c, len:601," FT /product="hypothetical protein; serine-rich protein; FT nuclear; sequence orphan" FT /fasta_file="fasta/c17H9.tab.seq.01500.out" FT misc_feature complement(2043963..2043974) FT /colour=6 FT /note="ctaactgcttag, splice branch and acceptor" FT misc_feature complement(2043997..2044002) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(2044228..2044241) FT /colour=6 FT /note="ctaactttctaaag, splice branch and acceptor" FT misc_feature complement(2044269..2044274) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(2044772..2044787) FT /colour=6 FT /note="ttaacgaataattaag, splice branch and acceptor" FT misc_feature complement(2044806..2044811) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS join(2046061..2046132,2046185..2046374,2046517..2046617) FT /colour=7 FT /gene="SPAC17H9.07" FT /label=SPAC17H9.07 FT /note="SPAC17H9.07, len:120," FT /note="SPAC17H9.07, len:120, SIMILARITY:Zea mays, O04438, FT signal recognition particle subunit 9., (103 aa), fasta FT scores: opt: 118, E():0.22, (26.1% identity in 115 aa)" FT /product="putative signal recognition particle subunit; FT similar to S. cerevisiae SRP21" FT /fasta_file="fasta/c17H9.tab.seq.00059.out" FT misc_feature 2046133..2046138 FT /colour=6 FT /note="gtatgg, splice donor sequence" FT misc_feature 2046167..2046184 FT /colour=6 FT /note="ctgacttttttcatttag, splice branch and acceptor" FT misc_feature 2046375..2046380 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2046496..2046516 FT /colour=6 FT /note="ctaacagtcatgttatatag, splice branch and acceptor" FT CDS 2048045..2049025 FT /colour=7 FT /gene="SPAC17H9.08" FT /label=SPAC17H9.08 FT /note="SPAC17H9.08, len:326, SIMILARITY:Saccharomyces FT cerevisiae, YHG2_YEAST, putative mitochondrial carrier FT yhr002w., (357 aa), fasta scores: opt: 671, E():0, (46.0% FT identity in 335 aa), also similar eg.to GDC _RAT, P16261, FT grave's disease carrier protein, (322aa), fasta scores, FT opt:489, E():1.2e-25, (32.5% identity in 308 aa overlap)" FT /product="MC transporter of unknown specificity" FT /fasta_file="fasta/c17H9.tab.seq.01502.out" FT misc_feature 2048090..2049013 FT /note="Match to PF00153 mito_carr, Mitochondrial carrier FT proteins Score 248.58" FT misc_feature 2048153..2048179 FT /colour=8 FT /note="PS00215 Mitochondrial energy transfer proteins FT signature" FT misc_feature 2048450..2048476 FT /colour=8 FT /note="PS00215 Mitochondrial energy transfer proteins FT signature" FT misc_feature complement(2049341..2050562) FT /note="Primary transcript determined from EM_FUN:SPRAS X03 FT RAS gene." FT CDS complement(join(2049434..2050087,2050159..2050164)) FT /colour=2 FT /gene="ste5" FT /gene="ras1" FT /gene="SPAC17H9.09c" FT /label=ras1 FT /note="SPAC17H9.09c, len:219 ras1" FT /product="ras-like protein; involved in pheromone FT response; involved in cell morphogenesis" FT /fasta_file="fasta/c17H9.tab.seq.01503.out" FT misc_feature complement(2049437..2050066) FT /note="Match to PF00071 ras, Ras family Score 358.25" FT misc_feature complement(2050028..2050051) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature complement(2050088..2050110) FT /colour=6 FT /note="ctaatcaacgataatatttatag, splice branch and acceptor" FT CDS complement(2050900..2054118) FT /colour=7 FT /gene="SPAC17H9.10c" FT /label=SPAC17H9.10c FT /note="SPAC17H9.10c, len:1072, FT SIMILARITY:Schizosaccharomyces pombe, AAD24488, silencing FT protein rik1., (916 aa), fasta scores: opt: 513, E():7.5e- FT 26, (20.9% identity in 961 aa)" FT /product="putative UV damage binding factor; XP-E FT ortholog; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c17H9.tab.seq.01504.out" FT conflict 2054677..2054702 FT /note="were 27 Ts in c607" FT CDS 2055011..2055436 FT /colour=7 FT /gene="SPAC17H9.11" FT /label=SPAC17H9.11 FT /note="SPAC17H9.11, len:141, SIMILARITY:Homo sapiens, FT GLMB_HUMAN, glia maturation factor beta, (141 aa), fasta FT scores: opt: 272, E():1.8e-12, (35.6% identity in 135 aa)" FT /product="cofilin/tropomyosin-type; actin binding protein" FT /fasta_file="fasta/c17H9.tab.seq.01505.out" FT misc_feature 2055083..2055424 FT /note="Match to PF00241 cofilin_ADF, Cofilin/tropomyosin- FT type actin-binding proteins Score 20.17" FT CDS complement(2055839..2056639) FT /EC_number="1.6.2.2" FT /colour=7 FT /gene="SPAC17H9.12c" FT /label=SPAC17H9.12c FT /note="SPAC17H9.12c, len:266, SIMILARITY:Saccharomyces FT cerevisiae, MCR1_YEAST, nadh-cytochrome b5 reductase , FT (302 aa), fasta scores: opt: 234, E():2.2e-08, (27.4% FT identity in 296 aa)" FT /product="putative nadh-cytochrome reductase" FT /fasta_file="fasta/c17H9.tab.seq.01506.out" FT CDS complement(join(2057020..2057874,2057951..2058249, FT 2058374..2058428)) FT /EC_number="2.7.2.11" FT /colour=7 FT /gene="SPAC17H9.13c" FT /label=SPAC17H9.13c FT /note="SPAC17H9.13c, len:402, SIMILARITY:Saccharomyces FT cerevisiae, PROB_YEAST, glutamate 5-kinase, (428 aa), FT fasta scores: opt: 1043, E():0, (52.4% identity in 422 aa)" FT /product="putative glutamate 5-kinase; similar to S. FT cerevisiae PRO1" FT /fasta_file="fasta/c17H9.tab.seq.01507.out" FT misc_feature complement(join(2057599..2057874,2057951..2058244)) FT /note="Match to PF00696 aakinase, Aspartate kinases, FT Glutamate kinases and Gamma glutamate phospho-reductases FT Score 92.12" FT misc_feature complement(2057875..2057892) FT /colour=6 FT /note="ctaactattaatatttag, splice branch and acceptor" FT misc_feature complement(2057945..2057950) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature complement(2058250..2058264) FT /colour=6 FT /note="ctaacattattttag, splice branch and acceptor" FT misc_feature complement(2058368..2058373) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT CDS complement(2058905..2059984) FT /EC_number="5.3.4.1" FT /colour=7 FT /gene="SPAC17H9.14c" FT /label=SPAC17H9.14c FT /note="SPAC17H9.14c, len:359, SIMILARITY:Medicago sativa, FT ERP5_MEDSA, putative protein disulfide isomerase p5 , (364 FT aa), fasta scores: opt: 931, E():0, (42.9% identity in 357 FT aa)" FT /product="putative protein disulfide isomerase (EC FT 5.3.4.1)" FT /fasta_file="fasta/c17H9.tab.seq.01508.out" FT misc_feature complement(2059235..2059567) FT /note="Match to PF00085 thiored, Thioredoxin Score 132.98" FT misc_feature complement(2059445..2059501) FT /colour=8 FT /note="PS00194 Thioredoxin family active site" FT misc_feature complement(2059595..2059927) FT /note="Match to PF00085 thiored, Thioredoxin Score 120.31" FT misc_feature complement(2059802..2059858) FT /colour=8 FT /note="PS00194 Thioredoxin family active site" FT CDS join(2060889..2061281,2061343..2061384) FT /colour=7 FT /gene="SPAC17H9.16" FT /label=SPAC17H9.16 FT /note="SPAC17H9.16, len:144, SIMILARITY:Saccharomyces FT cerevisiae, OM22_YEAST, mitochondrial import receptor FT subunit tom22, (151 aa), fasta scores: opt: 253, E():3e-10, FT (35.0% identity in 140 aa)" FT /product="putative mitochondrial import receptor subunit" FT /fasta_file="fasta/c17H9.tab.seq.01509.out" FT misc_feature 2061282..2061287 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2061323..2061342 FT /colour=6 FT /note="ctattctcaccatgttttag, splice branch and acceptor" FT CDS complement(join(2061685..2062305,2062364..2062758, FT 2062808..2062904)) FT /colour=7 FT /gene="SPAC17H9.17c" FT /label=SPAC17H9.17c FT /note="SPAC17H9.17c, len:370, SIMILARITY:Saccharomyces FT cerevisiae, MD10_YEAST, mitochondrial inheritance FT component mdm10., (493 aa), fasta scores: opt: 395, FT E():1.7e-19, (31.1% identity in 334 aa)" FT /product="putative mitochondrial inheritance component" FT /fasta_file="fasta/c17H9.tab.seq.01510.out" FT misc_feature complement(2062306..2062316) FT /colour=6 FT /note="cttacgctcag, splice branch and acceptor" FT misc_feature complement(2062358..2062363) FT /colour=6 FT /note="gtacgc, splice donor sequence" FT misc_feature complement(2062759..2062772) FT /colour=6 FT /note="cttacaaacaacag, splice branch and acceptor" FT misc_feature complement(2062802..2062807) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS complement(2063314..2063631) FT /colour=8 FT /gene="SPAC17H9.18c" FT /label=SPAC17H9.18c FT /note="SPAC17H9.18c, len:105" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c17H9.tab.seq.01511.out" FT CDS complement(2063854..2065326) FT /colour=2 FT /gene="cdt2" FT /gene="SPAC17H9.19c" FT /label=cdt2 FT /note="SPAC17H9.19c, len:490," FT /product="target of Cdc10 transcription factor coupling FT START with cytokinesis; WD repeat protein; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c17H9.tab.seq.01512.out" FT misc_feature complement(2063935..2064024) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 37.86" FT misc_feature complement(2064373..2064417) FT /colour=8 FT /note="PS00678 Beta-transducin family Trp-Asp repeats FT signa ture" FT misc_feature complement(2064553..2064597) FT /colour=8 FT /note="PS00678 Beta-transducin family Trp-Asp repeats FT signa ture" FT misc_feature 2066344..2066349 FT /colour=6 FT /note="gtaatg, splice donor sequence" FT misc_feature 2066375..2066388 FT /colour=6 FT /note="ctaacactgaaaag, splice branch and acceptor" FT misc_feature 2066502..2066507 FT /colour=6 FT /note="gtagag, splice donor sequence" FT misc_feature 2066527..2066539 FT /colour=6 FT /note="ctaaatattttag, splice branch and acceptor" FT misc_feature 2067094..2067099 FT /colour=6 FT /note="gtaaag, splice donor sequence" FT misc_feature 2067128..2067143 FT /colour=6 FT /note="ctaacctttatattag, splice branch and acceptor" FT misc_feature 2067669..2067901 FT /note="nominal overlap with cosmid SPAC607 S. pombe FT chromosome 1" FT misc_feature 2067669..2067901 FT /note="nominal overlap with cosmid SPAC17H9 S. pombe FT chromosome 1" FT misc_feature 2068744..2068749 FT /colour=6 FT /note="gtatac, splice donor sequence" FT misc_feature 2068779..2068791 FT /colour=6 FT /note="ctaacttgaccag, splice branch and acceptor" FT CDS complement(join(2069291..2069561,2069608..2069976, FT 2070025..2070080)) FT /colour=8 FT /gene="SPAC607.02c" FT /label=SPAC607.02c FT /note="SPAC607.02c, len:231, SIMILARITY, some FT to:Caenorhabditis elegans., P91570, cosmid zk354., (312 FT aa), fasta scores: opt: 179, E():0.0014, (29.6% identity FT in 159 aa)" FT /product="hypothetical lysine-rich protein; sequence FT orphan" FT /fasta_file="fasta/c607.tab.seq.00211.out" FT misc_feature complement(2069562..2069573) FT /colour=6 FT /note="ctaacatattag, splice branch and acceptor" FT misc_feature complement(2069602..2069607) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(2069977..2069994) FT /colour=6 FT /note="ctaacatttggttaatag, splice branch and acceptor" FT intron complement(2069977..2070024) FT /note="intron confirmed by EST" FT misc_feature complement(2070019..2070024) FT /colour=6 FT /note="gtaaaa, splice donor sequence" FT CDS complement(join(2070612..2070971,2071122..2071139)) FT /colour=2 FT /gene="snu13" FT /gene="SPAC607.03c" FT /label=snu13 FT /note="SPAC607.03c, len:125" FT /product="putative pre-mRNA splicing factor; U4/U6.U5 FT snRNP component; similar to S. cerevisiae SNU13" FT /fasta_file="fasta/c607.tab.seq.00212.out" FT misc_feature complement(2070663..2070947) FT /note="Match to PF01248 Ribosomal_L7Ae, Ribosomal protein FT L7Ae Score 182.41" FT misc_feature complement(2070972..2070984) FT /colour=6 FT /note="ctaacattgttag, splice branch and acceptor" FT misc_feature complement(2071116..2071121) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS 2072166..2072972 FT /colour=7 FT /gene="SPAC607.04" FT /label=SPAC607.04 FT /note="SPAC607.04, len:268, SIMILARITY:Saccharomyces FT cerevisia., ARG3_YEAST, arginine metabolism regulation FT protein III., (355 aa), fasta scores: opt: 216, E():1.3e- FT 07, (30.6% identity in 258 aa overlap)" FT /product="putative arginine metabolism transcriptional FT control protein" FT /fasta_file="fasta/c607.tab.seq.00213.out" FT CDS join(2073518..2073630,2073685..2074717) FT /colour=2 FT /gene="rpn9" FT /gene="SPAC607.05" FT /label=rpn9 FT /note="SPAC607.05, len:381, SIMILARITY:Homo sapiens, FT AAD43442, 26s proteasome subunit p40.5., (376 aa), fasta FT scores: opt: 728, E():0, (34.9% identity in 372 aa)" FT /product="19S proteasome regulatory subunit" FT /fasta_file="fasta/c607.tab.seq.00214.out" FT misc_feature 2073631..2073636 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2073675..2073684 FT /colour=6 FT /note="ctgacgccag, splice branch and acceptor" FT misc_feature 2074265..2074294 FT /colour=8 FT /note="PS00142 Neutral zinc metallopeptidases, zinc FT binding region signature" FT misc_feature 2074394..2074624 FT /note="Match to PF01399 PCI, PCI domain Score 24.92" FT CDS complement(join(2074886..2074921,2074960..2076711, FT 2076770..2076820)) FT /colour=7 FT /gene="SPAC607.06c" FT /label=SPAC607.06c FT /note="SPAC607.06c, len:612, SIMILARITY:Saccharomyces FT cerevisiae, YIK8_YEAST, hypothetical zinc FT metalloproteinase yil108w, (696 aa), fasta scores: opt: FT 646, E():0, (33.9% identity in 691 aa)" FT /product=" motif characteristic of zinc metallopeptidase FT zinc binding proteins by similar to yeast YIL108W" FT /fasta_file="fasta/c607.tab.seq.00215.out" FT misc_feature complement(2074922..2074934) FT /colour=6 FT /note="ctaacattaatag, splice branch and acceptor" FT intron complement(2074922..2074959) FT /note="Intron predicted by EST" FT misc_feature complement(2074954..2074959) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(2076712..2076721) FT /colour=6 FT /note="ctaattttag, splice branch and acceptor" FT misc_feature complement(2076764..2076769) FT /colour=6 FT /note="gtacga, splice donor sequence" FT CDS complement(2077375..2077806) FT /colour=8 FT /gene="SPAC607.07c" FT /label=SPAC607.07c FT /note="SPAC607.07c, len:143" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c607.tab.seq.00216.out" FT CDS complement(2078097..2079836) FT /colour=10 FT /gene="SPAC607.08c" FT /label=SPAC607.08c FT /note="SPAC607.08c, len:579, FT SIMILARITY:Schizosaccharomyces pombe, O14244, hypothetical FT 86.1 kD protein c6f6.13c in chromosome i., (778 aa), fasta FT scores: opt: 765, E():0, (34.5% identity in 472 aa)" FT /product="conserved protein; similar to S. cerevisiae FT YFL034W" FT /fasta_file="fasta/c607.tab.seq.00217.out" FT misc_feature complement(2078886..2078909) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS complement(2080138..2081328) FT /colour=7 FT /gene="SPAC607.09c" FT /label=SPAC607.09c FT /note="SPAC607.09c, len:396, SIMILARITY:Canis familiaris, FT CLN3_CANFA, cln3 protein.cln3 protein, (438 aa), fasta FT scores: opt: 578, E():6.1e-30, (33.0% identity in 406 aa)" FT /product="putative integral membrane protein; battenin FT family; possibly involved in cellular pH homeostasis; FT possibly involved in vacuolar pH control; similar to S. FT cerevisiae YHC3; similar to cln3 the human involved in FT Batten's disease" FT /fasta_file="fasta/c607.tab.seq.00218.out" FT CDS 2083621..2086707 FT /colour=2 FT /gene="spo3" FT /gene="SPAC607.10" FT /label=spo3 FT /note="SPAC607.10, len:1028)" FT /product="required for assembly of the forespore membrane; FT localises to forespore membrane (GFP); predicted N- FT terminal signal sequence; expressed only during FT sporulation; null viable; required for sporulation; no FT apparent orthologs" FT /fasta_file="fasta/c607.tab.seq.00219.out" FT misc_feature 2086857..2087227 FT /note="nominal overlap with cosmid SPAC732 S. pombe FT chromosome 1" FT CDS join(2087284..2087300,2087340..2087371,2087404..2087513, FT 2087569..2087604,2087650..2087720,2088013..2088235) FT /colour=7 FT /gene="vma11" FT /gene="SPAC732.01" FT /label=SPAC732.01 FT /note="SPAC732.01, len:162, SIMILARITY:Saccharomyces FT cerevisiae, VM11_YEAST, proteolipid protein vma11., (164 FT aa), fasta scores: opt: 680, E():0, (62.9% identity in 159 FT aa)" FT /product="putative vacuolar ATP synthase subunit; V-type FT ATPase subunit; vacuolar proton pump component; V0 sector; FT proteolipid subunit" FT /fasta_file="fasta/c732.tab.seq.00134.out" FT misc_feature 2087301..2087306 FT /colour=6 FT /note="gtaaag, splice donor sequence" FT misc_feature 2087320..2087517 FT /colour=9 FT /note="Pfam match to entry PF00137 ATP-synt_C, ATP FT synthase subunit C, score 43.50, E-value 4.9e-09" FT misc_feature 2087327..2087339 FT /colour=6 FT /note="ctaacgaactaag, splice branch and acceptor" FT misc_feature 2087372..2087377 FT /colour=6 FT /note="gtatgg, splice donor sequence" FT misc_feature 2087393..2087403 FT /colour=6 FT /note="ttaatagctag, splice branch and acceptor" FT misc_feature 2087514..2087519 FT /colour=6 FT /note="gtttgt, splice donor sequence" FT misc_feature 2087555..2087568 FT /colour=6 FT /note="ctaatattttgaag, splice branch and acceptor" FT misc_feature 2087605..2087610 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2087636..2087649 FT /colour=6 FT /note="ctgacgataaatag, splice branch and acceptor" FT misc_feature 2087721..2087726 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2088001..2088012 FT /colour=6 FT /note="ttaaccaagtag, splice branch and acceptor" FT misc_feature 2088023..2088205 FT /note="Match to PF00137 ATP-synt_C, ATP synthase subunit C FT Score 76.90" FT CDS complement(2088927..2090153) FT /EC_number="3.1.3.46" FT /colour=7 FT /gene="SPAC732.02c" FT /label=SPAC732.02c FT /note="SPAC732.02c, len:408, SIMILARITY:Saccharomyces FT cerevisiae, F26_YEAST, fructose-2,6-bisphosphatase, (452 FT aa), fasta scores: opt: 1033, E():0, (44.2% identity in FT 412 aa)" FT /product="putative fructose-2,6-bisphosphatase; similar to FT S. cerevisiae FBP26" FT /fasta_file="fasta/c732.tab.seq.00135.out" FT misc_feature complement(2088993..2089526) FT /note="Match to PF00300 PGAM, Phosphoglycerate mutase FT family Score 184.46" FT misc_feature complement(2089494..2089523) FT /colour=8 FT /note="PS00175 Phosphoglycerate mutase family FT phosphohistidine signature" FT misc_feature complement(2089536..2090144) FT /colour=9 FT /note="Pfam match to entry PF01591 6PF2K, 6-phosphofructo- FT 2-kinase, score 67.10, E-value 3.8e-16" FT misc_feature complement(2090085..2090108) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature 2092200..2092455 FT /note="nominal overlap with cosmid SPAC3C7, EM:Z99568 S. FT pombe chromosome 1" FT misc_feature 2092200..2092455 FT /note="nominal overlap with cosmid SPAC732, S.pombe FT chromosome 1" FT CDS complement(2094529..2095680) FT /colour=10 FT /gene="SPAC3C7.02c" FT /label=SPAC3C7.02c FT /note="SPAC3C7.02c, len:383, FT SIMILARITY:Schizosaccharomyces pombe, O74960, hypothetical FT 39.8 kD protein., (351 aa), fa sta scores: opt: 1007, FT E():0, (45.5% identity in 347 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YPL004C" FT /fasta_file="fasta/c3C7.tab.seq.01213.out" FT CDS complement(join(2096344..2097380,2097425..2097440)) FT /colour=2 FT /gene="rhp55" FT /gene="SPAC3C7.03c" FT /label=rhp55 FT /note="SPAC3C7.03c, len:350" FT /product="recombinational DNA repair protein; similar to FT S. cerevisiae RAD55" FT /fasta_file="fasta/c3C7.tab.seq.01214.out" FT misc_feature complement(2097381..2097394) FT /colour=6 FT /note="ctaatactttttag, splice branch and acceptor" FT misc_feature complement(2097419..2097424) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT CDS 2098440..2100791 FT /colour=7 FT /gene="SPAC3C7.04" FT /label=SPAC3C7.04 FT /note="SPAC3C7.04, len:783, SIMILARITY:Schizosaccharomyces FT pombe, THI1_SCHPO, thiamine repressible genes regulatory FT pr otein thi1, (775 aa), fasta scores: opt: 1077, E():0, FT (31.7 % identity in 782 aa)" FT /product="putative transcriptional regulator; zinc finger FT protein; fungal Zn(2)-Cys(6) binuclear cluster domain; FT putative metabolic control" FT /fasta_file="fasta/c3C7.tab.seq.01215.out" FT misc_feature 2098554..2098661 FT /note="Match to PF00172 Zn_clus, fungal Zn(2)-Cys(6) FT binuclear cluster domain Score 54.10" FT CDS complement(2101580..2102908) FT /colour=10 FT /gene="SPAC3C7.05c" FT /label=SPAC3C7.05c FT /note="SPAC3C7.05c, len:442, FT SIMILARITY:Schizosaccharomyces pombe, O74556, hypothetical FT 49.1 kD protein., (442 aa), fa sta scores: opt: 136, FT E():0.081, (20.6% identity in 233 aa)" FT /product="hypothetical protein; Pfam-B_11461 domain; FT similar to S. cerevisiae YKL046C and DFG5" FT /fasta_file="fasta/c3C7.tab.seq.00033.out" FT CDS complement(2103970..2105922) FT /colour=2 FT /gene="pit1" FT /gene="SPAC3C7.06c" FT /label=pit1 FT /note="SPAC3C7.06c, len:650, FT SIMILARITY:Schizosaccharomyces pombe, O43077, FT serine/threonine protein kinase., (559 aa), fasta scores: FT opt: 871, E():0, (34.6% identity in 488 aa)" FT /product="serine/threonine protein kinase; plays a role in FT sporulation; putative MAK; similar to S. cerevisiae IME2" FT /fasta_file="fasta/c3C7.tab.seq.01217.out" FT misc_feature complement(2104915..2105817) FT /colour=9 FT /fasta_file="c3C7.seq.0008.out" FT /note="Pfam match to entry PF00069 pkinase, Eukaryotic FT prot ein kinase domain" FT misc_feature complement(2104918..2105817) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 295.76" FT CDS complement(join(2106956..2107060,2107100..2107360, FT 2107402..2107472,2107519..2108042,2108097..2108162, FT 2108204..2108226,2108371..2108406)) FT /colour=7 FT /gene="SPAC3C7.07c" FT /label=SPAC3C7.07c FT /note="SPAC3C7.07c, len:361, SIMILARITY:Homo sapiens, FT G3806 094, arginine-tRNA-protein transferase 1-1p, (514 FT aa), fast a scores: opt: 525, E():1.8e-27, (46.5% identity FT in 202 aa)" FT /product="putative tRNA protein transferase" FT /fasta_file="fasta/c3C7.tab.seq.01218.out" FT misc_feature complement(2107061..2107072) FT /colour=6 FT /note="ctaattcttcag, splice branch and acceptor" FT misc_feature complement(2107094..2107099) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(2107361..2107373) FT /colour=6 FT /note="ctaatacaaacag, splice branch and acceptor" FT misc_feature complement(2107396..2107401) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature complement(2108043..2108062) FT /colour=6 FT /note="ctaaccgccgaatgttgaag, splice branch and acceptor" FT misc_feature complement(2108091..2108096) FT /colour=6 FT /note="gtactt, splice donor sequence" FT misc_feature complement(2108163..2108177) FT /colour=6 FT /note="ctaatataaaataag, splice branch and acceptor" FT misc_feature complement(2108198..2108203) FT /colour=6 FT /note="gtaaaa, splice donor sequence" FT misc_feature complement(2108227..2108245) FT /colour=6 FT /note="ttaacctcaggactaccag, splice branch and acceptor" FT misc_feature complement(2108365..2108370) FT /colour=6 FT /note="gtcagt, splice donor sequence" FT CDS complement(2108950..2112123) FT /colour=7 FT /gene="SPAC3C7.08c" FT /label=SPAC3C7.08c FT /note="SPAC3C7.08c, len:1057, SIMILARITY:Saccharomyces FT cerevisiae, Q08972, chromosome xvi reading frame orf FT ypl226w, ( 1196 aa), fasta scores: opt: 2801, E():0, FT (46.8% identity i n 1088 aa)" FT /product=" non-transporter group of the ATP-binding FT cassette (ABC) family; similar to S. cerevisiae NEW1" FT /fasta_file="fasta/c3C7.tab.seq.01219.out" FT misc_feature complement(2109175..2109963) FT /note="Match to PF00005 ABC_tran, ABC transporter Score FT 131.70" FT misc_feature complement(2110222..2110716) FT /note="Match to PF00005 ABC_tran, ABC transporter Score FT 139.48" FT CDS 2113195..2114484 FT /colour=10 FT /gene="SPAC3C7.09" FT /label=SPAC3C7.09 FT /note="SPAC3C7.09, len:429, SIMILARITY:Schizosaccharomyces FT pombe, O74738, conserved protein, (547 aa), f asta scores: FT opt: 228, E():4.3e-08, (30.8% identity in 185 aa)" FT /product="conserved protein; Pfam-B_2703; putative FT methyltransferase" FT /fasta_file="fasta/c3C7.tab.seq.01220.out" FT CDS 2114924..2115790 FT /colour=7 FT /gene="SPAC3C7.10" FT /label=SPAC3C7.10 FT /note="SPAC3C7.10, len:288, SIMILARITY:Saccharomyces FT cerevisiae, PEXD_YEAST, peroxisomal membrane protein pas20, FT (386 aa), fasta scores: opt: 243, E():1.7e-08, (31.6% FT identity i n 231 aa)" FT /product="putative peroxisomal membrane protein; with SRC FT homology domain" FT /fasta_file="fasta/c3C7.tab.seq.01221.out" FT misc_feature 2115596..2115769 FT /note="Match to PF00018 SH3, SH3 domain Score 56.70" FT misc_feature 2115596..2115781 FT /colour=9 FT /fasta_file="c3C7.seq.0015.out" FT /note="Pfam match to entry PF00018 SH3, Src homology FT domain 3" FT CDS complement(2116291..2117973) FT /colour=2 FT /gene="cal1" FT /gene="cnx1" FT /gene="SPAC3C7.11c" FT /label=cal1 FT /note="SPAC3C7.11c, len:560" FT /product="calnexin homolog" FT /fasta_file="fasta/c3C7.tab.seq.01222.out" FT misc_feature complement(2116756..2117856) FT /note="Match to PF00262 calreticulin, Calreticulin family FT Score 893.69" FT misc_feature 2118980..2120954 FT /colour=3 FT /note="primary transcript for noc1; EM_FUN:SPU59915; FT U59915" FT CDS 2119463..2120848 FT /colour=2 FT /gene="noc1" FT /gene="tip1" FT /gene="SPAC3C7.12" FT /label=noc1 FT /note="SPAC3C7.12, len:461" FT /product="similar to eukaryotic intermediate filament FT proteins; involved in organization of cytoskeleton" FT /fasta_file="fasta/c3C7.tab.seq.01223.out" FT misc_feature 2119526..2119669 FT /note="Match to PF01302 CAP_GLY, CAP-Gly domain Score FT 34.46" FT CDS complement(2121197..2122618) FT /colour=7 FT /gene="SPAC3C7.13c" FT /label=SPAC3C7.13c FT /note="SPAC3C7.13c, len:473, SIMILARITY:Emericella FT nidulans , G6PD_EMENI, glucose-6-phosphate 1-dehydrogenase, FT (511 aa) , fasta scores: opt: 1217, E():0, (41.4% FT identity in 469 aa )" FT /product="glucose-6-phosphate 1-dehydrogenase" FT /fasta_file="fasta/c3C7.tab.seq.01224.out" FT misc_feature complement(2121242..2121397) FT /note="Match to PF00479 G6PD, Glucose-6-phosphate FT dehydrogenase Score 40.72" FT misc_feature complement(2121512..2122603) FT /note="Match to PF00479 G6PD, Glucose-6-phosphate FT dehydrogenase Score 424.95" FT misc_feature complement(2121512..2122606) FT /colour=9 FT /fasta_file="c3C7.seq.0022.out" FT /note="Pfam match to entry PF00479 G6PD, Glucose-6- FT phosphat e dehydrogenase" FT CDS complement(2123959..2124567) FT /colour=2 FT /gene="obr1" FT /gene="SPAC3C7.14c" FT /label=obr1 FT /note="SPAC3C7.14c, len:202" FT /product="brefeldin A resistance protein" FT /fasta_file="fasta/c3C7.tab.seq.01225.out" FT misc_feature 2127250..2127251 FT /note="nominal overlap with c25A8 EM:AL021809" FT misc_feature 2127250..2127251 FT /note="nominal overlap with cosmid SPAC3C7, EM:Z99568 S. FT pombe chromosome 1" FT CDS complement(2127957..2130725) FT /colour=7 FT /gene="SPAC25A8.01c" FT /label=SPAC25A8.01c FT /note="SPAC25A8.01c, len:922, FT SIMILARITY:Schizosaccharomyces pombe, O74842, putative FT helicase., (1284 aa), fasta scores: opt: 2644, E():0, FT (45.9% identity in 937 aa)" FT /product="helicase of the Snf2p family with a DNA- FT dependent ATPase domain; possibly involved in resistance FT to UV radiation by similar to fun30" FT /fasta_file="fasta/c25A8.tab.seq.00970.out" FT misc_feature complement(2128344..2128595) FT /colour=9 FT /note="Pfam match to entry helicase_C PF00271, Helicases FT co nserved C-terminal domain" FT misc_feature complement(2128881..2129798) FT /colour=9 FT /note="Pfam match to entry SNF2_N PF00176, SNF2 and others FT N-terminal domain" FT CDS 2132458..2133630 FT /colour=8 FT /gene="SPAC25A8.02" FT /label=SPAC25A8.02 FT /note="SPAC25A8.02, len:390" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c25A8.tab.seq.00971.out" FT misc_feature 2133784..2133887 FT /note="nominal overlap with c631 S. pombe chromosome 1" FT CDS complement(join(2133873..2134276,2134326..2134722, FT 2134920..2134925)) FT /colour=7 FT /gene="SPAC631.01c" FT /label=SPAC631.01c FT /note="SPAC631.01c, len:269, SIMILARITY:Gallus gallus, FT CAPB_CHICK, f-actin capping protein beta subunit isoforms FT 1 and 2, (277 aa), fasta scores: opt: 858, E():0, (51.1% FT identity in 266 aa)" FT /product="putative f-actin capping protein beta subunit" FT /fasta_file="fasta/c631.tab.seq.02288.out" FT misc_feature 2133784..2133887 FT /note="nominal overlap with SPAC25A8 S. pombe chromosome 1" FT misc_feature complement(join(2133888..2134276,2134326..2134716)) FT /note="Match to PF01115 F_actin_cap_B, F-actin capping FT protein, beta subunit Score 390.29" FT misc_feature complement(2134277..2134290) FT /colour=6 FT /note="ctaacttcatttag, splice branch and acceptor" FT misc_feature complement(2134320..2134325) FT /colour=6 FT /note="gtattt, splice donor sequence" FT misc_feature complement(2134723..2134739) FT /colour=6 FT /note="ctaacttattcttttag, splice branch and acceptor" FT misc_feature complement(2134914..2134919) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS 2137616..2139799 FT /colour=7 FT /gene="SPAC631.02" FT /note="SPAC631.02, len:728; similar to yeast BDF1" FT /product="bromodomain protein; similar to S. cerevisiae FT BDF1" FT /fasta_file="fasta/c631.tab.seq.02289.out" FT misc_feature 2138318..2138581 FT /note="Match to PF00439 bromodomain, Bromodomain Score FT 124.15" FT misc_feature 2138801..2139070 FT /note="Match to PF00439 bromodomain, Bromodomain Score FT 141.16" FT misc_feature 2142326..2142444 FT /note="Nominal overlap with c631 S. pombe chromosome 1" FT CDS 2143687..2144439 FT /colour=7 FT /gene="SPAC20H4.02" FT /label=SPAC20H4.02 FT /note="SPAC20H4.02, len:251, SIMILARITY:Saccharomyces FT cerevisiae, Q12015, chromosome xv reading frame orf FT yor223w., (292 aa), fasta scores: opt: 227, E():3.9e-08, FT (27.6% identity in 279 aa)" FT /product="putative guanine nucleotide binding protein; FT similar to S. cerevisiae YOR223W" FT /fasta_file="fasta/c20H4.tab.seq.02317.out" FT CDS complement(join(2144832..2144876,2144926..2144950, FT 2145014..2145693,2145869..2145931,2145989..2146057)) FT /colour=2 FT /gene="tfs1" FT /gene="SPAC20H4.03c" FT /label=tfs1 FT /note="SPAC20H4.03c, len:294" FT /product="transcription elongation factor SII; similar to FT S. cerevisiae TFS1" FT /fasta_file="fasta/c20H4.tab.seq.02318.out" FT misc_feature complement(join(2144841..2144876,2144926..2144950, FT 2145014..2145069)) FT /note="Match to PF01096 TFIIS, Transcription factor S-II FT (TFIIS) Score 49.86" FT misc_feature complement(2144877..2144891) FT /colour=6 FT /note="ctaatttttttttag, splice branch and acceptor" FT misc_feature complement(2144920..2144925) FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature complement(2144951..2144966) FT /colour=6 FT /note="ttaacaatccgtatag, splice branch and acceptor" FT misc_feature complement(2145008..2145013) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(2145694..2145710) FT /colour=6 FT /note="ctaaccaatgatgctag, splice branch and acceptor" FT intron complement(2145694..2145868) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(2145863..2145868) FT /colour=6 FT /note="gtaggt, splice donor sequence" FT misc_feature complement(2145932..2145946) FT /colour=6 FT /note="ctaatatcaagctag, splice branch and acceptor" FT intron complement(2145932..2145988) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(2145983..2145988) FT /colour=6 FT /note="gtttgt, splice donor sequence" FT CDS 2146545..2148896 FT /colour=7 FT /gene="SPAC20H4.04" FT /label=SPAC20H4.04 FT /note="SPAC20H4.04, len:784, FT SIMILARITY:Schizosaccharomyces pombe, Q9UT23, putative ATP- FT dependent RNA helicase., (839 aa), fasta scores: opt: 960, FT E():0, (35.7% identity in 658 aa)" FT /product="putative ATP-dependent RNA helicase" FT /fasta_file="fasta/c20H4.tab.seq.02319.out" FT misc_feature 2146878..2147375 FT /note="Match to PF00270 DEAD, DEAD/DEAH box helicase Score FT 69.12" FT misc_feature 2148051..2148266 FT /note="Match to PF00271 helicase_C, Helicases conserved C- FT terminal domain Score 57.97" FT CDS complement(join(2149038..2149246,2149290..2149468, FT 2149514..2149591,2149651..2149728,2149839..2149960)) FT /colour=7 FT /gene="SPAC20H4.05c" FT /label=SPAC20H4.05c FT /note="SPAC20H4.05c, len:222, SIMILARITY:Homo sapiens, FT Q9Y318, cgi-29 protein., (242 aa), fasta scores: opt: 525, FT E():2.3e-28, (39.5% identity in 228 aa)" FT /product="putative phosphate epimerase" FT /fasta_file="fasta/c20H4.tab.seq.02320.out" FT misc_feature complement(2149247..2149258) FT /colour=6 FT /note="ctaaccgaatag, splice branch and acceptor" FT misc_feature complement(2149284..2149289) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(2149508..2149513) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(2149592..2149605) FT /colour=6 FT /note="ctaacctcttgcag, splice branch and acceptor" FT misc_feature complement(2149645..2149650) FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature complement(2149729..2149743) FT /colour=6 FT /note="ttaactttcatgtag, splice branch and acceptor" FT misc_feature complement(2149833..2149838) FT /colour=6 FT /note="gtaatt, splice donor sequence" FT CDS complement(2150280..2151884) FT /colour=10 FT /gene="SPAC20H4.06c" FT /label=SPAC20H4.06c FT /note="SPAC20H4.06c, len:535, SIMILARITY:Arabidopsis FT thaliana, BAB09825, genomic DNA, chromosome 5, p1 FT clone:myj24., (900 aa), fasta scores: opt: 321, E():6.7e- FT 13, (29.9% identity in 384 aa)" FT /product="hypothetical protein; G-patch domain at the N FT terminus; putative RNA-binding protein" FT /fasta_file="fasta/c20H4.tab.seq.02321.out" FT intron complement(2150557..2150606) FT /colour=7 FT /note="Intron predicted by HMM_intron, Score=12.10" FT /score=1.21 FT CDS join(2152966..2153032,2153128..2154125) FT /colour=2 FT /gene="rhp57" FT /gene="SPAC20H4.07" FT /gene="SPAC145.01" FT /label=rhp57 FT /note="SPAC20H4.07, len:355" FT /product="DNA repair protein; involved in sporulation" FT /fasta_file="fasta/c20H4.tab.seq.02322.out" FT misc_feature 2153033..2153038 FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature 2153115..2153127 FT /colour=6 FT /note="ctgacagctttag, splice branch and acceptor" FT CDS 2154668..2155480 FT /colour=12 FT /gene="SPAC20H4.08" FT /gene="SPAC145.02" FT /label=SPAC20H4.08 FT /note="SPAC20H4.08, len:271" FT /product="hypothetical protein; similar to S. pombe FT SPBP4H10.16C; possibly S. pombe specific" FT /fasta_file="fasta/c20H4.tab.seq.02323.out" FT CDS join(2155743..2155833,2155877..2155954,2156003..2156067, FT 2156116..2156372,2156409..2157180,2157227..2157328, FT 2157377..2157545,2157588..2157908,2157947..2158035) FT /colour=7 FT /gene="SPAC20H4.09" FT /gene="SPAC145.03" FT /label=SPAC20H4.09 FT /note="SPAC20H4.09, len:648" FT /product="putative pre-mRNA splicing factor; ATP-dependent FT RNA helicase" FT /fasta_file="fasta/c20H4.tab.seq.02324.out" FT misc_feature 2155834..2155839 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2155861..2155876 FT /colour=6 FT /note="ctgacgttacatttag, splice branch and acceptor" FT misc_feature 2155955..2155960 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2155985..2156002 FT /colour=6 FT /note="ctaaaaataatcttgaag, splice branch and acceptor" FT misc_feature 2156068..2156073 FT /colour=6 FT /note="gttagt, splice donor sequence" FT misc_feature 2156100..2156115 FT /colour=6 FT /note="ctaacttatttgaaag, splice branch and acceptor" FT misc_feature 2156373..2156378 FT /colour=6 FT /note="gtattt, splice donor sequence" FT intron 2156373..2156408 FT /note="confirmed by homology; missed from initial FT prediction; added 23.10.2000" FT misc_feature 2156396..2156408 FT /colour=6 FT /note="ctgacaaatcaag, splice branch and acceptor" FT misc_feature 2156707..2156985 FT /note="Match to PF00271 helicase_C, Helicases conserved C- FT terminal domain Score 20.34" FT misc_feature 2157181..2157186 FT /colour=6 FT /note="gtttgt, splice donor sequence" FT misc_feature 2157212..2157226 FT /colour=6 FT /note="ctaatttttttgaag, splice branch and acceptor" FT misc_feature 2157329..2157334 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 2157362..2157376 FT /colour=6 FT /note="ctaacccatcattag, splice branch and acceptor" FT misc_feature 2157546..2157551 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 2157577..2157587 FT /colour=6 FT /note="ttaacatttag, splice branch and acceptor" FT misc_feature 2157909..2157914 FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature 2157935..2157946 FT /colour=6 FT /note="ttaacgttttag, splice branch and acceptor" FT CDS join(2158139..2158156,2158199..2158942,2158989..2161185, FT 2161226..2161299) FT /colour=2 FT /gene="ufd2" FT /gene="SPAC20H4.10" FT /gene="SPAC145.04" FT /label=ufd2 FT /note="SPAC20H4.10, len:1011" FT /note="possibly overpredicted at the N-terminal exon" FT /product="ubiquitin fusion degradation protein-2; FT subcellular localization of GFP fusion- Nucleus and FT cytoplasmic dots" FT /fasta_file="fasta/c20H4.tab.seq.02325.out" FT misc_feature 2158157..2158162 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 2158182..2158198 FT /colour=6 FT /note="ctaatattggcccatag, splice branch and acceptor" FT misc_feature 2158943..2158948 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 2158976..2158988 FT /colour=6 FT /note="ctgatatttttag, splice branch and acceptor" FT misc_feature 2161186..2161191 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT intron 2161186..2161225 FT /colour=2 FT /note="confirmed intron" FT misc_feature 2161214..2161225 FT /colour=6 FT /note="ctaattctttag, splice branch and acceptor" FT CDS complement(join(2161571..2162102,2162221..2162291)) FT /colour=2 FT /gene="rho5" FT /gene="SPAC20H4.11c" FT /label=rho5 FT /note="SPAC20H4.11c, len:201, FT SIMILARITY:Schizosaccharomyces pombe, RHO1_SCHPO, rho1 FT protein., (202 aa), fasta scores: opt: 1170, E():0, (86.1% FT identity in 202 aa)" FT /product="Rho family; RAS small GTPase; guanine nucleotide FT exchange factor" FT /fasta_file="fasta/c20H4.tab.seq.02326.out" FT misc_feature complement(join(2161574..2162102,2162221..2162270)) FT /note="Match to PF00071 ras, Ras family Score 287.41" FT misc_feature complement(2162103..2162118) FT /colour=6 FT /note="ctaacaattattttag, splice branch and acceptor" FT misc_feature complement(2162215..2162220) FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 2162899..2162999 FT /note="Nominal overlap with SPAC23C11 S. pombe chromosome FT 1" FT CDS join(2163115..2163378,2163458..2163772,2163826..2164011, FT 2164052..2164164,2164250..2164697) FT /colour=10 FT /gene="SPAC23C11.01" FT /label=SPAC23C11.01 FT /note="SPAC23C11.01, len:441, SIMILARITY:Saccharomyces FT cerevisiae, YIJ0_YEAST, hypothetical 56.3 kD protein, (491 FT aa), fasta scores: opt: 175, E():0.00024, (26.5% identity FT in 480 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YIL090W; contains 10 predicted transmembrane helices" FT /fasta_file="fasta/c23C11.tab.seq.00405.out" FT misc_feature 2163379..2163384 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2163438..2163457 FT /colour=6 FT /note="ctaacataaatttaaaatag, splice branch and acceptor" FT misc_feature 2163773..2163778 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 2163811..2163825 FT /colour=6 FT /note="ttaacttaaacgcag, splice branch and acceptor" FT misc_feature 2164012..2164017 FT /colour=6 FT /note="gtaatt, splice donor sequence" FT misc_feature 2164039..2164051 FT /colour=6 FT /note="ttaacatatttag, splice branch and acceptor" FT misc_feature 2164165..2164170 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2164233..2164249 FT /colour=6 FT /note="ttaacattttttaacag, splice branch and acceptor" FT misc_feature complement(2165001) FT /colour=4 FT /note="poly A attachment site" FT misc_feature complement(2165001..2165481) FT /colour=3 FT /note="partial primary transcript for ribosomal protein FT s23 homolog; EM_FUN:SPAB1288" FT CDS complement(2165033..2165464) FT /colour=2 FT /gene="rps23" FT /gene="SPAC23C11.02c" FT /label=rps23 FT /note="SPAC23C11.02c, len:143" FT /product="40S ribosomal protein S23" FT /fasta_file="fasta/c23C11.tab.seq.00406.out" FT misc_feature complement(2165039..2165446) FT /note="Match to PF00164 Ribosomal_S12, Ribosomal protein FT S12 Score 262.42" FT misc_feature complement(2165264..2165287) FT /colour=8 FT /note="PS00055 Ribosomal protein S12 signature" FT promoter complement(2165531..2165538) FT /colour=4 FT /note="Homol D box" FT promoter complement(2165540..2165549) FT /colour=4 FT /note="Homol E box" FT CDS 2165821..2167617 FT /colour=7 FT /gene="SPAC23C11.03" FT /label=SPAC23C11.03 FT /note="SPAC23C11.03, len:598, SIMILARITY:Saccharomyces FT cerevisiae, YJX2_YEAST, hypothetical 67.0 kD protein in FT pre3-sag1 intergenic region., (593 aa), fasta scores: opt: FT 855, E():0, (33.0% identity in 610 aa)" FT /product="putative U3 snoRNP component; required for pre- FT 18S rRNA processing; similar to S. cerevisiae MPP10" FT /fasta_file="fasta/c23C11.tab.seq.00407.out" FT CDS complement(join(2167740..2167886,2167943..2168520, FT 2168574..2169114)) FT /colour=7 FT /gene="SPAC23C11.04c" FT /label=SPAC23C11.04c FT /note="SPAC23C11.04c, len:421, SIMILARITY:Homo sapiens, FT AAD51135, polynucleotide kinase-3'-phosphatase., (521 aa), FT fasta scores: opt: 493, E():3.4e-24, (34.3% identity in FT 376 aa)" FT /product="putative DNA 3' phosphatase; similar to S. FT cerevisiae TPP1; Pfam-B_11748 domain" FT /fasta_file="fasta/c23C11.tab.seq.00408.out" FT misc_feature complement(2167887..2167900) FT /colour=6 FT /note="ctaaccaattctag, splice branch and acceptor" FT misc_feature complement(2167937..2167942) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(2168252..2168275) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature complement(2168521..2168541) FT /colour=6 FT /note="ttaacatttttcaccctttag, splice branch and acceptor" FT misc_feature complement(2168568..2168573) FT /colour=6 FT /note="gtgagt, splice donor sequence" FT misc_feature 2170055..2171373 FT /colour=3 FT /note=" EM_FUN:SPPPAG X54301 Yeast ppa gene for inorganic FT p yrophosphatase" FT misc_feature 2170096..2170101 FT /colour=4 FT /note="putative TATA box" FT CDS 2170205..2171074 FT /EC_number="3.6.1.1" FT /colour=2 FT /gene="ppa" FT /gene="SPAC23C11.05" FT /label=ppa FT /note="SPAC23C11.05, len:289" FT /product="inorganic pyrophosphatase" FT /fasta_file="fasta/c23C11.tab.seq.00409.out" FT misc_feature 2170340..2170894 FT /colour=9 FT /note="Pfam match to entry PF00719 Pyrophosphatase, FT Inorgan ic pyrophosphatase" FT misc_feature 2170553..2170573 FT /colour=8 FT /note="PS00387 Inorganic pyrophosphatase signature" FT CDS complement(2171360..2172967) FT /colour=10 FT /gene="SPAC23C11.06c" FT /label=SPAC23C11.06c FT /note="SPAC23C11.06c, len:535" FT /product="hypothetical protein; similar to S. cerevisiae FT YNL115C; contains 5 predicted transmembrane helices" FT /fasta_file="fasta/c23C11.tab.seq.00410.out" FT misc_feature complement(2171702..2171725) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT CDS 2174570..2174902 FT /colour=8 FT /gene="SPAC23C11.07" FT /label=SPAC23C11.07 FT /note="SPAC23C11.07, len:110)" FT /product="hypothetical protein; sequence orphan; has FT transcript profile on microarray" FT /fasta_file="fasta/c23C11.tab.seq.00411.out" FT misc_feature 2174944..2176454 FT /colour=3 FT /note="primary transcript for php3; EM_FUN:SPRNAPHP3; FT X7507 2" FT CDS join(2175357..2175455,2175603..2175663,2175719..2175846, FT 2176002..2176064) FT /colour=2 FT /gene="php3" FT /gene="SPAC23C11.08" FT /label=php3 FT /note="SPAC23C11.08, len:116" FT /product="putative CCAAT-box binding factor; required for FT growth on non-fermentable carbon sources" FT /fasta_file="fasta/c23C11.tab.seq.00412.out" FT misc_feature join(2175390..2175455,2175603..2175663,2175719..2175792) FT /note="Match to PF00808 CBFD_NFYB_HMF, Histone-like FT transcription factors (CBF/NF-Y) and archaeal histones. FT Score 46.59" FT misc_feature 2175456..2175461 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT intron 2175456..2175602 FT /note="intron confirmed from EST" FT misc_feature 2175584..2175602 FT /colour=6 FT /note="ctaatgtctgactttttag, splice branch and acceptor" FT misc_feature 2175664..2175669 FT /colour=6 FT /note="gtatgg, splice donor sequence" FT intron 2175664..2175718 FT /note="intron confirmed from EST" FT misc_feature 2175704..2175718 FT /colour=6 FT /note="ctgaccatataatag, splice branch and acceptor" FT misc_feature 2175847..2175852 FT /colour=6 FT /note="gtaagg, splice donor sequence" FT intron 2175847..2176001 FT /note="intron confirmed from EST" FT misc_feature 2175986..2176001 FT /colour=6 FT /note="ctaacatctactctag, splice branch and acceptor" FT misc_feature 2176454 FT /colour=4 FT /note="poly A attachment site" FT CDS 2176878..2179757 FT /EC_number="6.1.1.7" FT /colour=7 FT /gene="SPAC23C11.09" FT /label=SPAC23C11.09 FT /note="SPAC23C11.09, len:959, SIMILARITY:Saccharomyces FT cerevisiae, SYAC_YEAST, alanyl-tRNA synthetase, FT cytoplasmic, (958 aa), fasta scores: opt: 3840, E():0, FT (59.4% identity in 955 aa)" FT /product="putative alanyl-tRNA synthetase, cytoplasmic" FT /fasta_file="fasta/c23C11.tab.seq.00413.out" FT misc_feature 2176917..2179715 FT /note="Match to PF01411 tRNA-synt_2c, tRNA synthetases FT class II (A) Score 1947.94" FT misc_feature 2177613..2177642 FT /colour=8 FT /note="PS00339 Aminoacyl-transfer RNA synthetases class-II FT signature 2" FT CDS join(2180300..2180420,2180460..2180581) FT /colour=8 FT /gene="SPAC23C11.10" FT /label=SPAC23C11.10 FT /note="SPAC23C11.10, len:80" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c23C11.tab.seq.00414.out" FT misc_feature 2180421..2180426 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 2180440..2180459 FT /colour=6 FT /note="ttgataactcatattcttag, splice branch and acceptor" FT misc_feature 2181713..2181883 FT /note="794 (+1) 6 171 EM_FUN:SPCKICAAA L29508 FT Schizosacchar omyces pombe casein kinase II catalytic FT subunit mRNA, compl ete cds. 7/94" FT misc_feature 2181713..2183664 FT /colour=3 FT /note="primary transcript for casein kinase II catalytic FT su bunit; EM_FUN:SPCKICAAA; L29508" FT CDS join(2181830..2181875,2181936..2182216,2182375..2182687, FT 2182749..2183050,2183144..2183200) FT /EC_number="2.7.1.37" FT /colour=2 FT /gene="cka1" FT /gene="orb5" FT /gene="SPAC23C11.11" FT /label=cka1 FT /note="SPAC23C11.11, len:332" FT /product="serine/threonine protein kinase; casein kinase FT ii, alpha chain; involved in cell growth regulation" FT /fasta_file="fasta/c23C11.tab.seq.00415.out" FT misc_feature 2181876..2181881 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT intron 2181876..2181935 FT /note="intron confirmed from EST" FT misc_feature 2181922..2181935 FT /colour=6 FT /note="ctaattagatttag, splice branch and acceptor" FT misc_feature 2182016..2182216 FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 56.38" FT misc_feature 2182217..2182222 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT intron 2182217..2182374 FT /note="intron confirmed from EST" FT misc_feature 2182361..2182374 FT /colour=6 FT /note="ctaatattttatag, splice branch and acceptor" FT misc_feature join(2182441..2182687,2182749..2183050,2183144..2183185) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 126.24" FT misc_feature 2182688..2182693 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT intron 2182688..2182748 FT /note="intron confirmed from EST" FT misc_feature 2182734..2182748 FT /colour=6 FT /note="ctaaccaaactttag, splice branch and acceptor" FT misc_feature 2183051..2183056 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT intron 2183051..2183143 FT /note="intron confirmed from EST" FT misc_feature 2183130..2183143 FT /colour=6 FT /note="ctaacttagcatag, splice branch and acceptor" FT CDS 2184471..2184713 FT /colour=2 FT /gene="hcn1" FT /gene="SPAC23C11.12" FT /label=hcn1 FT /note="SPAC23C11.12, len:80" FT /product="anaphase-promoting complex (APC); high copy FT supressor of cut9; similar to S. cerevisiae CDC26" FT /fasta_file="fasta/c23C11.tab.seq.00075.out" FT CDS complement(join(2185238..2185724,2185999..2186132)) FT /colour=7 FT /gene="SPAC23C11.13c" FT /label=SPAC23C11.13c FT /note="SPAC23C11.13c, len:206, SIMILARITY:Saccharomyces FT cerevisiae, YJ9B_YEAST, hypothetical 23.7 kD protein in FT nmd5-hom6 intergenic region., (209 aa), fasta scores: opt: FT 737, E():0, (59.0% identity in 200 aa)" FT /product="putative phosphoribosyl transferase" FT /fasta_file="fasta/c23C11.tab.seq.00417.out" FT misc_feature complement(2185725..2185736) FT /colour=6 FT /note="ctaatataacag, splice branch and acceptor" FT misc_feature complement(2185993..2185998) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2188335..2189762 FT /colour=3 FT /note="mRNA, complete cds; EM_FUN:SPD236 D89236" FT CDS 2188488..2189651 FT /colour=2 FT /gene="zhf" FT /gene="zhf1" FT /gene="SPAC23C11.14" FT /label=zhf1 FT /note="SPAC23C11.14, len:387, SIMILARITY:Saccharomyces FT cerevisiae, Q06808, oxidative stress resistance., (429 aa), FT fasta scores: opt: 1084, E():0, (46.8% identity in 376 FT aa)" FT /product="CDF metal cation transporter; involved in metal FT homeostasis (PMID: 11886869); involved in zinc homeostasis FT (PMID: 11886869); involved in cadmium homeostasis FT (independent of the phytochelatin detoxification pathway) FT (PMID: 11886869); involved in cobalt homeostasis (PMID: FT 11886869); subcellular localization endplasmic reticulum FT (IDA) (PMID: 11886869); similar to S. cerevisiae ZRC1; FT histidine rich cytoplasmic loop (PMID: 11886869); contains FT 6 predicted transmembrane helices" FT /fasta_file="fasta/c23C11.tab.seq.00076.out" FT misc_feature 2188677..2189615 FT /colour=9 FT /note="Pfam match to entry PF01545 Cation_efflux, Cation FT efflux family," FT CDS join(2190248..2190278,2190325..2190505,2190584..2193599) FT /colour=2 FT /function="essential for cell viability and required for FT retroelement propagation in fission yeast" FT /gene="pst2" FT /gene="SPAC23C11.15" FT /label=pst2 FT /note="SPAC23C11.15, len:1075, FT SIMILARITY:Schizosaccharomyces pombe, YB6A_SCHPO, FT hypothetical 171.5 kD protein c12c2.10c in chromosome ii., FT (1522 aa), fasta scores: opt: 1282, E():0, (27.8% identity FT in 1170 aa), also some similar to, Saccharomyces FT cerevisiae, SIN3_YEAST, paired amphipathic helix protein, FT (1536 aa), fasta scores: opt: 785, E(): 0, (25.9% identity FT in 1036 aa)" FT /product="sin3 family corepressor" FT /fasta_file="fasta/c23C11.tab.seq.00419.out" FT misc_feature 2190279..2190284 FT /colour=6 FT /note="gtacgt, splice donor sequence" FT misc_feature 2190308..2190324 FT /colour=6 FT /note="ttaaccaatgttgttag, splice branch and acceptor" FT misc_feature 2190506..2190511 FT /colour=6 FT /note="gtatat, splice donor sequence" FT misc_feature 2190568..2190583 FT /colour=6 FT /note="ttaacatgaacattag, splice branch and acceptor" FT CDS 2193916..2195967 FT /colour=2 FT /gene="plo1" FT /gene="SPAC23C11.16" FT /label=plo1 FT /note="SPAC23C11.16, len:683" FT /product="serine/threonine protein kinase; Polo family ; FT involved in bipolar spindle formation; involved in FT cytokinesis" FT /fasta_file="fasta/c23C11.tab.seq.00420.out" FT misc_feature 2194036..2194803 FT /colour=9 FT /note="Pfam match to entry PF00069 pkinase, Eukaryotic FT prot ein kinase domain" FT misc_feature 2194054..2194134 FT /colour=8 FT /note="PS00107 protein kinases ATP-binding region FT signature" FT misc_feature 2194390..2194428 FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT misc_feature 2194783..2194812 FT /colour=8 FT /note="PS00142 Neutral zinc metallopeptidases, zinc FT binding region signature" FT misc_feature 2195413..2195616 FT /colour=9 FT /note="Pfam match to entry PF00659 POLO_box, POLO box FT dupli cated region" FT misc_feature 2195725..2195925 FT /colour=9 FT /note="Pfam match to entry PF00659 POLO_box, POLO box FT dupli cated region." FT CDS join(2196846..2196921,2196978..2198359) FT /colour=10 FT /gene="SPAC23C11.17" FT /label=SPAC23C11.17 FT /note="SPAC23C11.17, len:485, SIMILARITY:Saccharomyces FT cerevisiae, Q06493, chromosome xvi cosmid 9642., (454 aa), FT fasta scores: opt: 1063, E():0, (43.5% identity in 418 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YPR125W;" FT /fasta_file="fasta/c23C11.tab.seq.00421.out" FT misc_feature 2196857..2198663 FT /colour=3 FT /note="partial primary transcript; EM_FUN:SPD117; D89117" FT misc_feature 2196922..2196927 FT /colour=6 FT /note="gtaagg, splice donor sequence" FT intron 2196922..2196977 FT /note="intron confirmed from EST" FT misc_feature 2196964..2196977 FT /colour=6 FT /note="ctaacgttttgtag, splice branch and acceptor" FT misc_feature 2198663 FT /colour=4 FT /note="putative polyA site" FT misc_feature complement(2198944..2198955) FT /colour=6 FT /note="ctgacgctacag, splice branch and acceptor" FT misc_feature complement(2198978..2198983) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(2198982..2199074) FT /note="Match to PF00488 mutS, DNA mismatch repair proteins, FT mutS family Score 31.39" FT misc_feature complement(2199069..2199084) FT /colour=6 FT /note="ttaactcgatacacag, splice branch and acceptor" FT misc_feature complement(2199108..2199113) FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature complement(2199138..2199734) FT /note="Match to PF00488 mutS, DNA mismatch repair proteins, FT mutS family Score 350.93" FT misc_feature complement(2199510..2199533) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop), FT [AG]. {4}GK[ST], info count = 13.8" FT misc_feature complement(2200095..2201288) FT /colour=9 FT /note="Pfam match to entry PF01624 MutS, MutS family, N- FT terminal putative DNA-binding domain," FT misc_feature complement(2200308..2200334) FT /colour=8 FT /note="PS00215 Mitochondrial energy transfer proteins FT signa ture" FT misc_feature 2201164..2201289 FT /note="nominal overlap with cosmid SPAC13F5, EM:Z99091 S. FT pombe chromosome 1" FT misc_feature 2201164..2201289 FT /note="nominal overlap with cosmid SPAC23C11, EM:Z98559 FT S.pombe chromosome 1" FT CDS complement(join(2202206..2203059,2203101..2203428)) FT /colour=2 FT /function="required for mRNA export" FT /gene="ptr6" FT /gene="SPAC13F5.02c" FT /label=ptr6 FT /note="SPAC13F5.02c, len:393" FT /product="transcription initiation factor TFIID subunit; FT similar to S. cerevisiae TAF67; required for mRNA export" FT /fasta_file="fasta/c13F5.tab.seq.01690.out" FT misc_feature complement(2203060..2203072) FT /colour=6 FT /note="ttaacagagttag, splice branch and acceptor" FT misc_feature complement(2203095..2203100) FT /colour=6 FT /note="gtaatg, splice donor sequence" FT LTR complement(2203575..2203911) FT /note="Tf2 type ltr" FT CDS complement(2204684..2206036) FT /EC_number="1.1.1.6" FT /colour=7 FT /gene="SPAC13F5.03c" FT /label=SPAC13F5.03c FT /note="SPAC13F5.03c, len:450, SIMILARITY:Bacillus FT stearothermophilus., GLDA_BACST, glycerol dehydrogenase, FT (370 aa), fasta scores: opt: 1052, E():0, (45.9% identity FT in 368 aa)" FT /product="glycerol dehydrogenase (bacterial like); no FT apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c13F5.tab.seq.00016.out" FT misc_feature complement(2204807..2205832) FT /note="Match to PF00465 Fe-ADH, Iron-containing alcohol FT dehydrogenases Score 145.68" FT misc_feature complement(2206076..2209795) FT /gene="putative gene free region" FT CDS complement(join(2207258..2208031,2208122..2208181)) FT /colour=9 FT /gene="SPAC13F5.04c" FT /label=SPAC13F5.04c FT /note="SPAC13F5.04c, len:277" FT /product="very hypothetical protein" FT /fasta_file="fasta/c13F5.tab.seq.01692.out" FT misc_feature complement(2208032..2208052) FT /colour=6 FT /note="ctaacccctattgctacgtag, splice branch and acceptor" FT misc_feature complement(2208116..2208121) FT /colour=6 FT /note="gtattt, splice donor sequence" FT CDS 2209748..2210839 FT /EC_number="5.3.4.1" FT /colour=7 FT /gene="SPAC13F5.05" FT /label=SPAC13F5.05 FT /note="SPAC13F5.05, len:363, SIMILARITY:Aspergillus niger., FT AAC77456, pdi related protein a., (464 aa), fasta FT scores: opt: 425, E():1.6e-19, (33.3% identity in 225 aa)" FT /product="protein disulphide isomerase" FT /fasta_file="fasta/c13F5.tab.seq.01693.out" FT misc_feature 2209835..2210161 FT /note="Match to PF00085 thiored, Thioredoxin Score 99.10" FT misc_feature 2209901..2209957 FT /colour=8 FT /note="PS00194 Thioredoxin family active site" FT CDS complement(join(2211243..2211399,2211443..2211544, FT 2211601..2213635,2213865..2213943,2213990..2214052)) FT /colour=2 FT /gene="sec10" FT /gene="SPAC13F5.06c" FT /label=sec2 FT /note="SPAC13F5.06c, len:811, SIMILARITY:Saccharomyces FT cerevisiae, SC10_YEAST, exocyst complex component sec10., FT (871 aa), fasta scores: opt: 462, E():8.4e-22, (22.3% FT identity in 797 aa)" FT /product="putative exocyst complex component" FT /fasta_file="fasta/c13F5.tab.seq.01694.out" FT misc_feature complement(2211400..2211410) FT /colour=6 FT /note="ttaacatttag, splice branch and acceptor" FT intron complement(2211400..2211442) FT /colour=2 FT /note="confirmed" FT misc_feature complement(2211437..2211442) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(2211545..2211558) FT /colour=6 FT /note="ctgactttatctag, splice branch and acceptor" FT intron complement(2211545..2211600) FT /colour=2 FT /note="confirmed" FT misc_feature complement(2211595..2211600) FT /colour=6 FT /note="gtacgc, splice donor sequence" FT misc_feature complement(2213636..2213652) FT /colour=6 FT /note="ctaacagaatgtttcag, splice branch and acceptor" FT misc_feature complement(2213859..2213864) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(2213944..2213957) FT /colour=6 FT /note="ctaacagattatag, splice branch and acceptor" FT misc_feature complement(2213984..2213989) FT /colour=6 FT /note="gtaacc, splice donor sequence" FT CDS complement(2214541..2214858) FT /colour=9 FT /gene="SPAC13F5.07c" FT /label=SPAC13F5.07c FT /note="SPAC13F5.07c, len:105" FT /product="very hypothetical protein" FT /fasta_file="fasta/c13F5.tab.seq.01695.out" FT misc_feature 2214823..2214963 FT /note="nominal overlap with SPBC2A9 S. pombe chromosome 2" FT misc_feature 2216138..2216256 FT /note="nominal overlap with SPAC1783 S. pombe chromosome 1" FT misc_feature 2216138..2216257 FT /note="nominal overlap with cosmid SPAC13F5 S. pombe FT chromosome 1" FT LTR 2216462..2216805 FT /note="Tf2-type LTR" FT CDS 2217230..2218981 FT /colour=7 FT /gene="SPAC1783.01" FT /label=SPAC1783.01 FT /note="SPAC1783.01, len:583, FT SIMILARITY:Schizosaccharomyces pombe, YB63_SCHPO, FT hypothetical 63.9 kD protein c12c2.03c in chromosome ii., FT (571 aa), fasta scores: opt: 1302, E():0, (44.7% identity FT in 562 aa)" FT /product="putative oxidoreductase" FT /fasta_file="fasta/c1783.tab.seq.00271.out" FT misc_feature 2217722..2218390 FT /note="Match to PF00667 FAD_binding, FAD binding domain FT Score 152.85" FT misc_feature 2218514..2218834 FT /note="Match to PF00175 oxidored_fad, Oxidoreductase FT FAD/NAD-binding domain Score 60.35" FT CDS complement(join(2219183..2219521,2219583..2219856, FT 2219921..2220185,2220242..2220350)) FT /colour=8 FT /gene="SPAC1783.02c" FT /label=SPAC1783.02c FT /note="SPAC1783.02c, len:328" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c1783.tab.seq.00272.out" FT misc_feature complement(2219522..2219534) FT /colour=6 FT /note="ctgatcattttag, splice branch and acceptor" FT misc_feature complement(2219577..2219582) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(2219857..2219870) FT /colour=6 FT /note="ctaatcatgagtag, splice branch and acceptor" FT misc_feature complement(2219915..2219920) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature complement(2220186..2220198) FT /colour=6 FT /note="ttaacccttttag, splice branch and acceptor" FT misc_feature complement(2220236..2220241) FT /colour=6 FT /note="gtttgt, splice donor sequence" FT CDS 2220684..2221739 FT /colour=8 FT /gene="SPAC1783.03" FT /label=SPAC1783.03 FT /note="SPAC1783.03, len:351" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c1783.tab.seq.00273.out" FT CDS complement(join(2221785..2222839,2222965..2223157)) FT /colour=2 FT /gene="hst4" FT /gene="SPAC1783.04c" FT /label=hst4 FT /note="SPAC1783.04c, len:415" FT /product="SIR2-like histone deacetylase; involved in FT chromatin silencing; involved in centromeric functions; FT most similar to S. cerevisiae HST4" FT /fasta_file="fasta/c1783.tab.seq.00274.out" FT misc_feature complement(2222840..2222856) FT /colour=6 FT /note="ctaatacgtttaaacag, splice branch and acceptor" FT intron complement(2222840..2222964) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(2222959..2222964) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT CDS 2224693..2228814 FT /colour=2 FT /gene="hrp1" FT /gene="chd1" FT /gene="SPAC1783.05" FT /label=hrp1 FT /note="SPAC1783.05, len:1373" FT /product="putative chromodomain-helicase; involved in FT chromosome segregation; involved in mitosis; DNA-binding FT domain binds AT-rich stretches; subcellular localization FT of GFP fusion- Nucleus; similar to S. cerevisiae CHD1" FT /fasta_file="fasta/c1783.tab.seq.00275.out" FT misc_feature 2225326..2225448 FT /note="Match to PF00385 chromo, 'chromo' (CHRromatin FT Organization MOdifier) domain Score 30.54" FT misc_feature 2225593..2225709 FT /note="Match to PF00385 chromo, 'chromo' (CHRromatin FT Organization MOdifier) domain Score 49.19" FT misc_feature 2225869..2226723 FT /note="Match to PF00176 SNF2_N, SNF2 and others N-terminal FT domain Score 414.98" FT misc_feature 2226892..2227146 FT /note="Match to PF00271 helicase_C, Helicases conserved C- FT terminal domain Score 87.92" FT CDS complement(join(2229124..2229246,2229301..2229437, FT 2229502..2229640)) FT /colour=7 FT /gene="SPAC1783.06c" FT /label=SPAC1783.06c FT /note="SPAC1783.06c, len:132, SIMILARITY:Saccharomyces FT cerevisiae, YB67_YEAST, hypothetical 21.1 kD protein in FT hpc2-pyc2 intergenic region., (186 aa), fasta scores: opt: FT 236, E():1.1e-09, (32.6% identity in 129 aa)" FT /product="similar to S. cerevisiae APG12 autophagy protein FT involved in cytoplasm to vacuole targeting" FT /fasta_file="fasta/c1783.tab.seq.00276.out" FT misc_feature complement(2229247..2229264) FT /colour=6 FT /note="ctaacttataatccatag, splice branch and acceptor" FT misc_feature complement(2229295..2229300) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(2229438..2229454) FT /colour=6 FT /note="ttaaccattatttttag, splice branch and acceptor" FT misc_feature complement(2229496..2229501) FT /colour=6 FT /note="gtttgt, splice donor sequence" FT CDS complement(2230265..2231923) FT /colour=2 FT /gene="pap1" FT /gene="SPAC1783.07c" FT /label=pap1 FT /note="SPAC1783.07c, len:552" FT /product="ap-1-like transcription factor; bZIP (basic FT leucine zipper) transcription factor family; stress FT induced transcription factor; required for oxidative sress FT response" FT /fasta_file="fasta/c1783.tab.seq.00277.out" FT misc_feature complement(2231510..2231683) FT /note="Match to PF00170 bZIP, bZIP transcription factor FT Score 42.39" FT CDS complement(2233417..2234022) FT /colour=2 FT /gene="rpl15-2" FT /gene="SPAC1783.08c" FT /label=rpl15.2 FT /note="SPAC1783.08c, len:201" FT /product="60S ribosomal protein L15.2/L15B" FT /fasta_file="fasta/c1783.tab.seq.00278.out" FT misc_feature complement(2233474..2234019) FT /note="Match to PF00827 Ribosomal_L15e, Ribosomal L15 FT Score 433.13" FT misc_feature 2235467..2235606 FT /note="nominal overlap with cosmid SPAC1327, EM:AL035254 FT S. pombe chromosome 1" FT misc_feature 2235467..2235606 FT /note="nominal overlap with cosmid SPAC1783 S. pombe FT chromosome 1" FT misc_feature complement(2236233..2236256) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A (P-loop)" FT misc_feature complement(2237475..2237561) FT /colour=8 FT /note="PS00463 fungal Zn(2)-Cys(6) binuclear cluster FT domain signature" FT misc_feature 2237579..2237676 FT /note="nominal overlap with cosmid SPAC18G6, EM:Z68198 FT S.pombe chromosome 1" FT misc_feature 2237579..2237676 FT /note="nominal overlap with cosmid SPAC1327, EM:AL035254 FT S. pombe chromosome 1" FT CDS complement(2239572..2240351) FT /colour=10 FT /gene="SPAC18G6.01c" FT /label=SPAC18G6.01c FT /note="SPAC18G6.01c, len:259aa; similarity: to FT hypothetical proteinSW:YHZ8_YEAST P38884 (27.1% identity FT in 192 aa ov erlap)" FT /product="hypothetical protein; similar to S. cerevisiae FT YHR198C; Pfam-B_18827" FT /fasta_file="fasta/c18G6.tab.seq.02033.out" FT CDS complement(2240653..2243535) FT /colour=2 FT /gene="chp1" FT /gene="SPAC18G6.02c" FT /label=chp1 FT /note="SPAC18G6.02c, len:960aa; similarity: at N-terminus FT t o SW:HP1_DROVI P29227 heterchromatin protein 1 (HP1) FT (46.4 % identity in 56 aa overlap)" FT /product="chromodomain protein; required for centromeric FT silencing and chromosome segregation; binds centromeric FT flanking sequence" FT /fasta_file="fasta/c18G6.tab.seq.02034.out" FT misc_feature complement(2243356..2243481) FT /colour=9 FT /note="Pfam match to entry PF00385 chromo, 'chromo' FT (CHRrom atin Organization MOdifier) domain, score 46.20, E- FT value 4. 6e-12" FT tRNA complement(2244409..2244490) FT /note="tRNA Val anticodon AAC, Cove score 63.53" FT intron complement(2244445..2244452) FT /note="intron tRNA Val anticodon AAC" FT misc_feature 2245412..2245467 FT /colour=3 FT /note="intron in 5' utr of transcript for ypt3" FT CDS join(2245491..2245917,2246162..2246242,2246297..2246433) FT /colour=2 FT /function="protein transport. probably involved in vesicul FT ar traffic (by similarity)" FT /gene="ypt3" FT /gene="SPAC18G6.03" FT /label=ypt3 FT /note="SPAC18G6.03, len:214aa" FT /product="golgi rab protein; RAS small GTPases; RAB FT subfamily" FT /fasta_file="fasta/c18G6.tab.seq.02035.out" FT misc_feature join(2245530..2245917,2246162..2246242,2246297..2246430) FT /note="Match to PF00071 ras, Ras family Score 320.83" FT misc_feature 2245539..2245562 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A" FT misc_feature 2245918..2245923 FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature 2246147..2246161 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaatgtttttacag" FT misc_feature 2246243..2246248 FT /colour=2 FT /note="splice donor sequence, gtatgt" FT intron 2246243..2246296 FT /note="confirmed by EST" FT misc_feature 2246281..2246296 FT /colour=2 FT /note="splice branch and acceptor sequence, FT tactaatctagcgta g" FT CDS complement(2246863..2248281) FT /EC_number="2.1.2.1" FT /colour=2 FT /gene="shm2" FT /gene="SPAC18G6.04c" FT /label=shm2 FT /note="SPAC18G6.04c, len:472aa; anomoly:possibly spliced FT at 5' end (9288..10667,10814..10897)" FT /product="serine hydroxymethyltransferase" FT /fasta_file="fasta/c18G6.tab.seq.02036.out" FT misc_feature complement(2246974..2246997) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A" FT misc_feature complement(2247034..2248230) FT /colour=9 FT /note="Pfam match to entry PF00464 SHMT, Serine FT hydroxymeth yltransferase" FT misc_feature complement(2247511..2247552) FT /colour=8 FT /note="PS00096 Serine hydroxymethyltransferase pyridoxal- FT ph osphate attachment site" FT CDS complement(join(2248931..2256795,2256869..2257016)) FT /colour=7 FT /gene="SPAC18G6.05c" FT /label=SPAC18G6.05c FT /note="SPAC18G6.05c, len:2670aa; similarity: SW:GCN1_YEAST FT P33892 translational activator GCN1 (38.8% identity in FT 187 5 aa overlap)" FT /product="putative translational activator; yeast GCN1 FT homolog" FT /fasta_file="fasta/c18G6.tab.seq.02037.out" FT misc_feature complement(2256796..2256812) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacttttcatttc ag" FT intron complement(2256796..2256868) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(2256863..2256868) FT /colour=2 FT /note="splice donor sequence, gtaatt" FT CDS 2258691..2259440 FT /colour=10 FT /gene="SPAC18G6.06" FT /label=SPAC18G6.06 FT /note="SPAC18G6.06, len:249aa; similarity: to hypothetical FT proteins C. elegans WP:C16C10.2 CE01493 (31.5% identity FT in 260 aa overlap) and budding yeast SW:YKJ9_YEAST P34247 FT (3 7.5% identity in 248 aa overlap)" FT /product="hypothetical protein; similar to S. cerevisiae FT YKL099C" FT /fasta_file="fasta/c18G6.tab.seq.02038.out" FT CDS complement(2260009..2261088) FT /colour=2 FT /function="required for cell growth and mating" FT /gene="mra1" FT /gene="SPAC18G6.07c" FT /label=mra1 FT /note="SPAC18G6.07c, len:316aa" FT /product="downstream factor of ras" FT /fasta_file="fasta/c18G6.tab.seq.02039.out" FT CDS complement(2262825..2263763) FT /colour=8 FT /gene="SPAC18G6.09c" FT /label=SPAC18G6.09c FT /note="SPAC18G6.09c, len:312aa" FT /product="hypothetical serine-rich protein; sequence FT orphan" FT /fasta_file="fasta/c18G6.tab.seq.02040.out" FT CDS 2264274..2266340 FT /colour=10 FT /gene="SPAC18G6.10" FT /label=SPAC18G6.10 FT /note="SPAC18G6.10, len:688aa; similarity: to YDR458C, FT YD58 _YEAST, hypothetical protein (663aa), fasta scores, FT opt:19 0, E():3e-10, (23.8% identity in 705 aa overlap)" FT /product="hypothetical protein; similar to S. cerevisiae FT YDR458C" FT /fasta_file="fasta/c18G6.tab.seq.02041.out" FT CDS complement(2266672..2268471) FT /colour=7 FT /gene="rrn3" FT /gene="SPAC18G6.11c" FT /label=rrn3 FT /note="SPAC18G6.11c, len:599aa; similarity: to YKL125W, FT RRN3_YEAST, P36070, RNA polymerase i specific FT transcription initiation factor, (627aa), fasta scores, FT opt:274, E():5.8e- 33, (26.9% identity in 590 aa overlap)" FT /product="putative RNA polymerase I specific transcription FT initiation factor; similar to S. cerevisiae RRN3" FT /fasta_file="fasta/c18G6.tab.seq.02042.out" FT CDS complement(2269177..2270106) FT /colour=12 FT /gene="B22918-1" FT /gene="SPAC18G6.12c" FT /label=SPAC18G6.12c FT /note="SPAC18G6.12c, len:309" FT /product="Pfam-B_22918 domain; possibly S. pombe specific" FT /fasta_file="fasta/c18G6.tab.seq.02043.out" FT CDS 2270689..2271033 FT /colour=9 FT /gene="SPAC18G6.13" FT /label=SPAC18G6.13 FT /note="SPAC18G6.13, len:114" FT /product="very hypothetical protein; putative pseudo- FT truncated; similar at the N-terminal to SPCC1682.03C FT (626aa)" FT /fasta_file="fasta/c18G6.tab.seq.02044.out" FT CDS complement(2271612..2272199) FT /colour=2 FT /gene="rps7" FT /gene="SPAC18G6.14c" FT /label=rps7 FT /note="SPAC18G6.14c, len:195aa" FT /product="40S ribosomal protein S7" FT /fasta_file="fasta/c18G6.tab.seq.02045.out" FT misc_feature complement(2271624..2272193) FT /note="Match to PF01251 Ribosomal_S7e, Ribosomal protein FT S7e Score 492.65" FT promoter complement(2272248..2272255) FT /colour=4 FT /note="Homol D box" FT CDS join(2273312..2273353,2273414..2274298) FT /colour=2 FT /function="possibly involved in chromosome segregation" FT /gene="mal3" FT /gene="SPAC18G6.15" FT /label=mal3 FT /note="SPAC18G6.15, len:308aa" FT /product="putative chromosome segregation protein" FT /fasta_file="fasta/c18G6.tab.seq.02046.out" FT misc_feature 2273354..2273359 FT /colour=2 FT /note="splice donor sequence, gtacgc" FT misc_feature 2273398..2273413 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctgacttattttaaa g" FT misc_feature 2275103..2275199 FT /note="nominal overlap with cosmid SPAC13D6, EM:Z69725 S. FT pombe chromosome 1" FT misc_feature 2275103..2275181 FT /note="nominal overlap with cosmid SPAC18G6, EM:Z68198 S. FT pombe chromosome 1" FT CDS 2275462..2276757 FT /colour=8 FT /gene="SPAC13D6.01" FT /label=SPAC13D6.01 FT /note="SPAC13D6.01, len:431" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c13D6.tab.seq.01633.out" FT CDS complement(2277619..2278158) FT /colour=2 FT /gene="byr3" FT /gene="SPAC13D6.02c" FT /label=byr3 FT /note="SPAC13D6.02c, len:179" FT /product="zinc finger protein; zf-CCHC type (zinc knuckle) FT (7); involved in mating response; null mutant has FT conjugation defects; cellular nucleic acid binding protein FT homolog" FT /fasta_file="fasta/c13D6.tab.seq.01634.out" FT misc_feature complement(2277637..2277690) FT /colour=9 FT /note="Pfam match to entry PF00098 zf-CCHC, zinc finger, FT CCHC class," FT misc_feature complement(2277703..2277756) FT /colour=9 FT /note="Pfam match to entry PF00098 zf-CCHC, zinc finger, FT CCHC class," FT misc_feature complement(2277760..2277813) FT /colour=9 FT /note="Pfam match to entry PF00098 zf-CCHC, zinc finger, FT CCHC class," FT misc_feature complement(2277859..2277912) FT /colour=9 FT /note="Pfam match to entry PF00098 zf-CCHC, zinc finger, FT CCHC class," FT misc_feature complement(2277934..2277987) FT /colour=9 FT /note="Pfam match to entry PF00098 zf-CCHC, zinc finger, FT CCHC class," FT misc_feature complement(2278000..2278053) FT /colour=9 FT /note="Pfam match to entry PF00098 zf-CCHC, zinc finger, FT CCHC class," FT misc_feature complement(2278057..2278110) FT /colour=9 FT /note="Pfam match to entry PF00098 zf-CCHC, zinc finger, FT CCHC class," FT tRNA complement(2278856..2278926) FT /note="tRNA Gly anticodon GCC, Cove score 72.94" FT CDS complement(join(2280048..2280653,2280703..2280783)) FT /colour=10 FT /gene="SPAC13D6.03c" FT /label=SPAC13D6.03c FT /note="SPAC13D6.03c, len:228, SIMILARITY:Saccharomyces FT cerevisiae, YMB4_YEAST, hypothetical 32.4 kD protein in FT taf40-erv25 intergenic region., (279 aa), fasta scores: FT opt: 703, E():0, (43.5% identity in 271 aa)" FT /product="conserved protein; similar to S. cerevisiae FT YML014W" FT /fasta_file="fasta/c13D6.tab.seq.01635.out" FT misc_feature complement(2280654..2280672) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaatcagtcatttt gtag" FT misc_feature complement(2280697..2280702) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT CDS complement(join(2281176..2282446,2282497..2282588, FT 2282657..2282865)) FT /colour=10 FT /gene="SPAC13D6.04c" FT /label=SPAC13D6.04c FT /note="SPAC13D6.04c, len:523, SIMILARITY:Saccharomyces FT cerevisiae, YIA1_YEAST, hypothetical 59.7 kD protein in FT bet1-pan1 intergenic region., (513 aa), fasta scores: opt: FT 533, E():1e-26, (36.4% identity in 511 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YIL001W; Ank-repeat/BTB-domain protein" FT /fasta_file="fasta/c13D6.tab.seq.01636.out" FT misc_feature complement(2281651..2282031) FT /colour=9 FT /note="Pfam match to entry PF00651 BTB, BTB/POZ domain," FT misc_feature complement(2282080..2282448) FT /colour=9 FT /note="Pfam match to entry PF00651 BTB, BTB/POZ domain," FT misc_feature complement(2282447..2282458) FT /colour=2 FT /note="splice branch and acceptor sequence, ctcacgcttaag" FT misc_feature complement(2282491..2282496) FT /colour=2 FT /note="splice donor sequence, gtatgc" FT misc_feature complement(2282515..2282613) FT /colour=9 FT /note="Pfam match to entry PF00023 ank, Ank repeat," FT misc_feature complement(2282589..2282605) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaaattcaaaatccag" FT misc_feature complement(2282614..2282715) FT /colour=9 FT /note="Pfam match to entry PF00023 ank, Ank repeat," FT misc_feature complement(2282651..2282656) FT /colour=2 FT /note="splice donor sequence, gtatgt" FT misc_feature 2282962..2283197 FT /note="nominal overlap with cosmid SPAC4G9, EM:Z69727 FT S.pombe chromosome 1" FT misc_feature 2282962..2283197 FT /note="nominal overlap with cosmid SPAC13D6, EM:Z69725 S. FT pombe chromosome 1" FT misc_feature 2283690..2283791 FT /note="Match to PF01302 CAP_GLY, CAP-Gly domain Score FT 71.48" FT CDS 2284264..2285244 FT /colour=7 FT /gene="SPAC4G9.02" FT /label=SPAC4G9.02 FT /note="SPAC4G9.02, len: 326, similar to PIR:S53908 FT hypothetical protein(N2369) - yeast (43.0% identity in FT 286 aa ove rlap)" FT /product="putative Ribonuclease H endonuclease; possibly FT degrades RNA in RNA-DNA hybrids; similar to S. cerevisiae FT RNH35" FT /fasta_file="fasta/c4G9.tab.seq.01722.out" FT misc_feature 2284459..2285094 FT /note="Match to PF01351 RNase_HII, Ribonuclease HII Score FT 380.45" FT CDS 2285611..2286273 FT /EC_number="2.7.4.3" FT /colour=2 FT /gene="adk1" FT /gene="SPAC4G9.03" FT /label=adk1 FT /note="SPAC4G9.03, len: 220" FT /product="adenylate kinase" FT /fasta_file="fasta/c4G9.tab.seq.01723.out" FT misc_feature 2285632..2286195 FT /colour=9 FT /note="Pfam match to entry PF00406 adenylatekinase, FT Adenyla te kinases" FT misc_feature 2285863..2285898 FT /colour=8 FT /note="PS00113 Adenylate kinase signature" FT CDS complement(join(2286533..2288299,2288348..2288497)) FT /colour=7 FT /gene="SPAC4G9.04c" FT /label=SPAC4G9.04c FT /note="SPAC4G9.04c, len:638, SIMILARITY:Saccharomyces FT cerevisiae, PC11_YEAST, pcf11 protein., (626 aa), fasta FT scores: opt: 432, E():2.6e-16, (27.1% identity in 676 aa)" FT /product="putative polyadenylation factor; similar to S. FT cerevisiae PCF11" FT /fasta_file="fasta/c4G9.tab.seq.01724.out" FT misc_feature complement(2288300..2288316) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaactcttatttac ag" FT misc_feature complement(2288342..2288347) FT /colour=2 FT /note="splice donor sequence, gtatga" FT CDS join(2289619..2290383,2290455..2290988,2291031..2291477) FT /colour=7 FT /gene="SPAC4G9.05" FT /label=SPAC4G9.05 FT /note="SPAC4G9.05, len:581, SIMILARITY:Schizosaccharomyces FT pombe, O74438, RNA binding protein, pumilio-family., (703 FT aa), fasta scores: opt: 1009, E():0, (35.1% identity in FT 507 aa)" FT /product="RNA-binding protein; pumilio family" FT /fasta_file="fasta/c4G9.tab.seq.01725.out" FT misc_feature 2290384..2290389 FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature 2290436..2290454 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaatgattcttttt ttag" FT misc_feature 2290560..2290661 FT /note="Match to PF00806 PUF, Pumilio-family RNA-binding FT domains (aka PUM-HD, Pumilio homology domain) Score 42.28" FT misc_feature 2290671..2290751 FT /note="Match to PF00806 PUF, Pumilio-family RNA-binding FT domains (aka PUM-HD, Pumilio homology domain) Score 33.42" FT misc_feature 2290896..2290988 FT /note="Match to PF00806 PUF, Pumilio-family RNA-binding FT domains (aka PUM-HD, Pumilio homology domain) Score 22.88" FT misc_feature 2290989..2290994 FT /colour=2 FT /note="splice donor sequence, gtacgt" FT misc_feature 2291016..2291030 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ttaacaaatcaatta g" FT misc_feature 2291046..2291150 FT /note="Match to PF00806 PUF, Pumilio-family RNA-binding FT domains (aka PUM-HD, Pumilio homology domain) Score 44.77" FT misc_feature 2291154..2291258 FT /note="Match to PF00806 PUF, Pumilio-family RNA-binding FT domains (aka PUM-HD, Pumilio homology domain) Score 26.90" FT misc_feature 2291298..2291387 FT /note="Match to PF00806 PUF, Pumilio-family RNA-binding FT domains (aka PUM-HD, Pumilio homology domain) Score 38.21" FT CDS complement(join(2291639..2291805,2291871..2292016, FT 2292063..2292091)) FT /colour=8 FT /gene="SPAC4G9.06c" FT /label=SPAC4G9.06c FT /note="SPAC4G9.06c, len:113" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c4G9.tab.seq.01726.out" FT misc_feature complement(2291806..2291824) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacttgacgtatt gtag" FT misc_feature complement(2291865..2291870) FT /colour=2 FT /note="splice donor sequence, gtatga" FT misc_feature complement(2292017..2292029) FT /colour=2 FT /note="splice branch and acceptor sequence, ctaataagaatag" FT misc_feature complement(2292057..2292062) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT CDS 2293343..2294884 FT /colour=12 FT /gene="B8647-3" FT /gene="SPAC4G9.07" FT /label=B8647-3 FT /note="SPAC4G9.07, len:513, SIMILARITY:Schizosaccharomyces FT pombe, O42654, hypothetical 49.4 kD protein c10f6.15 in FT chromosome i., (432 aa), fasta scores: opt: 482, E():5.6e- FT 25, (27.1% identity in 376 aa)" FT /product="Pfam-B_8647 domain; possibly S. pombe specific" FT /fasta_file="fasta/c4G9.tab.seq.01727.out" FT CDS complement(2295701..2299198) FT /EC_number="2.7.7.6" FT /colour=2 FT /gene="rpc2" FT /gene="SPAC4G9.08c" FT /label=rpc2 FT /note="SPAC4G9.08c, len:1165" FT /product="DNA-directed RNA polymerase III 130 kD subunit" FT /fasta_file="fasta/c4G9.tab.seq.01728.out" FT misc_feature complement(2295878..2298844) FT /colour=9 FT /note="Pfam match to entry PF00562 RNA_pol_B, RNA FT polymeras e beta subunit" FT CDS complement(2299695..2302352) FT /EC_number="2.7.2.8" FT /colour=2 FT /gene="arg11" FT /gene="SPAC4G9.09c" FT /label=arg11 FT /note="SPAC4G9.09c, len:885" FT /product="arg11 protein [contains- N-acetyl-gamma-glutamyl- FT phosphatereductase]" FT /fasta_file="fasta/c4G9.tab.seq.01729.out" FT misc_feature complement(2299737..2300639) FT /note="Match to PF01118 Semialdhyde_dh, Semialdehyde FT dehydrogenase Score 94.86" FT CDS 2303688..2304671 FT /EC_number="2.1.3.3" FT /colour=2 FT /gene="arg3" FT /gene="SPAC4G9.10" FT /label=arg3 FT /note="SPAC4G9.10, len:327" FT /product="ornithine carbamoyltransferase" FT /fasta_file="fasta/c4G9.tab.seq.01730.out" FT misc_feature 2303709..2304632 FT /note="Match to PF00185 OTCace, Aspartate/ornithine FT carbamoyltransferase Score 627.92" FT misc_feature 2303862..2303885 FT /colour=8 FT /note="PS00097 Aspartate and ornithine FT carbamoyltransferase s signature" FT CDS complement(2305254..2305925) FT /colour=2 FT /gene="cmb1" FT /gene="SPAC4G9.11c" FT /label=cmb1 FT /note="SPAC4G9.11c, len:223" FT /product="HMG box mismatch binding protein; Binds to FT Cytosines in Base Mismatches and Opposite Chemically FT Altered Guanines" FT /fasta_file="fasta/c4G9.tab.seq.01731.out" FT misc_feature complement(2305257..2305487) FT /colour=9 FT /note="Pfam match to entry PF00505 HMG_box, HMG (high FT mobility group) box, score 31.50, E-value 2.9e-06" FT CDS 2306875..2307456 FT /EC_number="2.7.1.12" FT /colour=7 FT /gene="SPAC4G9.12" FT /label=SPAC4G9.12 FT /note="SPAC4G9.12, len:193, SIMILARITY:Escherichia coli., FT IDNK_ECOLI, thermosensitive gluconokinase, (187 aa), fasta FT scores: opt: 420, E():2.4e-20, (39.5% identity in 167 aa)" FT /product="putative glucokinase" FT /fasta_file="fasta/c4G9.tab.seq.01732.out" FT misc_feature 2306935..2306958 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A" FT CDS complement(join(2307918..2308670,2308767..2308910)) FT /colour=2 FT /gene="pep8" FT /gene="SPAC4G9.13c" FT /label=pep8 FT /note="SPAC4G9.13c, len:298, SIMILARITY:Mus musculus, FT HB58_MOUSE, h beta 58 protein., (327 aa), fasta scores: FT opt: 1094, E():0, (52.0% identity in 294 aa)" FT /product="putative vacuolar sorting protein" FT /fasta_file="fasta/c4G9.tab.seq.01733.out" FT misc_feature complement(2308671..2308690) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacgacggtatag" FT misc_feature complement(2308761..2308766) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT CDS join(2310099..2310118,2310168..2310442,2310536..2310558, FT 2310668..2310796,2310844..2310915,2310984..2311130) FT /colour=7 FT /gene="SPAC4G9.14" FT /label=SPAC4G9.14 FT /note="SPAC4G9.14, len:221, SIMILARITY:Schizosaccharomyces FT pombe, O14142, hypothetical 23.4 kD protein c3g6.05 in FT chromosome i., (206 aa), fasta scores: opt: 438, E():4.6e- FT 23, (35.2% identity in 199aa)" FT /product="putative peroxisomal membrane protein" FT /fasta_file="fasta/c4G9.tab.seq.01734.out" FT misc_feature 2310119..2310124 FT /colour=2 FT /note="splice donor sequence, gtatgt" FT misc_feature 2310154..2310167 FT /colour=2 FT /note="splice branch and acceptor sequence, cttacgataattag" FT misc_feature 2310443..2310448 FT /colour=2 FT /note="splice donor sequence, gtacgt" FT misc_feature 2310519..2310535 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacataattgaac ag" FT misc_feature 2310559..2310564 FT /colour=2 FT /note="splice donor sequence, gtaaga" FT misc_feature 2310653..2310667 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacgcgaatctag" FT misc_feature 2310797..2310802 FT /colour=2 FT /note="splice donor sequence, gtacta" FT misc_feature 2310830..2310843 FT /colour=2 FT /note="splice branch and acceptor sequence, ttaacagtttttag" FT misc_feature 2310916..2310921 FT /colour=2 FT /note="splice donor sequence, gtaagg" FT misc_feature 2310971..2310983 FT /colour=2 FT /note="splice branch and acceptor sequence, ctaacatatttag" FT CDS join(2311906..2311918,2311979..2312109,2312159..2313040) FT /colour=7 FT /gene="SPAC4G9.15" FT /label=SPAC4G9.15 FT /note="SPAC4G9.15, len: 341, similar to SW:YB09_YEAST FT P38286, hypothetical protein, YBR159W, (43.3% ident ity in FT 328 aa overlap), some similar to SW:DHB3_HUMAN P3 7058 FT estradiol 17 beta-dehydrogenase 3, (34.5% identity in 229 FT aa overlap)" FT /product="putative short chain dehydrogenase; similar to FT S. cerevisiae YBR159W" FT /fasta_file="fasta/c4G9.tab.seq.01735.out" FT misc_feature 2311919..2311924 FT /colour=2 FT /note="splice donor sequence, gtatata" FT misc_feature 2311964..2311978 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaatagacttttag" FT misc_feature 2312110..2312115 FT /colour=2 FT /note="splice donor sequence, gtaaga" FT misc_feature 2312146..2312158 FT /colour=2 FT /note="splice branch and acceptor sequence, ctaacttctttag" FT misc_feature 2312189..2312749 FT /note="Match to PF00106 adh_short, short chain FT dehydrogenase Score 99.10" FT misc_feature 2312621..2312707 FT /colour=8 FT /note="PS00061 Short-chain alcohol dehydrogenase family FT sig nature" FT CDS complement(2313313..2313885) FT /colour=2 FT /gene="rpl9-1" FT /gene="SPAC4G9.16c" FT /label=rpl9-1 FT /note="SPAC4G9.16c, len:190" FT /product="60S ribosomal protein L9" FT /fasta_file="fasta/c4G9.tab.seq.01736.out" FT misc_feature complement(2313319..2313849) FT /colour=9 FT /note="Pfam match to entry PF00347 L6, Ribosomal protein FT L6" FT misc_feature complement(2313340..2313405) FT /colour=8 FT /note="PS00700 Ribosomal protein L6 signature 2" FT promoter complement(2313945..2313952) FT /colour=4 FT /note="Homol D box" FT promoter complement(2313965..2313974) FT /colour=4 FT /note="Homol E box" FT CDS complement(join(2314179..2314393,2314521..2315469)) FT /colour=7 FT /gene="SPAC4G9.17c" FT /label=SPAC4G9.17c FT /note="SPAC4G9.17c, len: 387, similar to SW:RT05_YEAST FT P337 59 putative mitochondrial 40S ribosomal (38.0% FT identity in 292 aa overlap)" FT /product="mitochondrial ribosomal protein S5" FT /fasta_file="fasta/c4G9.tab.seq.01737.out" FT misc_feature complement(join(2314269..2314393,2314521..2314773)) FT /note="Match to PF00333 Ribosomal_S5, Ribosomal protein S5 FT Score 105.41" FT misc_feature complement(2314394..2314407) FT /colour=2 FT /note="splice branch and acceptor sequence, ctaactaaatatag" FT intron complement(2314394..2314520) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(2314515..2314520) FT /colour=2 FT /note="splice donor sequence, gtatgt" FT misc_feature complement(2315994..2316230) FT /note="was SPAC4G9.18c, len:78 but now thought to be not FT coding" FT CDS 2317053..2317865 FT /colour=7 FT /gene="SPAC4G9.19" FT /label=SPAC4G9.19 FT /note="SPAC4G9.19, len:270, SIMILARITY:Mycoplasma FT pneumoniae., DNAJ_MYCPN, DNAJ protein., (390 aa), fasta FT scores: opt: 177, E():0.00047, (39.0% identity in 77 aa)" FT /product="DNAJ domain protein" FT /fasta_file="fasta/c4G9.tab.seq.01738.out" FT misc_feature 2317146..2317382 FT /colour=9 FT /note="Pfam match to entry PF00226 DnaJ, DnaJ domain" FT misc_feature 2317311..2317370 FT /colour=8 FT /note="PS00636 Nt-DNAJ domain signature" FT CDS complement(join(2318365..2319222,2319323..2319373)) FT /colour=7 FT /gene="SPAC4G9.20c" FT /label=SPAC4G9.20c FT /note="SPAC4G9.20c, len:302, may use upstream Met with FT alteRNAtive intron, SIMILARITY:Saccharomyces cerevisiae, FT Q12002, ymc1p., (307 aa), fasta scores: opt: 908, E():0, FT (49.6% identity in 282 aa)" FT /product="MC transporter of unknown specificity" FT /fasta_file="fasta/c4G9.tab.seq.01739.out" FT misc_feature complement(2318389..2319219) FT /note="Match to PF00153 mito_carr, Mitochondrial carrier FT proteins Score 293.64" FT misc_feature complement(2318854..2318880) FT /colour=8 FT /note="PS00215 Mitochondrial energy transfer proteins FT signa ture" FT misc_feature complement(2319139..2319165) FT /colour=8 FT /note="PS00215 Mitochondrial energy transfer proteins FT signa ture" FT misc_feature complement(2319223..2319235) FT /colour=2 FT /note="splice branch and acceptor sequence, ctaacttgtttag" FT misc_feature complement(2319223..2319623) FT /note="alteRNAtive intron prediction to use upstream FT initiator Met" FT misc_feature complement(2319317..2319322) FT /colour=2 FT /note="splice donor sequence, gtatct" FT misc_feature complement(2322765..2322780) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacggatgattta g" FT intron complement(2322765..2322812) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(2322801..2322887) FT /note="Match to PF00432 prenyltrans, Prenyltransferase and FT squalene oxidase repeats Score 22.99" FT misc_feature complement(2322807..2322812) FT /colour=2 FT /note="splice donor sequence, gtatgg" FT misc_feature complement(2322906..2323031) FT /note="Match to PF00432 prenyltrans, Prenyltransferase and FT squalene oxidase repeats Score 43.05" FT misc_feature complement(2322942..2322986) FT /colour=8 FT /note="PS01074 Terpene synthases signature" FT misc_feature complement(2323431..2323445) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaactttaatttag" FT intron complement(2323431..2323486) FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(2323481..2323486) FT /colour=2 FT /note="splice donor sequence, gtgcgc (cag|gtgcgc donor FT sequ ence supported by homology)" FT misc_feature 2323821..2323876 FT /note="nominal overlap with cosmid SPAC13G7, EM:Z69729 S. FT pombe chromosome 1" FT misc_feature 2323821..2323876 FT /note="nominal overlap with cosmid SPAC4G9, EM:Z69727 FT S.pombe chromosome 1" FT misc_feature complement(2324261..2324380) FT /note="Match to PF00432 prenyltrans, Prenyltransferase and FT squalene oxidase repeats Score 41.96" FT CDS complement(2325495..2327429) FT /colour=7 FT /gene="SPAC13G7.02c" FT /label=SPAC13G7.02c FT /note="SPAC13G7.02c, len:643" FT /product="heat shock protein 70 family" FT /fasta_file="fasta/c13G7.tab.seq.01991.out" FT misc_feature complement(2325600..2327417) FT /note="Match to PF00012 HSP70, Hsp70 protein Score 1396.33" FT misc_feature complement(2326392..2326436) FT /colour=8 FT /note="PS01036 Heat shock hsp70 proteins family signature FT 3" FT misc_feature complement(2326806..2326847) FT /colour=8 FT /note="PS00329 Heat shock hsp70 proteins family signature FT 2" FT misc_feature complement(2327388..2327411) FT /colour=8 FT /note="PS00297 Heat shock hsp70 proteins family signature FT 1" FT CDS join(2328655..2328809,2328869..2328975,2329026..2329600) FT /colour=10 FT /gene="SPAC13G7.03" FT /label=SPAC13G7.03 FT /note="SPAC13G7.03, len:278, LOW SIMILARITY to C-term of FT histones:Homo sapiens, H1B_HUMAN, histone h1b, (218 aa), FT fasta scores: opt: 186, E():0.00059, (36.8% identity in FT 117 aa)" FT /product="hypothetical protein; very low similar to the C FT term of histones, some conserved residues; putative FT ATP/GTP-binding site motif A" FT /fasta_file="fasta/c13G7.tab.seq.01992.out" FT misc_feature 2328810..2328815 FT /colour=2 FT /note="splice donor sequence, gtattt" FT misc_feature 2328849..2328868 FT /colour=2 FT /note="splice donor sequence, ctaatatcgtgcctttgtag" FT misc_feature 2328976..2328981 FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature 2329006..2329025 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ttaactcaaacatgc attag" FT misc_feature 2329247..2329270 FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A" FT CDS complement(2330198..2332468) FT /colour=10 FT /gene="SPAC13G7.04c" FT /label=SPAC13G7.04c FT /note="SPAC13G7.04c, len:755, SIMILARITY: low to FT Emericella nidulans, E1339447, pali protein., (601 aa), FT fasta scores: opt: 281, E():1.5e-08, (23.0% identity in FT 578 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT TOS7; Pfam-B_7111; contains 3 predicted transmembrane FT helices; predicted N-terminal signal sequence; possibly FT fungal specific" FT /fasta_file="fasta/c13G7.tab.seq.01993.out" FT CDS 2335021..2336634 FT /EC_number="2.3.1.26" FT /colour=7 FT /gene="SPAC13G7.05" FT /label=SPAC13G7.05 FT /note="SPAC13G7.05, len:536, SIMILARITY:Saccharomyces FT cerevisiae, Q12673, acyl-coa:sterol acyltransferase, (642 FT aa), fasta scores: opt: 728, E():0, (33.0% identity in 461 FT aa)" FT /product="acyl-coa-sterol acyltransferase; similar to S. FT cerevisiae ARE2" FT /fasta_file="fasta/c13G7.tab.seq.01994.out" FT CDS 2337405..2338205 FT /EC_number="1.8.99.4" FT /colour=7 FT /gene="SPAC13G7.06" FT /label=SPAC13G7.06 FT /note="SPAC13G7.06, len:265, SIMILARITY:Saccharomyces FT cerevisiae, MT16_YEAST, phosphoadenosine phosphosulfate FT reductase, (261 aa), fasta scores: opt: 885, E():0, (55.1% FT identity in 247 aa)" FT /product="phosphoadenosine phosphosulfate reductase; FT similar to S. cerevisiae MET16" FT /fasta_file="fasta/c13G7.tab.seq.01995.out" FT CDS join(2338702..2338888,2338935..2339326) FT /colour=8 FT /gene="SPAC13G7.07" FT /label=SPAC13G7.07 FT /note="SPAC13G7.07, len:191" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c13G7.tab.seq.01996.out" FT misc_feature 2338889..2338894 FT /colour=2 FT /note="splice donor sequence, gtaggg" FT misc_feature 2338914..2338934 FT /colour=2 FT /note="splice donor sequence, ttaacttgcaattgaaattag" FT CDS complement(join(2340062..2340193,2340237..2341247, FT 2341370..2341567)) FT /colour=2 FT /gene="crb3" FT /gene="SPAC13G7.08c" FT /label=crb3 FT /note="SPAC13G7.08c, len:445" FT /product="DNA damage and replication checkpoint control FT protein; essential" FT /fasta_file="fasta/c13G7.tab.seq.01997.out" FT misc_feature complement(2340194..2340209) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacataattttta g" FT misc_feature complement(2340231..2340236) FT /colour=2 FT /note="splice donor sequence, gtatgt" FT misc_feature complement(2340471..2340515) FT /colour=8 FT /note="PS00678 Trp-Asp (WD) repeats signature" FT misc_feature complement(2340828..2340872) FT /colour=8 FT /note="PS00678 Trp-Asp (WD) repeats signature" FT misc_feature complement(2340831..2340938) FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 29.98" FT misc_feature complement(2341248..2341262) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaatacaagtgtag" FT misc_feature complement(2341364..2341369) FT /colour=2 FT /note="splice donor sequence, gtaggt" FT CDS complement(2342294..2342701) FT /colour=8 FT /gene="SPAC13G7.09c" FT /label=SPAC13G7.09c FT /note="SPAC13G7.09c, len:134" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c13G7.tab.seq.01998.out" FT CDS join(2343422..2343637,2343725..2343807,2343866..2344739) FT /colour=10 FT /gene="SPAC13G7.10" FT /label=SPAC13G7.10 FT /note="SPAC13G7.10, len:389" FT /product="DNA-binding protein; Myb family DNA-binding FT protein" FT /fasta_file="fasta/c13G7.tab.seq.01999.out" FT misc_feature 2343638..2343643 FT /colour=2 FT /note="splice donor sequence, gtatgt" FT misc_feature 2343711..2343724 FT /colour=2 FT /note="splice branch and acceptor sequence, ctaaccgtctctag" FT misc_feature 2343808..2343813 FT /colour=2 FT /note="splice donor sequence, gtatgc" FT misc_feature 2343848..2343865 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaatgggtatatgc aag" FT misc_feature 2343993..2344127 FT /note="Match to PF00249 myb_DNA-binding, Myb-like DNA- FT binding domain Score 35.16" FT CDS join(2344863..2345025,2345062..2345275,2345377..2345809) FT /colour=8 FT /gene="SPAC13G7.11" FT /label=SPAC13G7.11 FT /note="SPAC13G7.11, len:280" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c13G7.tab.seq.02000.out" FT intron 2345026..2345061 FT /colour=2 FT /note="confirmed intron" FT misc_feature 2345276..2345281 FT /colour=2 FT /note="splice donor sequence, gtacgt" FT intron 2345276..2345376 FT /colour=2 FT /note="confirmed intron" FT misc_feature 2345358..2345376 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacttagacttgt taag" FT CDS complement(2346143..2347513) FT /EC_number="2.7.1.32" FT /colour=7 FT /gene="SPAC13G7.12c" FT /label=SPAC13G7.12c FT /note="SPAC13G7.12c, len:455, SIMILARITY:Saccharomyces FT cerevisiae, KICH_YEAST, choline kinase, (582 aa), fasta FT scores: opt: 444, E():1.1e-22, (29.1% identity in 494 aa)" FT /product="putative choline kinase; similar to S. FT cerevisiae CKI1" FT /fasta_file="fasta/c13G7.tab.seq.02001.out" FT misc_feature complement(2348653..2348817) FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 37.06" FT misc_feature 2348734..2348829 FT /note="nominal overlap with cosmid SPAC6C3, EM:Z69731 FT S.pombe chromosome 1" FT misc_feature 2348734..2348829 FT /note="nominal overlap with cosmid SPAC13G7, EM:Z69729 FT S.pombe chromosome 1" FT misc_feature complement(2349457..2349675) FT /note="Match to PF00076 rrm, RNA recognition motif. FT (a.k.a. RRM, RBD, or RNP domain) Score 46.07" FT misc_feature 2349916..2354320 FT /note="low complexity gene free region" FT CDS complement(2354321..2354839) FT /colour=10 FT /gene="SPAC6C3.02c" FT /label=SPAC6C3.02c FT /note="SPAC6C3.02c, len:172, SIMILARITY:Caenorhabditis FT elegans., YQ5B_CAEEL, hypothetical 15.4 kD protein, (154 FT aa), fasta scores: opt: 268, E():4.6e-06, (35.8% identity FT in 179 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YMR002W" FT /fasta_file="fasta/c6C3.tab.seq.01792.out" FT CDS complement(2356008..2356310) FT /colour=9 FT /gene="SPAC6C3.03c" FT /label=SPAC6C3.03c FT /note="SPAC6C3.03c, len:99" FT /product="very hypothetical protein" FT /fasta_file="fasta/c6C3.tab.seq.01793.out" FT CDS 2358351..2359772 FT /colour=7 FT /gene="cit1" FT /gene="SPAC6C3.04" FT /label=cit1 FT /note="SPAC6C3.04, len:473, SIMILARITY:Emericella nidulans, FT CISY_EMENI, citrate synthase, mitochondrial , (474 aa), FT fasta scores: opt: 2227, E():0, (70.2% identity in 473 aa)" FT /product="putative citrate synthase, mitochondrial" FT /fasta_file="fasta/c6C3.tab.seq.01794.out" FT misc_feature 2358588..2359724 FT /note="Match to PF00285 citrate_synt, Citrate synthase FT Score 688.45" FT CDS 2360831..2361640 FT /colour=8 FT /gene="SPAC6C3.05" FT /label=SPAC6C3.05 FT /note="SPAC6C3.05, len:269" FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c6C3.tab.seq.01795.out" FT CDS complement(join(2361796..2361932,2361982..2362061, FT 2362113..2362239,2362281..2365038)) FT /colour=7 FT /gene="SPAC6C3.06c" FT /label=SPAC6C3.06c FT /note="SPAC6C3.06c, len:1033, SIMILARITY:Saccharomyces FT cerevisiae, ATC7_YEAST, putative calcium-transporting FT atpase 7, (1151 aa), fasta scores: opt: 2117, E():0, FT (52.2% identity in 982 aa)" FT /product="P-type calcium ATPase" FT /fasta_file="fasta/c6C3.tab.seq.01796.out" FT misc_feature complement(2361933..2361945) FT /colour=6 FT /note="ctaatacatatag, splice branch and acceptor" FT misc_feature complement(2361976..2361981) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(2362062..2362074) FT /colour=6 FT /note="ctaacgacgttag, splice branch and acceptor" FT misc_feature complement(2362107..2362112) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(2362240..2362252) FT /colour=6 FT /note="cttacaaacatag, splice branch and acceptor" FT misc_feature complement(2362275..2362280) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(2363020..2363169) FT /note="Match to PF00122 E1-E2_ATPase, E1-E2 ATPases Score FT 27.19" FT misc_feature complement(2363764..2363850) FT /note="Match to PF00122 E1-E2_ATPase, E1-E2 ATPases Score FT 22.74" FT misc_feature complement(2364412..2364492) FT /colour=9 FT /note="Pfam match to entry PF00122 E1-E2_ATPase, E1-E2 FT ATPase, score 1.00, E-value 15" FT CDS 2365710..2367257 FT /colour=10 FT /gene="SPAC6C3.07" FT /label=SPAC6C3.07 FT /note="SPAC6C3.07, len:515" FT /product="hypothetical protein; ankaryin repeats (5)" FT /fasta_file="fasta/c6C3.tab.seq.01797.out" FT CDS join(2367851..2367955,2368094..2368693) FT /colour=10 FT /gene="SPAC6C3.08" FT /label=SPAC6C3.08 FT /note="SPAC6C3.08, len:234, SIMILARITY:Saccharomyces FT cerevisiae, YG4X_YEAST, hypothetical 25.6 kD protein, (228 FT aa), fasta scores: opt: 370, E():1e-17, (34.8% identity in FT 224 aa)" FT /product="ankyrin repeat protein; similar to S. cerevisiae FT NAS6 which interacts with 26S proteasome" FT /fasta_file="fasta/c6C3.tab.seq.01798.out" FT misc_feature 2367956..2367961 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2368074..2368093 FT /colour=6 FT /note="ctaatcacaaatattgttag, splice branch and acceptor" FT misc_feature 2368100..2368195 FT /note="Match to PF00023 ank, Ank repeat Score 23.47" FT misc_feature 2368166..2368261 FT /colour=9 FT /note="Pfam match to entry PF00023 ank, Ank repeat, score FT 15.90, E-value 0.99" FT misc_feature 2368307..2368366 FT /note="Match to PF00023 ank, Ank repeat Score 25.31" FT misc_feature 2368406..2368492 FT /note="Match to PF00023 ank, Ank repeat Score 30.48" FT misc_feature 2368508..2368600 FT /note="Match to PF00023 ank, Ank repeat Score 20.60" FT CDS join(2369560..2369652,2369697..2369844,2369895..2369951, FT 2370068..2370626,2370667..2370817) FT /colour=10 FT /gene="SPAC6C3.09" FT /label=SPAC6C3.09 FT /note="SPAC6C3.09, len:335, SIMILARITY:Homo sapiens, FT O75818, ribonuclease p protein subunit p40., (302 aa), FT fasta scores: opt: 164, E():0.00061, (23.9% identity in FT 247 aa)" FT /product="hypothetical protein; with low similarity to FT ribonuclease p protein subunit p40; no apparent S. FT cerevisiae ortholog" FT /fasta_file="fasta/c6C3.tab.seq.00021.out" FT misc_feature 2369653..2369658 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT intron 2369653..2369700 FT /note="confirmed; probably a mis-splice variant?, as makes FT an out of frame product. Also uses 2nd AG when first would FT be preferred" FT misc_feature 2369680..2369696 FT /colour=6 FT /note="ctaataataaaacttag, splice branch and acceptor" FT misc_feature 2369845..2369850 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT intron 2369845..2369894 FT /note="confirmed intron" FT misc_feature 2369877..2369894 FT /colour=6 FT /note="ctaattttttcaatatag, splice branch and acceptor" FT misc_feature 2369952..2369957 FT /colour=6 FT /note="gtgagt, splice donor sequence" FT intron 2369952..2370067 FT /note="confirmed intron" FT misc_feature 2370053..2370067 FT /colour=6 FT /note="cttacagttaataag, splice branch and acceptor" FT misc_feature 2370627..2370632 FT /colour=6 FT /note="gtaata, splice donor sequence" FT misc_feature 2370655..2370666 FT /colour=6 FT /note="ctaacagtaaag, splice branch and acceptor" FT misc_feature complement(2372189..2372212) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A" FT misc_feature 2373268..2373376 FT /note="nominal overlap with cosmid SPAC17G8, EM:Z69795 FT S.pombe chromosome 1" FT misc_feature 2373268..2373376 FT /note="nominal overlap with cosmid SPAC6C3, EM:Z69731 FT S.pombe chromosome 1" FT CDS 2374491..2375483 FT /colour=7 FT /gene="SPAC17G8.02" FT /label=SPAC17G8.02 FT /note="SPAC17G8.02, len:330, SIMILARITY:Escherichia coli., FT YBEK_ECOLI, hypothetical 33.8 kD protein in leus-gltl FT intergenic region., (311 aa), fasta scores: opt: 664, FT E():0, (38.2% identity in 314 aa)" FT /product="putative uridine ribohydrolase" FT /fasta_file="fasta/c17G8.tab.seq.01260.out" FT misc_feature 2374536..2375474 FT /colour=9 FT /note="Pfam match to entry PF01156 IU_nuc_hydro, Inosine- FT uridine preferring nucleoside hydrolase," FT CDS complement(2376108..2376707) FT /colour=7 FT /gene="SPAC17G8.03c" FT /label=SPAC17G8.03c FT /note="SPAC17G8.03c, len:199, SIMILARITY:Homo sapiens, FT Q14919, nc2 alpha subunit., (205 aa), fasta scores: opt: FT 376, E():1e-15, (38.8% identity in 165 aa)" FT /product="putative transcriptional repressor; putative FT basal inhibitor of class II transcription; possibly binds FT to TBP and represses RNAP II during assembly of the pre- FT initiation complex; similar to S. cerevisiae BUR6" FT /fasta_file="fasta/c17G8.tab.seq.01261.out" FT CDS complement(join(2378228..2378290,2378381..2378557, FT 2378684..2378756,2378801..2378946)) FT /colour=7 FT /gene="SPAC17G8.04c" FT /label=SPAC17G8.04c FT /note="SPAC17G8.04c, len:152, SIMILARITY:Saccharomyces FT cerevisiae, AR16_YEAST, arp2/3 complex 16 kD subunit, (154 FT aa), fasta scores: opt: 245, E():3.7e-10, (29.4% identity FT in 153 aa)" FT /product=" ARP2/3 actin-organizing complex; involved in FT actin assembly and function; similar to S. cerevisiae FT ARC15" FT /fasta_file="fasta/c17G8.tab.seq.01262.out" FT misc_feature complement(2378291..2378307) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaatacggttttgt ag" FT misc_feature complement(2378375..2378380) FT /colour=2 FT /note="splice donor sequence, gtaact" FT misc_feature complement(2378558..2378570) FT /colour=2 FT /note="splice branch and acceptor sequence, ttaacttttttag" FT misc_feature complement(2378678..2378683) FT /colour=2 FT /note="splice donor sequence, gtatgt" FT misc_feature complement(2378757..2378769) FT /colour=2 FT /note="splice branch and acceptor sequence, ttaattaaaatag" FT misc_feature complement(2378795..2378800) FT /colour=2 FT /note="splice donor sequence, gtatgt" FT CDS join(2380084..2380147,2380217..2380695) FT /colour=8 FT /gene="SPAC17G8.05" FT /label=SPAC17G8.05 FT /note="SPAC17G8.05, len:180," FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c17G8.tab.seq.01263.out" FT misc_feature 2380148..2380153 FT /colour=2 FT /note="splice donor sequence, gtaagc" FT misc_feature 2380200..2380216 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaactttgaatttc ag" FT CDS complement(2381047..2382843) FT /EC_number="4.2.1.9" FT /colour=2 FT /gene="ilv3" FT /gene="SPAC17G8.06c" FT /label=ilv3 FT /note="SPAC17G8.06c, len:598, SIMILARITY:Saccharomyces FT cerevisiae, ILV3_YEAST, dihydroxy-acid dehydratase , (585 FT aa), fasta scores: opt: 2497, E():0, (64.5% identity in FT 572 aa)" FT /product="dihydroxy-acid dehydratase; mitochondrial; FT similar to S. cerevisiae ILV3" FT /fasta_file="fasta/c17G8.tab.seq.01264.out" FT misc_feature complement(2381182..2382549) FT /colour=9 FT /note="Pfam match to entry PF00920 ILVD_EDD, Dehydratase FT family," FT misc_feature complement(2381302..2381337) FT /colour=8 FT /note="PS00887 Dihydroxy-acid and 6-phosphogluconate FT dehydr atases signature 2" FT misc_feature complement(2382343..2382375) FT /colour=8 FT /note="PS00886 Dihydroxy-acid and 6-phosphogluconate FT dehydr atases signature 1" FT CDS 2384077..2384730 FT /colour=7 FT /gene="SPAC17G8.07" FT /label=SPAC17G8.07 FT /note="SPAC17G8.07, len:217, SIMILARITY:Saccharomyces FT cerevisiae, YNK7_YEAST, hypothetical kD protein , (226 aa), FT fasta scores: opt: 576, E():3.2e-31, (44.9% identity in FT 225 aa)" FT /product="putative transcription factor; similar to S. FT cerevisiae YAF9; putative chromatin associated; human FT homologue GAS41 is glioma amplified; predicted C-terminal FT coiled-coil region" FT /fasta_file="fasta/c17G8.tab.seq.01265.out" FT CDS complement(join(2385024..2385830,2386102..2386158)) FT /colour=10 FT /gene="SPAC17G8.08c" FT /label=SPAC17G8.08c FT /note="SPAC17G8.08c, len:287, SIMILARITY:Saccharomyces FT cerevisiae, YB37_YEAST, hypothetical 30.3 kD protein in FT mba1-rps9b intergenic region., (280 aa), fasta scores: FT opt: 545, E():1.4e-28, (32.9% identity in 286 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YBR187W; UPF0016 family; predicted N-terminal signal FT sequence; contains 7 predicted transmembrane helices" FT /fasta_file="fasta/c17G8.tab.seq.01266.out" FT misc_feature complement(2385298..2386023) FT /colour=9 FT /note="Pfam match to entry PF01169 UPF0016, FT Uncharacterized protein family UPF0016," FT misc_feature complement(2385831..2385845) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacactactttag" FT misc_feature complement(2386096..2386101) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT CDS join(2387037..2387132,2387252..2387373,2387439..2387607) FT /colour=10 FT /gene="SPAC17G8.09" FT /label=SPAC17G8.09 FT /note="SPAC17G8.09, len:132," FT /product="hypothetical protein; similar to S. cerevisiae FT YBR258C" FT /fasta_file="fasta/c17G8.tab.seq.01267.out" FT misc_feature 2387145..2387150 FT /colour=2 FT /note="splice donor sequence, gtaggg" FT misc_feature 2387237..2387251 FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacatcgcctcag" FT misc_feature 2387374..2387379 FT /colour=2 FT /note="splice donor sequence, gtaagc" FT misc_feature 2387427..2387438 FT /colour=2 FT /note="splice branch and acceptor sequence, ctaacccataag" FT CDS complement(2388246..2389049) FT /colour=2 FT /gene="dma1" FT /gene="SPAC17G8.10c" FT /label=dma1 FT /note="SPAC17G8.10c, len:267" FT /product="spindle assembly checkpoint component; protein FT to prevent septum formation and premature exit from FT mitosis if spindle function is compromised" FT /fasta_file="fasta/c17G8.tab.seq.01268.out" FT misc_feature complement(2388639..2388809) FT /colour=9 FT /note="Pfam match to entry PF00498 FHA, Forkhead- FT associated (FHA) domain," FT CDS complement(2390119..2391189) FT /colour=7 FT /gene="SPAC17G8.11c" FT /label=SPAC17G8.11c FT /note="SPAC17G8.11c, len:356, SIMILARITY:Saccharomyces FT cerevisiae, YB11_YEAST, hypothetical 44.4 kD protein in FT cdc28-arl1 intergenic region., (376 aa), fasta scores: FT opt: 895, E():0, (42.9% identity in 296 aa)" FT /product="similar to S. cerevisiae SUR1; possibly required FT for the synthesis of mannosylated sphingolipids" FT /fasta_file="fasta/c17G8.tab.seq.01269.out" FT misc_RNA 2392072..2392317 FT /colour=3 FT /note="mRNA not associated with an ORF" FT misc_RNA 2392319..2392429 FT /colour=3 FT /note="mRNA not associated with an ORF" FT CDS 2393244..2395070 FT /colour=8 FT /gene="SPAC17G8.12" FT /label=SPAC17G8.12 FT /note="SPAC17G8.12, len:608," FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c17G8.tab.seq.01270.out" FT misc_feature 2394903..2394932 FT /colour=8 FT /note="PS00422 Granins signature 1" FT CDS complement(join(2395123..2395803,2395851..2395940, FT 2396057..2396509)) FT /colour=7 FT /gene="SPAC17G8.13c" FT /label=SPAC17G8.13c FT /note="SPAC17G8.13c, len:407, SIMILARITY:Homo sapiens, FT AAC99368, histone acetyltransferase., (611 aa), fasta FT scores: opt: 1005, E():0, (55.4% identity in 280 aa)" FT /product="putative MYST-family acetyltransferase" FT /fasta_file="fasta/c17G8.tab.seq.01271.out" FT misc_feature complement(2395804..2395820) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ttgatgtttttcctt ag" FT intron complement(2395804..2395850) FT /note="confirmed intron by BLAST homology" FT misc_feature complement(2395845..2395850) FT /colour=2 FT /note="splice donor sequence, gtaagt" FT misc_feature complement(2395941..2395953) FT /colour=2 FT /note="splice branch and acceptor sequence, ctaacataatcag" FT intron complement(2395941..2396056) FT /note="confirmed intron from BLAST homology" FT misc_feature complement(2396051..2396056) FT /colour=2 FT /note="splice donor sequence, gtaaac" FT misc_feature complement(2397173..2397187) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaacgatcgattag" FT misc_feature complement(2397212..2397217) FT /colour=2 FT /note="splice donor sequence, gtatga" FT misc_feature complement(2397269..2397463) FT /colour=9 FT /note="Pfam match to entry PF00433 pkinase_C, protein FT kinase C terminal domain," FT misc_feature complement(2397402..2397417) FT /colour=2 FT /note="splice branch and acceptor sequence, FT ctaattcaaaaaata g" FT misc_feature complement(2397437..2397442) FT /colour=2 FT /note="splice donor sequence, gtatgc" FT misc_feature complement(2397464..2398243) FT /colour=9 FT /note="Pfam match to entry PF00069 pkinase, Eukaryotic FT protein kinase domain," FT misc_feature complement(2397632..2397644) FT /colour=2 FT /note="splice branch and acceptor sequence, ctaacgaaaatag" FT misc_feature complement(2397670..2397675) FT /colour=2 FT /note="splice donor sequence, gtaagg" FT misc_feature complement(2397787..2397825) FT /colour=8 FT /note="PS00108 Serine/Threonine protein kinases active- FT site signature" FT misc_feature complement(2397878..2397889) FT /colour=2 FT /note="splice branch and acceptor sequence, ttaaccccatag" FT misc_feature complement(2397927..2397932) FT /colour=2 FT /note="splice donor sequence, gtagta" FT misc_feature complement(2398127..2398225) FT /colour=8 FT /note="PS00107 protein kinases ATP-binding region FT signature" FT misc_feature complement(2398643..2398753) FT /colour=8 FT /note="PS00652 TNFR/NGFR family cysteine-rich region FT signat ure" FT misc_feature complement(2398643..2398792) FT /colour=9 FT /note="Pfam match to entry PF00130 DAG_PE-bind, Phorbol FT esters/diacylglycerol binding domain (C1 domain)," FT misc_feature complement(2398850..2398993) FT /colour=9 FT /note="Pfam match to entry PF00130 DAG_PE-bind, Phorbol FT esters/diacylglycerol binding domain (C1 domain)," FT misc_feature 2399820..2399956 FT /note="nominal overlap with cosmid SPAC22H10, EM:Z69730 FT S.pombe chromosome 1" FT misc_feature 2399820..2399956 FT /note="nominal overlap with cosmid SPAC17G8, EM:Z69795 S. FT pombe chromosome 1" FT CDS join(2401368..2401485,2401553..2401641,2401779..2402048) FT /colour=10 FT /gene="SPAC22H10.02" FT /label=SPAC22H10.02 FT /note="SPAC22H10.02, len:158" FT /product="hypothetical protein; similar to N. crassa FT B21O8.090; no apparent S. cerevisiae ortholog" FT /fasta_file="fasta/c22H10.tab.seq.00028.out" FT misc_feature 2401486..2401491 FT /colour=6 FT /note="gtaagc, splice donor sequence" FT misc_feature 2401537..2401552 FT /colour=6 FT /note="ctaactgttgaactag, splice branch and acceptor" FT misc_feature 2401642..2401647 FT /colour=6 FT /note="gtaggt, splice donor sequence" FT misc_feature 2401761..2401778 FT /colour=6 FT /note="ctaactttattggtttag, splice branch and acceptor" FT CDS complement(join(2402820..2402939,2402979..2403031, FT 2403089..2403259,2403302..2403420,2403468..2403637, FT 2403678..2405899,2405956..2406061)) FT /colour=2 FT /gene="kap114" FT /gene="SPAC22H10.03c" FT /label=kap114 FT /note="SPAC22H10.03c, len:986, SIMILARITY:Saccharomyces FT cerevisiae, YGZ1_YEAST, hypothetical 113.9 kD protein in FT rtf1-cse1 intergenic region., (1004 aa), fasta scores: FT opt: 535, E():1.4e-26, (23.4% identity in 1049 aa)" FT /product="putative ranbp7-importin-beta-cse1p family FT protein; similar to S. cerevisiae KAP114" FT /fasta_file="fasta/c22H10.tab.seq.00032.out" FT misc_feature complement(2402940..2402952) FT /colour=6 FT /note="ctaacatttttag, splice branch and acceptor" FT misc_feature complement(2402973..2402978) FT /colour=6 FT /note="gtgggt, splice donor sequence" FT misc_feature complement(2403032..2403049) FT /colour=6 FT /note="ttaacgaattgtccaaag, splice branch and acceptor" FT misc_feature complement(2403083..2403088) FT /colour=6 FT /note="gtacgc, splice donor sequence" FT misc_feature complement(2403260..2403273) FT /colour=6 FT /note="ttaaccaaaactag, splice branch and acceptor" FT misc_feature complement(2403296..2403301) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(2403421..2403432) FT /colour=6 FT /note="ctaacctgaaag, splice branch and acceptor" FT misc_feature complement(2403462..2403467) FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature complement(2403638..2403652) FT /colour=6 FT /note="ctgacttttatttag, splice branch and acceptor" FT misc_feature complement(2403672..2403677) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature complement(2405736..2405762) FT /colour=8 FT /note="PS00215 Mitochondrial energy transfer proteins FT signa ture" FT misc_feature complement(2405900..2405918) FT /colour=6 FT /note="ctaactatcttttacgaag, splice branch and acceptor" FT misc_feature complement(2405950..2405955) FT /colour=6 FT /note="gtatgc, splice donor sequence" FT CDS join(2407031..2407191,2407258..2407328,2407441..2408132) FT /EC_number="3.1.3.16" FT /colour=7 FT /gene="SPAC22H10.04" FT /label=SPAC22H10.04 FT /note="SPAC22H10.04, len:307, SIMILARITY:Dictyostelium FT discoideum, AAD43137, protein phosphatase 4 catalytic FT subunit., (305 aa), fasta scores: opt: 1274, E():0, (59.7% FT identity in 305 aa)" FT /product="serine/threonine protein phosphatase; member of FT the PPP family of protein phosphatases; related to PP2A FT phosphatases; possibly involved in involved in glycogen FT accumulation; similar to S. cerevisiae PPG1" FT /fasta_file="fasta/c22H10.tab.seq.00031.out" FT misc_feature join(2407040..2407191,2407258..2407328,2407441..2408072) FT /note="Match to PF00149 STphosphatase, Ser/Thr protein FT phosphatase Score 559.35" FT misc_feature 2407192..2407197 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 2407242..2407257 FT /colour=6 FT /note="cttacaaagtatatag, splice branch and acceptor" FT misc_feature 2407329..2407334 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2407427..2407440 FT /colour=6 FT /note="ctaactatttgaag, splice branch and acceptor" FT misc_feature 2407530..2407547 FT /colour=8 FT /note="PS00125 Serine/threonine specific protein FT phosphatas es signature" FT CDS complement(join(2408404..2409702,2409848..2409919)) FT /colour=7 FT /gene="SPAC22H10.05c" FT /label=SPAC22H10.05c FT /note="SPAC22H10.05c, len:456, SIMILARITY:Saccharomyces FT cerevisiae, Q08685, chromosome xv reading frame orf FT yor250c., (445 aa), fasta scores: opt: 503, E():7.9e-27, FT (31.2% identity in 462 aa)" FT /product="putative cleavage and polyadenylation factor; CF FT IA component; similar to S. cerevisiae CLP1" FT /fasta_file="fasta/c22H10.tab.seq.00357.out" FT misc_feature complement(2409415..2409438) FT /colour=8 FT /note="PS00017 ATP/GTP-binding site motif A" FT misc_feature complement(2409703..2409715) FT /colour=6 FT /note="ctaacatgtttag, splice branch and acceptor" FT misc_feature complement(2409842..2409847) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS complement(2410996..2411277) FT /colour=9 FT /gene="SPAC22H10.06c" FT /label=SPAC22H10.06c FT /note="SPAC22H10.06c, len:93" FT /product="very hypothetical protein" FT /fasta_file="fasta/c22H10.tab.seq.00034.out" FT CDS 2411406..2411558 FT /colour=7 FT /gene="SPAC22H10.13" FT /label=SPAC22H10.13 FT /note="SPAC22H10.13, len:50, SIMILARITY: Cricetulus FT griseus, MT1_CRIGR, metallothionein-I (MT-I)., (61 aa), FT fasta scores: opt: 151, E(): 0.0011, (42.9% identity in 42 FT aa)" FT /product="putative metallothionein; possibly not real; may FT be spurious Pfam due to CYS" FT /fasta_file="fasta/c22H10.tab.seq.00030.out" FT misc_feature 2411421..2411555 FT /note="Match to PF00131 metalthio, Metallothionein Score FT 25.25" FT CDS join(2412848..2412856,2412910..2414511) FT /colour=2 FT /gene="scd2" FT /gene="ral3" FT /gene="SPAC22H10.07" FT /label=scd2 or ral3 FT /note="SPAC22H10.07, len:536" FT /product="involved in mating; involved in sporulation; FT involved in morphogenesis; similar to S. cerevisiae BEM1" FT /fasta_file="fasta/c22H10.tab.seq.00360.out" FT misc_feature 2412857..2412862 FT /colour=6 FT /note="gtatgc, splice donor sequence" FT misc_feature 2412896..2412909 FT /colour=6 FT /note="ttaaccatctctag, splice branch and acceptor" FT misc_feature 2412979..2413152 FT /note="Match to PF00018 SH3, Src homology domain 3 Score FT 74.51" FT misc_feature 2413177..2413215 FT /colour=8 FT /note="PS00018 EF-hand calcium-binding domain" FT misc_feature 2413279..2413446 FT /note="Match to PF00018 SH3, Src homology domain 3 Score FT 57.62" FT misc_feature 2413783..2414127 FT /note="Match to PF00787 PX, PX domain Score 103.93" FT CDS join(2415583..2416941,2416998..2417117) FT /colour=12 FT /gene="SPAC22H10.08" FT /label=SPAC22H10.08 FT /note="SPAC22H10.08, len:492, FT SIMILARITY:Schizosaccharomyces pombe, CAB53075, FT hypothetical 53.7 kD protein., (466 aa), fasta scores: FT opt: 1278, E():0, (43.5% identity in 460 aa)" FT /product="hypothetical protein; similar to S. pombe FT SPCC16A11.03C; possibly S. pombe specific" FT /fasta_file="fasta/c22H10.tab.seq.00361.out" FT misc_feature 2416942..2416947 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2416984..2416997 FT /colour=6 FT /note="ctaactagctctag, splice branch and acceptor" FT CDS 2417409..2419349 FT /colour=8 FT /gene="SPAC22H10.09" FT /label=SPAC22H10.09 FT /note="SPAC22H10.09, len:646" FT /product="hypothetical protein; sequence orphan; very low FT similarity to S. cerevisiae mei4 (21% in 304 AA)" FT /fasta_file="fasta/c22H10.tab.seq.00029.out" FT CDS join(2419762..2419916,2419955..2420223,2420266..2420365, FT 2420412..2420687,2420731..2421466) FT /colour=2 FT /gene="alp21" FT /gene="sto1" FT /gene="SPAC22H10.10" FT /label=alp21 FT /note="SPAC22H10.10, len:511" FT /product="required for microtubulae assembly; putative FT tubulin-specific chaperone; involved in formation of alpha- FT beta-tubulin heterodimer; null lethal; similar to S. FT cerevisiae PAC2" FT /fasta_file="fasta/c22H10.tab.seq.00363.out" FT misc_feature 2419917..2419922 FT /colour=6 FT /note="gtaaga, splice donor sequence" FT misc_feature 2419943..2419954 FT /colour=6 FT /note="ctaaactattag, splice branch and acceptor" FT misc_feature 2420224..2420229 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2420250..2420265 FT /colour=6 FT /note="ttaacggaatttgtag, splice branch and acceptor" FT misc_feature 2420366..2420371 FT /colour=6 FT /note="gcatgt, splice donor sequence" FT misc_feature 2420399..2420411 FT /colour=6 FT /note="ctaactctttcag, splice branch and acceptor" FT misc_feature 2420688..2420693 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2420720..2420730 FT /colour=6 FT /note="ctaatctaaag, splice branch and acceptor" FT misc_feature 2420918..2420944 FT /colour=8 FT /note="PS00215 Mitochondrial energy transfer proteins FT signa ture" FT CDS complement(2422046..2423935) FT /colour=10 FT /gene="SPAC22H10.11c" FT /label=SPAC22H10.11c FT /note="SPAC22H10.11c, len:629" FT /product="fungal conserved protein; Gaillardin et al" FT /fasta_file="fasta/c22H10.tab.seq.00364.out" FT CDS complement(join(2425091..2426291,2426377..2426498)) FT /colour=2 FT /gene="gdi1" FT /gene="sec19" FT /gene="SPAC22H10.12c" FT /label=gdi1 FT /note="SPAC22H10.12c, len:440, SIMILARITY:Saccharomyces FT cerevisiae, GDI1_YEAST, secretory pathway gdp dissociation FT inhibitor., (451 aa), fasta scores: opt: 1913, E():0, FT (61.4% identity in 446 aa)" FT /product="putative RAB recycling protein" FT /fasta_file="fasta/c22H10.tab.seq.00033.out" FT misc_feature complement(join(2425100..2426291,2426377..2426498)) FT /note="Match to PF00996 GDI, GDP dissociation inhibitor FT Score 1183.74" FT misc_feature complement(2426292..2426305) FT /colour=6 FT /note="ctaactcctcttag, splice branch and acceptor" FT misc_feature complement(2426371..2426376) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2426947..2427046 FT /note="nominal overlap with cosmid SPAC15F9, EM:Z68197 S. FT pombe chromosome 1" FT misc_feature 2426947..2427046 FT /note="nominal overlap with cosmid SPAC22H10, EM:Z69730 S. FT pombe chromosome 1" FT CDS complement(join(2427126..2427499,2427555..2427864)) FT /colour=8 FT /gene="SPAC15F9.01c" FT /label=SPAC15F9.01c FT /note="SPAC15F9.01c, len:227," FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c15F9.tab.seq.01648.out" FT misc_feature complement(2427500..2427512) FT /colour=6 FT /note="ttaacagctgtag, splice branch and acceptor" FT misc_feature complement(2427549..2427554) FT /colour=6 FT /note="gtgcgt, splice donor sequence" FT CDS join(2429097..2429163,2429205..2430138,2430193..2430211) FT /colour=7 FT /gene="SPAC15F9.02" FT /label=SPAC15F9.02 FT /note="SPAC15F9.02, len:339, SIMILARITY:Saccharomyces FT cerevisiae, SEH1_YEAST, nuclear pore protein seh1., (349 FT aa), fasta scores: opt: 808, E():0, (41.6% identity in 344 FT aa)" FT /product="putative nuclear pore protein" FT /fasta_file="fasta/c15F9.tab.seq.01649.out" FT misc_feature 2429164..2429169 FT /colour=6 FT /note="gtaagg, splice donor sequence" FT misc_feature 2429193..2429204 FT /colour=6 FT /note="ctaattgtcaag, splice branch and acceptor" FT misc_feature 2429753..2429878 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 27.52" FT misc_feature 2429999..2430088 FT /note="Match to PF00400 WD40, WD domain, G-beta repeat FT Score 21.90" FT misc_feature 2430139..2430144 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2430179..2430192 FT /colour=6 FT /note="ctaacttgtgacag, splice branch and acceptor" FT misc_feature 2430543..2430856 FT /note="nominal overlap with cosmid SPAC1B9, EM:AL109951 S. FT pombe chromosome 1" FT misc_feature complement(2430744..2430758) FT /colour=6 FT /note="ttaacctttttgtag, splice branch and acceptor" FT misc_feature complement(2430816..2430821) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT intron 2430744..2430821 FT /colour=2 FT /note="confirmed intron" FT intron complement(2430744..2430821) FT /note="confirmed intron" FT source 2430543..2436539 FT /chromosome="I" FT /clone="cosmid c1B9" FT /map="IL" FT /organism="Schizosaccharomyces pombe" FT /strain="972h-" FT misc_feature 2430543..2430857 FT /note="nominal overlap with cosmid SPAC15F9 EM:Z68157 S. FT pombe chromosome 1" FT misc_feature complement(2430744..2430758) FT /note="ttaacctttttgtag, splice branch and acceptor" FT misc_feature complement(2430816..2430821) FT /note="gtaagt, splice donor sequence" FT misc_feature complement(2430924..2430940) FT /note="ttaactgtttggtatag, splice branch and acceptor" FT intron complement(2430924..2430975) FT /note="confirmed intron" FT misc_feature complement(2430970..2430975) FT /note="gtatga, splice donor sequence" FT misc_feature complement(2431048..2431065) FT /note="ctaacttatatatattag, splice branch and acceptor" FT intron complement(2431048..2431116) FT /note="confirmed intron" FT misc_feature complement(2431111..2431116) FT /note="gtatgc, splice donor sequence" FT misc_feature complement(2431200..2431213) FT /note="ctaatactctgcag, splice branch and acceptor" FT misc_feature complement(2431236..2431241) FT /note="gtaaga, splice donor sequence" FT CDS complement(join(2431977..2432169,2432220..2433186, FT 2433236..2433926,2434043..2434282)) FT /EC_number="2.7.1.37" FT /colour=2 FT /gene="sck1" FT /gene="SPAC1B9.02c" FT /label=sck1 FT /note="SPAC1B9.02c, len:696," FT /product="serine/threonine protein kinase; involved in FT trehalase activation" FT /fasta_file="fasta/c1B9.tab.seq.00973.out" FT misc_feature complement(2432170..2432188) FT /note="ctaaccttaaactttatag, splice branch and acceptor" FT misc_feature complement(2432214..2432219) FT /note="gtaagt, splice donor sequence" FT misc_feature complement(2432321..2432428) FT /note="Match to PF00433 pkinase_C, protein kinase C FT terminal domain Score 64.34" FT misc_feature complement(2432429..2433187) FT /note="Match to PF00069 pkinase, Eukaryotic protein kinase FT domain Score 265.75" FT misc_feature complement(2433187..2433200) FT /note="ctaactttatttag, splice branch and acceptor" FT misc_feature complement(2433230..2433235) FT /note="gtaaag, splice donor sequence" FT misc_feature complement(2433927..2433940) FT /note="ctaacctatcatag, splice branch and acceptor" FT misc_feature complement(2434037..2434042) FT /note="gtatgt, splice donor sequence" FT misc_feature 2436364..2436369 FT /note="gtatgt, splice donor sequence" FT misc_feature 2436407..2436421 FT /note="ctaatttaattatag, splice branch and acceptor" FT misc_feature 2436449..2436539 FT /note="nominal overlap with cosmid SPAC6B12 EM:Z98531 S. FT pombe chromosome 1" FT misc_feature 2436482..2436487 FT /note="gtatgt, splice donor sequence" FT misc_feature 2436526..2436539 FT /note="ctaattcttattta, splice branch and acceptor - FT missing AG in cosmid SPAC6B12" FT misc_feature 2436449..2436539 FT /note="nominal overlap with cosmid SPAC1B9, AL109951 S. FT pombe chromosome 1" FT CDS complement(2437980..2443646) FT /colour=10 FT /gene="SPAC6B12.02c" FT /label=SPAC6B12.02c FT /note="SPAC6B12.02c, len:1888," FT /product="hypothetical protein; similar to N. crassa FT B8B20.20" FT /fasta_file="fasta/c6B12.tab.seq.01289.out" FT CDS complement(2443905..2444813) FT /colour=8 FT /gene="SPAC6B12.03c" FT /label=SPAC6B12.03c FT /note="SPAC6B12.03c, len:302," FT /product="hypothetical protein; sequence orphan" FT /fasta_file="fasta/c6B12.tab.seq.01290.out" FT LTR 2445181..2445536 FT /colour=4 FT /note="retrotransposon; LTR; Tf1-107- like." FT CDS complement(2446458..2447723) FT /colour=7 FT /gene="SPAC6B12.04c" FT /label=SPAC6B12.04c FT /note="SPAC6B12.04c, len:421, SIMILARITY:Saccharomyces FT cerevisiae, YJG0_YEAST, hypothetical aminotransferase FT yjl060w, (444 aa), fasta scores: opt: 1380, E():0, (48.4% FT identity in 413 aa)" FT /product="putative aminotransferase (EC 2.6.1.-)" FT /fasta_file="fasta/c6B12.tab.seq.01291.out" FT misc_feature complement(2446476..2447711) FT /colour=9 FT /note="Pfam match to entry PF00155 aminotran_1, FT Aminotransferases class-I," FT CDS complement(2448408..2449295) FT /colour=10 FT /gene="SPAC6B12.05c" FT /label=SPAC6B12.05c FT /note="SPAC6B12.05c, len:295, SIMILARITY:Saccharomyces FT cerevisiae, YNV5_YEAST, hypothetical 36.2 kD protein in FT rap1-pex17 intergenic region., (320 aa), fasta scores: FT opt: 245, E():3.9e-06, (30.6% identity in 271 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YNL215W" FT /fasta_file="fasta/c6B12.tab.seq.01292.out" FT misc_feature complement(2450164..2450358) FT /note="SPAC6B12.06c, len:64, previously annotated as very FT hypothetical protein"" FT CDS complement(2451468..2452838) FT /colour=10 FT /gene="SPAC6B12.07c" FT /label=SPAC6B12.07c FT /note="SPAC6B12.07c, len:456," FT /product="zinc finger protein; zf-C3HC4 type (RING finger)" FT /fasta_file="fasta/c6B12.tab.seq.01293.out" FT misc_feature complement(2451687..2451716) FT /colour=8 FT /note="PS00518 zinc finger, C3HC4 type" FT CDS join(2455868..2455956,2456091..2457144) FT /colour=7 FT /gene="SPAC6B12.08" FT /label=SPAC6B12.08 FT /note="SPAC6B12.08, len:380, SIMILARITY:Helicobacter FT pylori, O25890, co-chaperone and heat shock protein, (369 FT aa), fasta scores: opt: 223, E():5.7e-06, (35.8% identity FT in 120 aa)" FT /product="zinc finger protein; zf-C2H2 type; DNAJ domain FT protein" FT /fasta_file="fasta/c6B12.tab.seq.01294.out" FT misc_feature 2455892..2456089 FT /colour=9 FT /note="Pfam match to entry PF00226 DnaJ, DnaJ domain," FT misc_feature 2455957..2455962 FT /colour=6 FT /note="gtatga, splice donor sequence" FT misc_feature 2456078..2456090 FT /colour=6 FT /note="ctaatcataacag, splice branch and acceptor" FT misc_feature 2456815..2456883 FT /colour=8 FT /note="PS00028 zinc finger, C2H2 type" FT CDS 2457697..2458611 FT /colour=10 FT /gene="SPAC6B12.09" FT /label=SPAC6B12.09 FT /note="SPAC6B12.09, len:304, SIMILARITY:Saccharomyces FT cerevisiae, Q12400, chromosome xv reading frame orf FT yol093w., (293 aa), fasta scores: opt: 579, E():2.8e-27, FT (39.3% identity in 295 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YOL093W" FT /fasta_file="fasta/c6B12.tab.seq.01295.out" FT CDS complement(join(2458846..2460136,2460221..2460294)) FT /colour=2 FT /gene="pri1" FT /gene="SPAC6B12.10c" FT /label=pri2 FT /note="SPAC6B12.10c, len:454, SIMILARITY:Saccharomyces FT cerevisiae, PRI1_YEAST, DNA primase small subunit, (409 FT aa), fasta scores: opt: 1131, E():0, (45.7% identity in FT 370 aa)" FT /product="DNA primase small subunit" FT /fasta_file="fasta/c6B12.tab.seq.01296.out" FT misc_feature complement(2460137..2460157) FT /colour=6 FT /note="tctctaacaattttcttatag, splice branch and acceptor" FT intron 2460137..2460220 FT /colour=2 FT /note="confirmed intron" FT misc_feature complement(2460215..2460220) FT /colour=6 FT /note="gtaagt, splice donor sequence" FT CDS join(2460675..2460804,2460861..2461493,2461534..2461784) FT /colour=10 FT /gene="SPAC6B12.11" FT /label=SPAC6B12.11 FT /note="SPAC6B12.11, len:337, SIMILARITY:some to, FT Saccharomyces cerevisiae, YKK8_YEAST, hypothetical 52.3 kD FT protein in hap4-aat1 intergenic region., (453 aa), fasta FT scores: opt: 178, E():0.0029, (23.7% identity in 316 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT SLD2 null lethal and involved in replication" FT /fasta_file="fasta/c6B12.tab.seq.01297.out" FT misc_feature 2460805..2460810 FT /colour=6 FT /note="gtatgt, splice donor sequence" FT misc_feature 2460844..2460860 FT /colour=6 FT /note="ctaacgaacttttttag, splice branch and acceptor" FT misc_feature 2461494..2461499 FT /colour=6 FT /note="gtaagg, splice donor sequence" FT misc_feature 2461522..2461533 FT /colour=6 FT /note="ctaacgttttag, splice branch and acceptor" FT tRNA 2462725..2462796 FT /note="tRNA Thr anticodon AGT, Cove score 75.01" FT CDS 2463069..2464946 FT /colour=7 FT /gene="SPAC6B12.12" FT /label=SPAC6B12.12 FT /note="SPAC6B12.12, len:625, SIMILARITY:Podospora FT anserina., O13499, tom70 gene., (614 aa), fasta scores: FT opt: 1609, E():0, (43.6% identity in 617 aa)" FT /product="putative mitochondrial proteins import receptor" FT /fasta_file="fasta/c6B12.tab.seq.01298.out" FT misc_feature 2463528..2463620 FT /colour=9 FT /note="Pfam match to entry PF00515 TPR, TPR Domain," FT misc_feature 2464320..2464406 FT /colour=9 FT /note="Pfam match to entry PF00515 TPR, TPR Domain," FT misc_feature 2464524..2464610 FT /colour=9 FT /note="Pfam match to entry PF00515 TPR, TPR Domain," FT CDS join(2465726..2465918,2466144..2466265) FT /colour=10 FT /gene="SPAC6B12.13" FT /label=SPAC6B12.13 FT /note="SPAC6B12.13, len:104, SIMILARITY:some to, Homo FT sapiens, O60927, hcg v., (126 aa), fasta scores: opt: 208, FT E():8.9e-08, (34.0% identity in 100 aa)" FT /product="hypothetical protein; similar to S. cerevisiae FT YFR003C protein which may physically interact with Glc7p FT and Ppz1p and is null lethal" FT /fasta_file="fasta/c6B12.tab.seq.01299.out" FT misc_feature 2465919..2465924 FT /colour=6 FT /note="gtaagt, splice donor sequence" FT misc_feature 2466114..2466143 FT /colour=6 FT /note="ttaacatgatgtgatgctaaatattactag, splice branch and FT ac ceptor" FT CDS complement(2466676..2467140) FT /colour=9 FT /gene="SPAC6B12.14c" FT /label=SPAC6B12.14c FT /note="SPAC6B12.14c, len:154," FT